Whereas mobilization to inflammatory sites is an important function of neutrophils, it remains to be determined whether granulocyte colony-stimulating factor (G-CSF) stimulates the mobilization of neutrophils to the inflammatory sites. This study compared the expression of more than 9000 genes in neutrophils treated with and without G-CSF with the use of a DNA microarray system to determine the effects of G-CSF on the function of neutrophils. It was found that messenger RNA expression of epithelial cell–derived neutrophil attractant-78 (ENA-78), which has been reported to be a chemotactic factor for neutrophils, was induced by G-CSF in neutrophils. The study demonstrated that the supernatant of G-CSF–treated neutrophils induced the chemotaxis of neutrophils and that anti–ENA-78 antibody and anti–CXCR-2 antibody inhibited the chemotaxis. These data suggest that G-CSF may enhance the mobilization of neutrophils and consequently augment the accumulation of neutrophils in the inflammatory sites through the secretion of ENA-78.

Introduction

Granulocyte colony-stimulating factor (G-CSF) is now widely used for the treatment of neutropenic patients with severe infection.1-3 It is not only a specific growth factor for the granulocyte colony-forming unit (CFU-G) but also an activator for mature neutrophils.4-6 G-CSF enhances the survival of neutrophils and stimulates superoxide production and phagocytosis.2,7 These findings indicate that G-CSF exerts its effects in the treatment of severe infection through the increase of neutrophils and activation of effector functions. Whereas mobilization to inflammatory sites is known to be an important function of neutrophils, the effect of G-CSF on the mobilization of neutrophils is controversial.8-10 

In this study, we sought to demonstrate the effects of G-CSF on the function of neutrophils with the use of a DNA microarray system. By comparing the expression of more than 9000 genes by screening messenger RNAs (mRNAs) extracted from untreated neutrophils and those treated with G-CSF in vitro, we found that epithelial cell–derived neutrophil attractant-78 (ENA-78) was expressed 17-fold higher in the neutrophils treated with G-CSF than in those untreated. As ENA-78 is an attractant for neutrophils,11,12 we examined the expression of ENA-78 in the neutrophils treated with or without G-CSF by a Northern blot analysis and further examined the motility-stimulating activities for neutrophils in the supernatants of the neutrophils treated with or without G-CSF.

Study design

Reagents

Modified G-CSF was kindly supplied from Kyowa Hakko (Tokyo, Japan). Because this G-CSF is stabler in human plasma than intact human G-CSF,13 the plasma level of this G-CSF reaches 20 ng/mL after a drip infusion at 2 μg/kg. Anti–ENA-78 antibody, anti–CXCR-2 antibody, and recombinant ENA-78 were purchased from R&D Systems (Minneapolis, MN).

Cells

Neutrophils were separated from peripheral blood obtained from healthy volunteers. Neutrophils were separated from mononuclear cells by centrifugation on Ficoll-Paque (Amersham Pharmacia Biotech, Uppsala, Sweden). After removal of mononuclear cells, precipitated cells were separated into a red blood cell fraction and a neutrophil fraction by mixing with 2% methylcellulose. After contaminated red blood cells were removed by hypotonic shock, neutrophils were washed with phosphate-buffered saline twice. Purity of the neutrophils recovered by this method was higher than 99%.

DNA microarray system

Total RNA was extracted from the neutrophils incubated for 24 hours with or without G-CSF at 10 ng/mL with the use of Trizol Reagent (Life Technologies, Tokyo, Japan). mRNA was purified from the total RNA with the use of a Quickprep mRNA purification kit (Amersham Pharmacia Biotech). Differentially expressed genes were screened with the use of a DNA microarray system, UