The risk factors for hepatitis due to hepatitis B virus (HBV) reactivation in patients positive for hepatitis B surface antigen (HBsAg) treated with autologous hematopoietic cell transplantation (HCT) are unknown. We evaluated 137 consecutive patients (23 positive for HBsAg, 37 positive for hepatitis B surface antibody, and 77 negative for HBV) who underwent HCT. Serial serum ALT were measured before transplant and after transplant at 1 to 4 weekly intervals for the first year and then at 2 to 12 weekly intervals thereafter. Before HCT, basic core promoter (T1762/A1764) and precore (A1896) HBV variants were determined in HBsAg-positive and HBV DNA–positive (by polymerase chain reaction assay) patients by direct sequencing and serum HBV DNA quantitation using the Digene Hybrid Capture II assay. Cox proportional hazards analysis was used to assess the association between pretransplantation HBV virologic and host factors and occurrence of hepatitis due to HBV reactivation. After HCT, hepatitis due to HBV reactivation was more common in HBsAg-positive patients than in HBsAg-negative patients (hazard ratio, 33.3; 95% confidence interval [CI], 7.35-142.86;P < .0001). HBsAg-positive patients with detectable serum HBV DNA before HCT (on Digene assay) had a significantly higher risk of hepatitis due to HBV reactivation than HBsAg-positive patients with no detectable serum HBV DNA (adjusted hazard ratio, 9.35; 95% CI, 1.65-52.6; P = .012). Thus, we found that hepatitis due to HBV reactivation is common in HBsAg-positive patients undergoing autologous HCT. A high HBV DNA level (>105 copies/mL) was the most important risk factor for HBV reactivation, and its lowering by administration of nucleoside analogues before transplantation should be considered.

Introduction

Hepatitis due to reactivation of hepatitis B virus (HBV) is a well-recognized complication in patients with chronic HBV infection undergoing cytotoxic or immunosuppressive therapy. It has been observed in patients positive for hepatitis B surface antigen (HBsAg)1-6 and in HBsAg-negative patients who had HBV infection in the past (hepatitis B surface antibody [HBsAb], HBsAb positive and hepatitis B core antibody [HBcAb], and anti-HBc positive).7-11 

In the past few decades, hematopoietic cell transplantation (HCT) has become the standard treatment for various hematologic and oncologic problems.12 In areas such as Southeast Asia, where HBV infection is prevalent, HCT might be complicated by morbidity and mortality related to HBV.13 The median prevalence of HBsAg positivity in Asian Chinese patients undergoing HCT has been reported to be more than 10%.14 Hepatic complications related to HBV infection after HCT are primarily associated with HBV reactivation.2,5,10,11,13,15-17 The underlying pathogenesis of HBV reactivation is likely to be related to the intensive chemotherapy with or without total-body irradiation (TBI) required to ablate the recipients' marrow.18 Prospective serologic testing of patients with chronic HBV infection who have HBV reactivation after chemotherapy showed that immunosuppression enhances viral replication. This is reflected by increases in serum levels of hepatitis B e antigen (HBeAg) and HBV DNA polymerase and naive hepatocyte infection with HBV.6,18,19 Discontinuation of cytotoxic or immunosuppressive drugs restores immune function, resulting in rapid destruction of infected hepatocytes. Clinically, this may manifest as hepatitis and hepatic failure and even cause death.7,20-22 

Despite its clinical importance, few data are available on the incidence and risk factors for hepatitis due to HBV reactivation after chemotherapy or immunosuppression. In particular, relation between the various HBV virologic variables and HBV reactivation is unclear. Because these cases of hepatitis are preceded or accompanied by enhanced HBV viral replication, reflected by an increasing serum level of HBV DNA on Digene Hybrid Capture II assays (Murex, Digene, Gaithersburg, MD), it is not known whether HBV-infected patients with a higher HBV viral load have a higher risk of hepatitis due to HBV reactivation after HCT. Other HBV viral factors that might be involved in HBV reactivation are the presence of variants, notably, the G→A mutation at nucleotide 1896 in the precore region (A1896), which converts codon 28 for tryptophan to a stop codon23; and the double mutation in the basic core promoter (BCP) that consists of the A→T mutation at nucleotide 1762 and the G→A mutation at nucleotide 1764 (T1762/A1764).24 The precore A1896 stop mutation was reported to be an Andromeda strain that markedly increased HBV virulence and contributed to the development of fulminant hepatitis.25,26 On the other hand, the BCP regulates transcription of pregenomic RNA, encodes core protein and HBV polymerase, and serves as a replicative intermediate for the synthesis of viral DNA.27 Variants of the BCP (T1762/A1764) have been observed in patients with severe liver disease.28-34 

Unlike the situation with hepatitis C virus (HCV) infections, the clinical importance of HBV genotype has received little attention. Seven genotypes of HBV are recognized, distinguished by differences of more than 8% in the entire nucleotide sequence of approximately 3200 nucleotides. They are designated by letters ranging from A to G.35-37 HBV genotypes have distinct geographical distributions.31,38-40 Overall, genotypes B and C are common in Asia, whereas genotypes A and D prevail in Western countries. Genotype E is restricted to Africa, and genotype F is dominant in Central America. Genotype G was described more recently,37and its distribution is still unknown. There is now an increasing awareness of the clinical importance of HBV genotype.29,33 

In this study, we investigated the prevalence and risk factors for occurrence of hepatitis due to HBV reactivation after autologous HCT in an area endemic for HBV infection.

Patients, materials, and methods

Patients

We studied 137 consecutively treated patients who underwent autologous HCT at Queen Mary Hospital, Hong Kong, from November 1990 to March 2000 (Table 1). None had received any preemptive antiviral therapy with substantial activity against HBV (such as famciclovir or lamivudine), intravenous immunoglobulin, or HBV vaccination within 12 weeks of transplantation. In accordance with our standard protocols, all recipients who underwent autologous HCT were screened for HBsAg, HBsAb, human immunodeficiency virus (HIV) antibody, and HBV DNA by polymerase chain reaction (PCR) assay. In addition, after July 1993, all recipients were screened for HCV antibody (anti-HCV). Samples of serum obtained before transplantation from recipients who underwent HCT before July 1993 were tested retrospectively for anti-HCV. For all HBsAg-positive recipients, additional PCR serologic testing for HBeAg, hepatitis B e antibody (HBeAb), and serum HBV DNA was done within 4 to 8 weeks of marrow harvest or HCT. In addition, all HBsAg-positive pretransplantation samples of recipients' serum collected after December 1998 were tested for HBV DNA by using the Digene II assay within 4 to 8 weeks of marrow harvest or HCT. All HBsAg-positive or HBV DNA–positive (on PCR assay) pretransplantation samples of recipients' serum collected before December 1998 (and stored at −70°C) were tested retrospectively for HBV DNA by using the Digene assay. The precore and core promoter HBV DNA sequences for all marrow recipients positive for HBsAg or HBV DNA (on PCR assay) were determined by direct DNA sequencing.

Table 1.

Clinical and virologic characteristics of 137 patients who underwent autologous hematopoietic cell transplantation

Characteristic Values  
Sex: M/F 72 (53)/65 (47)  
Median age, y (range) 37  (1-67) 
Transplantation ALT  
 Elevated 6  (4) 
 Normal 131  (96)  
Pretransplant hepatitis serologic results  
 HBsAg positive 23  (17)  
 HBeAg positive 4  (3)  
 HBeAb positive 19  (14)  
 HBV DNA positive on Digene assay 10  (7)  
 HBsAg, HBsAb, and HBcAb negative 77  (56)  
 Precore A1896 variants alone present 2  (1)  
 BCP T1762/A1764variant alone present 3  (2)  
 Both A1896 and T1762/A1764 variants present 3  (2) 
 Anti-HBs positive/anti-HBc positive 37/28  (27/20)  
 HBV DNA positive by PCR 41  (30)  
 HBV genotype B/HBV genotype C 22/18  (16/13)  
 Anti-HCV positive 1  (1)  
Underlying disease  
 Non-Hodgkin lymphoma 60  (44)  
 Breast cancer 18  (13)  
 Multiple myeloma 17  (12)  
 Hodgkin lymphoma 11  (8)  
 Other 31  (23) 
Characteristic Values  
Sex: M/F 72 (53)/65 (47)  
Median age, y (range) 37  (1-67) 
Transplantation ALT  
 Elevated 6  (4) 
 Normal 131  (96)  
Pretransplant hepatitis serologic results  
 HBsAg positive 23  (17)  
 HBeAg positive 4  (3)  
 HBeAb positive 19  (14)  
 HBV DNA positive on Digene assay 10  (7)  
 HBsAg, HBsAb, and HBcAb negative 77  (56)  
 Precore A1896 variants alone present 2  (1)  
 BCP T1762/A1764variant alone present 3  (2)  
 Both A1896 and T1762/A1764 variants present 3  (2) 
 Anti-HBs positive/anti-HBc positive 37/28  (27/20)  
 HBV DNA positive by PCR 41  (30)  
 HBV genotype B/HBV genotype C 22/18  (16/13)  
 Anti-HCV positive 1  (1)  
Underlying disease  
 Non-Hodgkin lymphoma 60  (44)  
 Breast cancer 18  (13)  
 Multiple myeloma 17  (12)  
 Hodgkin lymphoma 11  (8)  
 Other 31  (23) 

Values are numbers (%) of patients unless otherwise specified.

ALT indicates alanine aminotransferase; HBsAg, hepatitis B (HB) surface antigen; HBeAg, HB e antigen; HBeAb, HB e antibody; HBV, HB virus; HBsAb, HB surface antibody; HBcAb, HB core antibody; BCP, basic core promoter; HBs, HB surface; HBc, HB core; PCR, polymerase chain reaction; and HCV, hepatitis C.

Recipients of HCT underwent tests of liver function (including determinations of serum levels of alanine aminotransferase [ALT], albumin, and bilirubin) at least once a week during the first 12 weeks, 1 to 4 times weekly until the end of week 52 after HCT, and at 2- to 12-week intervals until their last follow-up or death. Hepatitis serologic variables (HBsAg, HBeAg, HBeAb, HBV DNA on Digene assay and PCR, and HCV RNA on PCR) were assessed in serum samples collected before and during hepatic events when there was any clinical suspicion of liver damage due to HBV infection. The occurrence of hepatic events (acute hepatitis, chronic hepatitis, anicteric or icteric hepatitis, hepatic failure, and veno-occlusive disease [VOD]) and death were recorded. At least one pretransplantation serum sample (obtained 1-6 weeks before HCT) was available for all HCT recipients in this study. Serial serum samples were collected before HCT and after HCT at 1 to 4 weekly intervals for the first year and then at 2 to 12 weekly intervals until their last follow-up or death. At least 6 posttransplantation serum samples were available for each patient in the study. All serum samples were stored at −70°C. All patients who had hepatitis due to HBV reactivation after HCT were treated with lamivudine (100 mg given once daily). All patients who underwent autologous HCT had high-dose cytoreductive therapy. This consisted of either both busulfan and cyclophosphamide (Cy) or Cy and TBI with a total radiation dose of more than 12 Gy or Cy and bischloroethylnitrosourea (BCNU) with etoposide, high-dose melphalan, melphalan with TBI, etoposide, BCNU, cytarabine, and melphalan.

Hepatitis serologic analysis and HBV DNA assay

HBV serologic markers, including HBsAg, HBsAb, HBeAg, HBeAb, anti-HCV Ab (Electroimmunoassay II), anti–hepatitis-D antibody, and anti-HIV antibody, were tested by using commercially available enzyme immunoassays (Abbott Laboratories, Chicago, IL). HBcAb was tested by radioimmunoassay (Corab; Abbott). Serial serum samples from the same patient were tested in a single run to minimize interassay variation. A nested PCR assay for detection of serum HBV DNA was done by using primer sets from the HBV surface antigen and the core antigen coding region.41 For the surface region, the primers were CCTGCTGGTGGCTCCAGTTC (map position, 58-77) and CAAACGGGCAACATACCTTG (476-457) for the first round of PCR testing and ACATCAGGATTCCTAGGACC (169-188) and CGCAGACACATCCAGCGATA (398-370) for the second round. The corresponding sets of primers for the core region were GGAGTGTGGATTCGCATCCTCC (2269-2288), ATACTAACATTGAGATTCCC (2457-2438), AGACCACCAAATGCCCCTAT (2299-2318), and GATCTTCTGCGACGCGGCGA (2429-2410). Using serial dilution of EuroHep-2 HBV DNA plasma standards, we estimated the detection limit of the PCR assay to be 1 × 102 genomes/mL. Results of the Digene Hybrid Capture II assay were expressed in copies per milliliter, and the manufacturer's stated cut-off limit for detecting HBV viremia in clinical specimens was 0.142 × 106 copies/mL. Reverse transcription–nested PCR for HCV was done in a single tube assay as described previously. The outer primers 57 (5′-AGCGTCTAGCCATGGCGT-3′) and 321 (5′-GCACGGTCTACGAGACCT-3′) and the inner primers 126 (5′-GTGGTCTGCGGAACCGG-3′) and 299 (5′-GGGCACTCGCAAGCACCC-3′) were designed from the highly conserved 5′ noncoding region.

HBV PCR sequencing

The HBV DNA extracted was used to amplify the precore and BCP fragments with PCR using the following primer sets: P7 (5′-TCCTCTGCCGATCCATACTG) and BC1 (5′GGAAAGAAGTCAGAAGGCAA) or P8 (5′-TCTGCCGATCCATACTGCGG) and BC1 (5′GGAAAGAAGTCAGAAGGCAA) at a concentration of 50 pmol. Direct sequencing of the PCR products was carried out with the “fmol” sequencing kit (Promega, Southampton, England). Sequencing primers P9 and BC1 were end-labeled with 25 μCi 32P–adenosine triphosphase (Amersham International, Amersham, England) in a volume of 10 μL using 10 U polynucleotide kinase (Boehringer Mannheim, Penzberg, Germany) for 20 minutes at 37°C, and 1.5 μL of the reaction mix was used directly in sequencing reactions. PCR product (90 μL) was precipitated with an equal volume of 4 M sodium acetate and 2 vol isopropanol for 10 minutes at room temperature, formed into pellets by centrifugation for 10 minutes, and washed twice with 70% ethanol. After resuspension in 20 μL water, 9.5 μL DNA was added to the reaction buffer with the end-labeled primer and 5 U Taq enzyme. Dideoxynucleotide termination sequencing was done according to the manufacturer's instructions. Cycle sequencing was performed for 30 rounds.

The denaturation, annealing, and extension steps were 30 seconds, 30 seconds, and 1 minute in length, respectively. Reproducibility of results was ascertained with selected samples by repeat sequencing with different primers as well as sequencing from both the 5′ and 3′ ends. The PCR band with variants was electroeluted, phosphorylated, and cloned into the SmaI site of pUC18 by using conventional procedures. Recombinant clones were identified by restriction-enzyme digestion, and purified plasmid DNA from individual clones was sequenced in both directions with universal primers by using a commercial sequencing kit (Sequenase 2.0; United States Biochemicals, Cleveland, OH).42 HBV genotyping was done with restriction fragment-length polymorphism of an S region or a pre-S region amplicon, as described by Lindh et al.31 

Definition of hepatic events

Hepatitis was defined as a greater than 3-fold elevation in serum aminotransferase above the upper limit of normal on 2 consecutive determinations done at least 5 days apart and in the absence of clinical features suggestive of VOD or infection by cytomegalovirus or herpes simplex virus. Icteric hepatitis was defined as hepatitis associated with clinical jaundice and a serum bilirubin level that exceeded 30 μM (normal, <19 μM). Hepatitis was considered to be transient if the duration was less than 6 months and persistent if the duration was more than 6 months. Hepatitis was assumed to be due to HBV reactivation when it was preceded or accompanied by an elevation in serum HBV DNA to more than 10 times that of the pre-exacerbation baseline value, when serum HBV DNA test results turned from negative to positive, or when HBsAg test results became positive and remained so for 2 consecutive readings 5 days apart. Hepatic failure was defined as the presence of hepatic encephalopathy and deficits in blood coagulation (prothrombin time prolonged for more than 10 seconds). The clinical criteria used for diagnosis of VOD disease were a bilirubin level of at least 34.2 μM, hepatomegaly or right upper quadrant pain of liver origin, and a greater than 2% weight gain due to fluid accumulation; the diagnosis required that 2 of these 3 criteria occurred within 20 days of HCT. Moreover, the diagnosis was made only after hyperacute graft-versus-host disease, sepsis, cardiac failure, and tumor infiltration were ruled out.43 

Statistical analysis

Clinical characteristics of patients were quantified and percentages calculated. Differences among groups were analyzed by using the median test for continuous data and the likelihood χ2or Fisher exact test for categorical data. The outcome of interest was the survival time with hepatitis due to HBV reactivation, which was defined as the time from marrow infusion to the time of diagnosis of hepatitis due to HBV reactivation. Patients who died of other causes and patients who were alive without hepatitis due to HBV reactivation were censored. Cumulative survival with hepatitis due to HBV reactivation was analyzed by using Kaplan-Meier curves.44 The Cox proportional hazards model45 was used to compare differences in HBV hepatitis survival between groups by obtaining hazard ratios and 95% confidence intervals (CIs). Virologic factors possibly associated with the rate of occurrence of hepatitis due to HBV reactivation were studied by using a multivariate Cox proportional hazards model, and hazard ratios adjusted for other model factors were obtained together with their 95% CIs. The proportional hazards assumption was checked by examining the martingale and deviance residuals. The SAS statistical program (version 8.0; SAS Institute, Cary, NC) was used. A P value less than .05 was considered to represent a significant difference.

Results

Clinical characteristics of patients undergoing autologous HCT

Before HCT, 23 patients (16.8%) were positive for HBsAg, 37 (27.0%) were positive for anti-HBs (28 were also anti-HBc positive), and 77 (56.2%) were negative for HBV. There were no significant differences in sex, age, underlying disease, conditioning regimen, or percentage of patients with elevated serum ALT levels before HCT (Table2).

Table 2.

Characteristics of 137 patients treated with autologous hematopoietic cell transplantation and evaluated for hepatitis due to hepatitis B virus (HBV) reactivation, according to patients' HBV status

Characteristic HBsAg positive (n = 23) Anti-HBs positive (n = 37) HBsAg or anti-HBs negative (n = 77) Total
(n = 137)  
Sex: M/F 13/10 21/16 38/39 72/65  
Median age, y (range) 36.4 (14-56) 40.7 (18-64) 32.9 (1-67) 37.0 (1-67)  
Underlying disease     
 Non-Hodgkin lymphoma 15 20 25 60  
 Breast cancer 13 18  
 Multiple myeloma 11 17  
 Hodgkin lymphoma 11  
 Other 22 31 
Pretransplantation ALT     
 Elevated 
 Normal 20 37 74 131  
Hepatic events*     
 Total cases of hepatitis 13 (11) 5 (1) 14 (1) 32 (13) 
 Transient hepatitis 3 (2) 14 (1) 21 (3)  
 Persistent hepatitis 10 (9) 1 (1) 11 (10)  
 Anicteric hepatitis 5 (4) 5 (1) 11 (1) 21 (6)  
 Icteric hepatitis 3 (3) 6 (3)  
 Death due to hepatic failure 5 (4) 5 (4)  
Cause of hepatitis     
 HBV related 11 13 
 Sepsis 13  
 Unknown 
Veno-occlusive disease 18 
Characteristic HBsAg positive (n = 23) Anti-HBs positive (n = 37) HBsAg or anti-HBs negative (n = 77) Total
(n = 137)  
Sex: M/F 13/10 21/16 38/39 72/65  
Median age, y (range) 36.4 (14-56) 40.7 (18-64) 32.9 (1-67) 37.0 (1-67)  
Underlying disease     
 Non-Hodgkin lymphoma 15 20 25 60  
 Breast cancer 13 18  
 Multiple myeloma 11 17  
 Hodgkin lymphoma 11  
 Other 22 31 
Pretransplantation ALT     
 Elevated 
 Normal 20 37 74 131  
Hepatic events*     
 Total cases of hepatitis 13 (11) 5 (1) 14 (1) 32 (13) 
 Transient hepatitis 3 (2) 14 (1) 21 (3)  
 Persistent hepatitis 10 (9) 1 (1) 11 (10)  
 Anicteric hepatitis 5 (4) 5 (1) 11 (1) 21 (6)  
 Icteric hepatitis 3 (3) 6 (3)  
 Death due to hepatic failure 5 (4) 5 (4)  
Cause of hepatitis     
 HBV related 11 13 
 Sepsis 13  
 Unknown 
Veno-occlusive disease 18 

Values are numbers of patients unless otherwise indicated. For explanation of abbreviations, see Table 1.

*

Values in parentheses are numbers of events related to HBV.

There was 1 death due to HBV-related hepatic failure.

Liver-related complications after autologous HCT

One hundred thirty-seven patients were followed for a median of 25 months (range, 0.3-122 months). After autologous HCT, hepatitis developed in 32 patients (23%), with a mean onset at 136 ± 272 days after transplantation. Eleven cases were persistent and 21 were transient. Ten cases of persistent hepatitis (91%) and 3 cases of transient hepatitis (14%) were due to HBV reactivation (P < .0001). Most cases of persistent hepatitis (10 of 11) occurred in patients who were HBsAg positive before HCT, and only one patient negative for HBsAg had persistent hepatitis after HCT (P < .012). All cases of persistent hepatitis were due to HBV reactivation. Of the 32 cases of hepatitis after HCT, 13 were due to HBV reactivation and 13 were related to systemic sepsis; the cause of the remaining 6 cases was undetermined. Hepatitis due to HBV reactivation was more common in patients who were positive for HBsAg before HCT (11 of 23) than in patients who were HBsAg negative (2 of 114; P = .023). Seven of the 11 cases of severe hepatitis (icteric hepatitis or hepatic failure) were due to HBV reactivation, whereas only 6 of the 21 cases of anicteric hepatitis were due to HBV reactivation (P = .072).

The peak HBV DNA level preceded the peak serum ALT level by a median of 6 weeks (range, 0-12 weeks). HBV-related hepatitis resulted in 7 cases of severe hepatitis (54%), whereas there were only 4 cases of severe hepatitis not related to HBV (21%; P = .072 on 2-sided Fisher exact test). The median peak serum ALT levels were higher in patients with HBV-related hepatitis (632 IU/L; range, 120-2410 IU/L) than in those with non-HBV–related hepatitis (208 IU; range, 93-3200 IU/L; P = .029 on median test). However, the median peak bilirubin levels were similar in the HBV-related cases of hepatitis (15 μM/L; range, 5-680 μM/L) and the non-HBV–related cases (24 μM/L; range, 6-380 μM/L; P = 1.000 on median test). The median time to peak ALT levels was 110 days (range, 29-374 days) for HBV hepatitis cases and 27 days (range, 3-1500 days) for non-HBV hepatitis cases (P = .0002 on median test).

Three patients in this series underwent lamivudine treatment for hepatitis reactivation (lamivudine was not available before late 1998). Two patients recovered completely after this treatment. The third patient had complete resolution of hepatitis but died later of leukemia relapse.

The patients' survival was not affected by the occurrence of hepatitis (P = .189 on log rank test; Figure1A) or HBV-related hepatitis (P = .618 on log rank test; Figure 1B). However, patients who had severe hepatitis after HCT had a poorer survival than patients in whom severe hepatitis did not develop after HCT (P < .0001 on log-rank test; Figure 1C). Eighteen patients (13%) had VOD after transplantation; 4 of these patients (17%) were positive for HBsAg, 7 (19%) were positive for anti-HBs, and 7 (9%) were negative for HBV (P value not significant).

Fig. 1.

Results of survival analysis.

Cumulative survival of patients after autologous HCT in relation to occurrence of (A) posttransplantation hepatitis, (B) hepatitis due to HBV reactivation, and (C) severe hepatitis.

Fig. 1.

Results of survival analysis.

Cumulative survival of patients after autologous HCT in relation to occurrence of (A) posttransplantation hepatitis, (B) hepatitis due to HBV reactivation, and (C) severe hepatitis.

Pretransplantation characteristics associated with HBV-related hepatitis after autologous HCT

Pretransplantation characteristics associated with hepatitis due to HBV reactivation after HCT were an elevated serum ALT level, HBsAg positivity, detectable serum HBV DNA (on Digene assay), and BCP (T1762/A1764). Three patients (50%) with elevated serum ALT before HCT and 10 patients (8%) with normal serum ALT before HCT had hepatitis due to HBV reactivation (P < .0001). Eleven patients (48%) who were positive for HBsAg before HCT had hepatitis due to HBV reactivation, where only 2 HBsAg-negative patients (2%) had hepatitis due to HBV reactivation (P < .0001). Nine patients (90%) with detectable serum HBV DNA and only 4 (4%) without detectable serum HBV DNA had hepatitis due to HBV reactivation (P < .0001). Pretransplantation serum HBV DNA levels were also significantly higher in patients with hepatitis due to HBV reactivation (median, 800 pg/mL; range, 0-3800 pg/mL) than in those without hepatitis due to HBV reactivation (median, 0 pg/mL; range, 0-800 pg/mL; P < .0001 on median test). In addition, 7 patients (88%) with BCP (T1762/A1764) and 5 (31%) without BCP (T1762/A1764) had hepatitis due to HBV reactivation (P = .025; Table3).

Table 3.

Results of univariate analysis of predictive factors for hepatitis due to HBV reactivation after transplantation

Characteristic No. of patients Relative hazard 95% CI P 
Sex 137    
 Male 72 1.3 0.44 -4.08 .614  
 Female 65   
Age at diagnosis, y 137    
 ≤ 30 50 0.6 0.13 -2.51 .451  
 31-45 46 1.6 0.45 -5.60 .479 
 ≥ 46 41   
HBeAg 23    
 Positive 0.5 0.07 -4.24 .559  
 Negative 19   
HBV DNA on PCR 137    
 Positive 41 32.3 4.12 -250 .001 
 Negative 96   
Precore A1896 24    
 Positive 0.7 0.14 -3.03 .596 
 Negative 19   
HBsAg 137    
 Positive 23 33.3 7.35-142.86 < .0001 
 Negative 114   
HBV DNA on Digene assay 119    
 Detectable 10 62.5 16.67 -250 < .0001 
 Undetectable 109   
Genotype 42    
 C 19 5.27 1.41 -19.62 .013  
 B 23   
BCP T1762/A1764 24    
 Positive 3.76 1.18 -11.90 .025  
 Negative 16   
Pretransplantation ALT 137    
 Elevated 15.38 4.10 -58.82 < .0001  
 Normal 131   
Characteristic No. of patients Relative hazard 95% CI P 
Sex 137    
 Male 72 1.3 0.44 -4.08 .614  
 Female 65   
Age at diagnosis, y 137    
 ≤ 30 50 0.6 0.13 -2.51 .451  
 31-45 46 1.6 0.45 -5.60 .479 
 ≥ 46 41   
HBeAg 23    
 Positive 0.5 0.07 -4.24 .559  
 Negative 19   
HBV DNA on PCR 137    
 Positive 41 32.3 4.12 -250 .001 
 Negative 96   
Precore A1896 24    
 Positive 0.7 0.14 -3.03 .596 
 Negative 19   
HBsAg 137    
 Positive 23 33.3 7.35-142.86 < .0001 
 Negative 114   
HBV DNA on Digene assay 119    
 Detectable 10 62.5 16.67 -250 < .0001 
 Undetectable 109   
Genotype 42    
 C 19 5.27 1.41 -19.62 .013  
 B 23   
BCP T1762/A1764 24    
 Positive 3.76 1.18 -11.90 .025  
 Negative 16   
Pretransplantation ALT 137    
 Elevated 15.38 4.10 -58.82 < .0001  
 Normal 131   

CI indicates confidence interval. For explanation of other abbreviations, see Table 1.

Patients at risk of posttransplantation hepatitis due to HBV reactivation

The overall cumulative incidence rates of hepatitis due to HBV reactivation were 4.2% (95% CI, 0.6%-7.9%), 10.5% (95% CI, 4.9%-16.2%), and 11.7% (95% CI, 5.7%-17.8%) at 3, 6, and 24 months, respectively, after HCT. Univariate analysis was done to determine whether pretransplantation variables such as sex, age at diagnosis, HBsAg and HBeAg status, HBV DNA positivity on PCR and Digene assays, HBV genotype, BCP (T1762/A1764), and elevated serum ALT level before HCT were associated with an increased cumulative incidence of hepatitis due to HBV reactivation. We found that patients who were positive for HBsAg before HCT had a higher cumulative incidence of hepatitis due to HBV reactivation (51.9%; 95% CI, 30.6%-73.3%) than patients who were negative for HBsAg (2.5%; 95% CI, 0%-6.1%; P < .0001). Other HBV virologic factors found to be associated with posttransplantation hepatitis due to HBV reactivation were detectable serum HBV DNA before HCT (on Digene assay), HBV genotype C, and the presence of BCP (T1762/A1764). Patients with elevated serum ALT levels before HCT also had a higher cumulative incidence of hepatitis due to HBV reactivation. When multivariate Cox regression analysis was used to assess patients positive for HBsAg, detectable HBV DNA on Digene assay before HCT was the only significant and independent risk factor associated with hepatitis due to HBV reactivation after HCT (adjusted hazard ratio, 9.35; 95% CI, 1.65-52.6; Table4).

Table 4.

Results of Cox proportional hazard analysis of HBV virologic factors predictive of hepatitis due to HBV reactivation in HBsAg-positive patients after autologous hematopoietic cell transplantation

Variable Hazard ratio4-150 95% CI P4-151 
HBV DNA    
 Detectable 9.35 1.65-52.6 .012 
 Undetectable   
Genotype    
 C 1.47 0.16-13.50 .734 
 B   
BCP    
 Positive 2.02 0.70-43.48 .448 
 Negative   
Pretransplantation ALT    
 Elevated 5.49 0.07-6.25 .105 
 Normal   
Variable Hazard ratio4-150 95% CI P4-151 
HBV DNA    
 Detectable 9.35 1.65-52.6 .012 
 Undetectable   
Genotype    
 C 1.47 0.16-13.50 .734 
 B   
BCP    
 Positive 2.02 0.70-43.48 .448 
 Negative   
Pretransplantation ALT    
 Elevated 5.49 0.07-6.25 .105 
 Normal   

CI indicates confidence interval. For explanation of other abbreviations, see Table 1.

F4-150

Hazard ratios above 1.00 represent an increased risk of hepatitis due to HBV reactivation; those below 1.00 represent a decreased risk of hepatitis due to HBV reactivation.

F4-151

Based on the hypothesis that the hazard ratio determined by a Cox proportional hazards analysis is equal to 1.0.

On Digene Hybrid Capture II assay.

Discussion

Hepatitis due to HBV reactivation is a serious cause of morbidity and mortality in HBsAg-positive patients undergoing intensive immunosuppression or chemotherapy.1-11 This is a particularly important clinical issue in areas such as Hong Kong, where HBV infection is endemic.14,46 However, the incidence and risk factors for this clinical disorder have not been defined clearly. Hence, in this study, we investigated a cohort of Chinese patients (17% HBsAg positive and 20% anti-HBs and anti-HBc positive) who received intensive chemotherapy in association with autologous HCT. We found that nearly half of the HBsAg-positive patients in our series had hepatitis due to HBV reactivation after autologous HCT. The incidence was comparable to that reported in HBsAg-positive Chinese patients with lymphoma treated with chemotherapy.46 

Although most of the posttransplantation cases of hepatitis due to HBV reactivation occurred in patients positive for HBsAg, this disorder also developed in 2 patients who were negative for HBsAg. One of these patients had natural immunity against HBV (anti-HBs and anti-HBc positive). This was probably related to reactivation from latent HBV infection, an assumption consistent with findings of previous studies.7-11 In patients with natural immunity against HBV, HBV DNA could still be detected in serum and peripheral blood mononuclear cells (PBMCs) by using sensitive PCR methods. Moreover, CD69+ (a marker of recent activation) cytotoxic T lymphocytes (CTLs) could still be detected in PBMCs from these patients, indicating the presence of an active CTL control on actively replicating HBV (at a very low level).47 The other HBsAg-negative patient in our study with hepatitis due to HBV reactivation was negative for HBV on PCR assay before HCT, and HBV was probably acquired from the multiple blood products given during HCT.48 

The median time to onset of hepatitis due to HBV reactivation was 110 days after marrow infusion, significantly longer than for cases of hepatitis not due to HBV reactivation. The timing of the HBV-related cases of hepatitis coincides with immune reconstitution. Furthermore, peak HBV DNA levels preceded peak ALT levels in patients with hepatitis due to HBV reactivation by a median time of 6 weeks (or they accompanied peak ALT levels), suggesting the presence of an immune mechanism of liver damage.

Because the cases of hepatitis due to HBV reactivation were preceded or accompanied by an increasing level of viral replication, we hypothesized that HBV virologic and host factors implicated to influence HBV viral replication might affect the occurrence of posttransplantation hepatitis due to HBV reactivation. Among those HBV virologic factors, HBV genotype, BCP, and HBV viral load are of particular interest. An association between BCP (T1762/A1764) and severe liver disease was previously reported.29-34 This might be related to the accompanying changes in the secondary structure of the pregenome, which might increase viral replication.34 Furthermore, the BCP (T1762/A1764) double mutation enhanced synthesis of core protein by 15 fold in an expression system.28 In vitro, the mutation was shown to increase transcription of pregenomic RNA by creation of a binding site for hepatocyte nuclear factor 1.49 On the other hand, studies in Taiwan and Japan suggested that, compared with HBV genotype B, HBV genotype C was associated with more severe disease and a lower rate of response to interferon-α therapy.29,33,50 The underlying pathogenetic explanation for this finding remains speculative, and further studies are required to reveal the effect of HBV genotype on HBV virus-host immune interaction.

Using univariate analysis, we found that the risk factors associated with posttransplantation hepatitis due to HBV reactivation were HBsAg, detectable HBV DNA before HCT (on Digene assay), HBV genotype C, and the presence of BCP (T1762/A1764). We also observed that HBV genotype C was associated with the occurrence of BCP (T1762/A1764). These findings are similar to those of studies in Japan,29 Chinese populations,33,51 and Sweden.32 The underlying molecular explanation is unclear but might be related to the stabilization of the stem-loop structure of the encapsidation for various HBV genotypes with these HBV variants.51 

Among the few pretransplantation viral and host factors related to the occurrence of hepatitis due to HBV reactivation, a detectable HBV DNA level (on Digene Hybrid Capture II assay) in HBsAg-positive patients was found to be the principal predicting factor on multivariate Cox regression analysis. Moreover, the pretransplantation serum HBV DNA level was also significantly higher in patients with hepatitis due to HBV reactivation than in those without this disorder. Therefore, it is logical to reduce the HBV viral load and to keep it below the detection limit of the Digene assay (105copies/mL) before HCT and immediately afterward. Determining whether additional reductions in the HBV viral load will be beneficial will require studies using more sensitive HBV DNA quantitation methods.52 Treatment with interferon-α53 or nucleoside analogues such as famciclovir54 and lamivudine55 has been shown to reduce the amount of circulating HBV DNA in most patients with chronic HBV infection. Nucleoside analogues are preferable because they do not cause substantial myelosuppression, a possible complication of interferon-α therapy.56 However, prolonged monotherapy with lamivudine or famciclovir was associated with an increase risk of resistant variants,57,58 and emergence of resistant mutants might cause serious liver disease, particularly in immunosuppressed patients.59 It is relevant to this issue that in treatment of HIV infections, resistance has developed as a result of ineffective suppression of viral replication, ie, resistance cannot occur without replication.60 Hence, the use of more potent nucleoside analogues is desirable. Several new nucleoside analogues, including adefovir dipivoxil,61 entecavir,62and emtricitabine,63 have been found to be effective in suppressing HBV replication. Additional clinical trials of these nucleoside analogues are needed to determine their antiviral efficacy in patients. Alternatively, combination nucleoside-analogue therapy with phenotypic reversion and synergism might be useful.60,64 

In this series, VOD (Seattle criteria) was observed in 15% of patients after HCT. This finding is consistent with those in some other series,65-67 but the rate is higher than that in a recent European study (3.1%).68 The discrepancy in the incidence of VOD is probably related to our common use of high-dose cytoreductive therapy, which is a known risk factor for VOD43,68; our use of less stringent criteria for the diagnosis of VOD; and the presence of HBV infection in a substantial proportion of our patients.

In conclusion, we found that hepatitis due to HBV reactivation was common in patients positive for HBsAg who underwent autologous HCT. Among such patients, a high HBV DNA level (>105 copies/mL) was the most important risk factor for HBV reactivation. Additional clinical trials of the preemptive use of nucleoside analogues to lower the HBV DNA level before transplantation are needed.

We thank Yuen Wing Sze and Amy Kwok for assistance in data management.

Supported by a grant from the Cheng Si-yuan (China International) Hepatitis Research Foundation to the University of Hong Kong; China National 973 research grant (G 1999 054105 (Y.M.W. and G.K.K.L); an ear-marked grant from the Hong Kong Research Grant Council; and a grant from the University Research Committee (R.L.).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

References

References
1
Markovic
S
Drozina
G
Vovk
M
Fidler-Jenko
M
Reactivation of hepatitis B but not hepatitis C in patients with malignant lymphoma and immunosuppressive therapy. A prospective study in 305 patients.
Hepatogastroenterology.
46
1999
2925
2930
2
Ustun
C
Koc
H
Karayalcin
S
et al. 
Hepatitis B virus infection in allogeneic bone marrow transplantation.
Bone Marrow Transplant.
20
1997
289
296
3
Alexopoulos
CG
Vaslamatzis
M
Hatzidimitriou
G
Prevalence of hepatitis B virus marker positivity and evolution of hepatitis B virus profile, during chemotherapy, in patients with solid tumours.
Br J Cancer.
81
1999
69
74
4
Reed
EC
Myerson
D
Corey
HT
Meyers
JD
Allogeneic marrow transplantation in patients positive for hepatitis B surface antigen.
Blood.
77
1991
195
200
5
Pariente
EA
Goudeau
A
Dubois
F
et al. 
Fulminant hepatitis due to reactivation of chronic hepatitis B virus infection after allogeneic bone marrow transplantation.
Dig Dis Sci.
33
1988
1185
1191
6
Hoofnagle
JH
Dusheiko
GM
Schafer
DF
et al. 
Reactivation of chronic hepatitis B virus infection by cancer chemotherapy.
Ann Intern Med.
96
1982
447
449
7
Nagington
J
Cossart
YE
Cohen
BJ
Reactivation of hepatitis B after transplantation operations.
Lancet.
68
1977
105
112
8
Villa
E
Theodossi
A
Portmann
B
Eddleston
AL
Williams
R
Reactivation of hepatitis B virus infection in two patients: immunofluorescence studies of liver tissue.
Gastroenterology.
80
1981
1048
1053
9
Blanpain
C
Knoop
C
Delforge
ML
et al. 
Reactivation of hepatitis B after transplantation in patients with pre-existing anti-hepatitis B surface antigen antibodies: report on three cases and review of the literature.
Transplantation.
66
1998
883
886
10
Dhedin
N
Douvin
C
Kuentz
M
et al. 
Reverse seroconversion of hepatitis B after allogeneic bone marrow transplantation: a retrospective study of 37 patients with pretransplant anti-HBs and anti-HBc.
Transplantation.
66
1998
616
619
11
Martin
BA
Rowe
JM
Kouides
PA
DiPersio
JF
Hepatitis B reactivation following allogeneic bone marrow transplantation: a case report and review of the literature.
Bone Marrow Transplant.
15
1995
145
148
12
Horowitz
MM
Uses and growth of hematopoietic cell transplantation.
Hematopoietic Cell Transplantation.
2nd ed.
Thomas
ED
Blume
KG
Forman
SJ
1999
12
18
Blackwell
Cambridge, MA
13
Chen
PM
Liu
JH
Fan
FS
et al. 
Liver disease after bone marrow transplantation: the Taiwan experience.
Transplantation.
59
1995
1139
1143
14
Liang
R
Lau
GKK
Kwong
YL
Chemotherapy and bone marrow transplantation for cancer patients who are also chronic hepatitis B carriers: a review of the problem.
J Clin Oncol.
17
1999
394
398
15
Iwai
K
Tashima
M
Itoh
M
et al. 
Fulminant hepatitis B following bone marrow transplantation in an HBsAg-negative, HBsAb-positive recipient; reactivation of dormant virus during the immunosuppressive period.
Bone Marrow Transplant.
25
2000
105
108
16
Kostaridou
S
Ladis
V
Kattamis
A
Laras
A
Hadziyannis
SJ
HBeAg-negative hepatitis B in a previously thalassemic patient during immunosuppressive therapy for chronic GVHD.
Bone Marrow Transplant.
22
1998
919
921
17
Caselitz
M
Link
H
Hein
R
et al. 
Hepatitis B associated liver failure following bone marrow transplantation.
J Hepatol.
27
1997
572
577
18
Davis
GL
Hoofnagle
JH
Reactivation of chronic hepatitis B virus infection.
Gastroenterology.
92
1987
2028
2031
19
McMillan
JS
Shaw
T
Angus
PW
Locarnini
SA
Effect of immunosuppressive and antiviral agents on hepatitis B virus replication in vitro.
Hepatology.
22
1995
36
43
20
Wands
JR
Chura
CM
Roll
FJ
Maddrey
WC
Serial studies of hepatitis-associated antigen and antibody in patients receiving antitumor chemotherapy for myeloproliferative and lymphoproliferative disorders.
Gastroenterology.
68
1975
105
112
21
Scullard
GH
Smith
CI
Merigan
TC
Robinson
WS
Gregory
PB
Effects of immunosuppressive therapy on viral markers in chronic active hepatitis B.
Gastroenterology.
81
1981
987
991
22
Galbraith
RM
Eddleston
ALWF
Williams
R
Zuckerman
AJ
Fulminant hepatic failure in leukemia and choriocarcinoma related to withdrawal of cytotoxic drug therapy.
Lancet.
2
1975
528
530
23
Carman
WF
Jacyna
MR
Hadziyannis
S
et al. 
Mutation preventing formation of hepatitis B e antigen in patients with chronic hepatitis B infection.
Lancet.
2
1989
588
591
24
Buckwold
VE
Xu
Z
Chen
M
Yen
TS
Ou
JH
Effects of a naturally occurring mutation in the hepatitis B virus basal core promoter on precore gene expression and viral replication.
J Virol.
70
1996
5845
5851
25
Hasegawa
K
Huang
JK
Wands
JR
Obata
H
Liang
TJ
Association of hepatitis B viral precore mutations with fulminant hepatitis B in Japan.
Virology.
185
1991
460
463
26
Omata
M
Ehata
T
Yokosuka
O
Hosoda
K
Ohto
M
Mutations in the precore region of hepatitis B virus DNA in patients with fulminant and severe hepatitis.
N Engl J Med.
324
1991
1699
1704
27
Tiollais
P
Pourcel
C
Dejean
A
The hepatitis B virus.
Nature.
317
1985
489
495
28
Baumert
TF
Marrone
A
Vergalla
J
Liang
TJ
Naturally occurring mutations define a novel function of the hepatitis B virus core promoter in core protein expression.
J Virol.
72
1998
6785
6795
29
Orito
E
Mizokami
M
Sakugawa
H
et al. 
A case-control study for clinical and molecular biological differences between hepatitis B viruses of genotypes B and C. Japan HBV Genotype Research Group.
Hepatology.
33
2001
218
223
30
Takahashi
K
Aoyama
K
Ohno
N
et al. 
The precore/core promoter mutant (T1762A1764) of hepatitis B virus: clinical significance and an easy method for detection.
J Gen Virol.
76
1995
3159
3164
31
Lindh
M
Andersson
AS
Gusdal
A
Genotypes, nt 1858 variants, and geographic origin of hepatitis B virus—large-scale analysis using a new genotyping method.
J Infect Dis.
175
1997
1285
1293
32
Lindh
M
Hannoun
C
Dhillon
AP
Norkrans
G
Horal
P
Core promoter mutations and genotypes in relation to viral replication and liver damage in East Asian hepatitis B virus carriers.
J Infect Dis.
179
1999
775
782
33
Kao
JH
Chen
PJ
Lai
MY
Chen
DS
Hepatitis B genotypes correlate with clinical outcomes in patients with chronic hepatitis B.
Gastroenterology.
118
2000
554
559
34
Kidd-Ljunggren
K
Variability in hepatitis B virus DNA: phylogenetic, epidemiological and clinical implications.
Scand J Infect Dis.
28
1996
111
116
35
Okamoto
H
Tsuda
F
Sakugawa
H
et al. 
Typing hepatitis B virus by homology in nucleotide sequence: comparison of surface antigen subtypes.
J Gen Virol.
69
1988
2575
2583
36
Norder
H
Courouce
AM
Magnius
LO
Complete genomes, phylogenetic relatedness, and structural proteins of six strains of the hepatitis B virus, four of which represent two new genotypes.
Virology.
198
1994
489
503
37
Stuyver
L
De Gendt
S
Van Geyt
C
et al. 
A new genotype of hepatitis B virus: complete genome and phylogenetic relatedness.
J Gen Virol.
81
2000
67
74
38
Magnius
LO
Norder
H
Subtypes, genotypes and molecular epidemiology of the hepatitis B virus as reflected by sequence variability of the S-gene.
Intervirology.
38
1995
24
34
39
Mizokami
M
Nakano
T
Orito
E
et al. 
Hepatitis B virus genotype assignment using restriction fragment length polymorphism patterns.
FEBS Lett.
450
1999
66
71
40
Usuda
S
Okamoto
H
Iwanari
H
et al. 
Serological detection of hepatitis B virus genotypes by ELISA with monoclonal antibodies to type-specific epitopes in the preS2-region product.
J Virol Methods.
80
1999
97
112
41
Lau
GKK
Lok
ASF
Liang
RHS
et al. 
Clearance of HBsAg after bone marrow transplantation: role of adoptive immunity transfer.
Hepatology.
25
1997
1497
1501
42
Hou
J
Lau
GKK
Cheng
J
Cheng
CC
Luo
K
Carman
WF
T1762/A1764 variants of the basal core promoter of hepatitis B virus and its serological and clinical correlation in Chinese.
Liver.
19
1995
411
417
43
McDonald
GB
Hinds
MS
Fisher
LD
et al. 
Veno-occlusive disease of the liver and multiorgan failure after bone marrow transplantation: a cohort study of 355 patients.
Ann Intern Med.
118
1993
255
267
44
Kaplan
EL
Meier
P
Non-parametric estimation from incomplete observations.
J Am Stat Assoc.
53
1958
458
481
45
Cox
DR
Regression model and life tables.
J R Stat Soc.
34
1972
187
220
46
Lok
AS
Liang
RH
Chiu
EK
Wong
KL
Chan
TK
Todd
D
Reactivation of hepatitis B virus replication in patients receiving cytotoxic therapy. Report of a prospective study.
Gastroenterology.
100
1991
182
188
47
Rehermann
B
Ferrari
C
Pasquinelli
C
Chisari
FV
The hepatitis B virus persists for decades after patients' recovery from acute viral hepatitis despite active maintenance of a cytotoxic T-lymphocyte response.
Nature Med.
10
1996
1104
1108
48
Schreiber
GB
Busch
MP
Kleinman
SH
Korelitz
JJ
The risk of transfusion-transmitted viral infections. The Retrovirus Epidemiology Donor Study.
N Engl J Med.
334
1996
1685
1690
49
Li
J
Buckwold
VE
Hon
MW
Ou
JH
Mechanism of suppression of hepatitis B virus precore RNA transcription by a frequent double mutation.
J Virol.
73
1999
1239
1244
50
Kao
JH
Wu
NH
Chen
PJ
Lai
MY
Chen
DS
Hepatitis B genotypes and the response to interferon therapy.
J Hepatol.
33
2000
998
1002
51
Chan
HLY
Leung
WYN
Hussain
M
Wong
ML
Lok
ASF
Hepatitis B e antigen–negative chronic hepatitis B in Hong Kong.
Hepatology.
31
2000
763
768
52
Loeb
K
Jerome
K
Goddard
J
Huang
M
Cent
A
Corey
L
High-throughput quantitative analysis of hepatitis B virus DNA in serum using the TaqMan fluorogenic detection system.
Hepatology.
32
2000
626
629
53
Wong
DK
Cheung
AM
O'Rourke
K
Naylor
CD
Detsky
AS
Heathcote
J
Effect of α-interferon treatment in patients with hepatitis B e antigen-positive chronic hepatitis B. A meta-analysis.
Ann Intern Med.
119
1993
312
323
54
Trepo
C
Jezek
P
Atkinson
G
Boon
R
Young
C
Famciclovir in chronic hepatitis B: results of a dose-finding study.
J Hepatol.
32
2000
1011
1018
55
Liaw
YF
Leung
NW
Chang
TT
et al. 
Effects of extended lamivudine therapy in Asian patients with chronic hepatitis B. Asia Hepatitis Lamivudine Study Group.
Gastroenterology.
119
2000
172
180
56
Lau
GKK
Lie
AKW
Kwong
YL
et al. 
A case-controlled study on the use of HBsAg positive donors for allogeneic hematopoietic cell transplantation.
Blood.
96
2000
452
458
57
Lai
CL
Chien
RN
Leung
NW
et al. 
A one-year trial of lamivudine for chronic hepatitis B. Asia Hepatitis Lamivudine Study Group.
N Engl J Med.
339
1998
61
68
58
Leung
N
Nucleoside analogues in the treatment of chronic hepatitis B.
J Gastroenterol Hepatol.
15(suppl)
2000
E53
E60
59
Hussain
M
Lok
AS
Mutations in the hepatitis B virus polymerase gene associated with antiviral treatment for hepatitis B.
J Viral Hepat.
6
1999
183
194
60
Shaw
T
Locarnini
S
Combination chemotherapy for hepatitis B virus: the final solution?
Hepatology.
32
2000
430
432
61
Gilson
RJC
Chopra
KB
Newell
AM
et al. 
A placebo-controlled phase I/II study of adefovir dipivoxil in patients with chronic hepatitis B virus infection.
J Viral Hepat.
6
1999
387
395
62
De Man
RA
Wolters
LM
Nevens
F
et al. 
Safety and efficacy of oral entecavir given for 28 days in patients with chronic hepatitis B virus infection.
Hepatology.
34
2001
578
582
63
Gish
R
Leung
NWY
Wright
TL
et al. 
Anti-hepatitis B virus (HBV) activity and pharmacokinetics of FTC in a 2-month trial in HBV-infected patients [abstract].
Gastroenterology.
116
1999
A1216
64
Lau
GKK
Tsiang
M
Hou
J
et al. 
Combination therapy with lamivudine and famciclovir for chronic hepatitis B infected Chinese: a viral dynamics study.
Hepatology.
32
2000
394
399
65
Bearman
SI
The syndrome of hepatic veno-occlusive disease after marrow transplantation.
Blood.
85
1995
3005
3020
66
Shulman
HM
Hinterberger
W
Hepatic veno-occlusive disease-liver toxicity syndrome after bone marrow transplantation.
Bone Marrow Transplant.
10
1992
197
214
67
Carreras
E
Grañena
A
Rozman
C
et al. 
Hepatic veno-occlusive disease after bone marrow transplant.
Blood Rev.
7
1993
43
51
68
Carreras
E
Bertz
H
Arcese
W
et al. 
Incidence and outcome of hepatic veno-occlusive disease after blood or marrow transplantation: a prospective cohort study of the European Group for Blood and Marrow Transplantation. European Group for Blood and Marrow Transplantation Chronic Leukemia Working Party.
Blood.
92
1998
3599
3604

Author notes

Raymond Liang, Division of Hematology and Oncology, University Department of Medicine, Queen Mary Hospital, 102 Pokfulam Road, Hong Kong SAR, China; e-mail: rliang@hkucc.hku.hk.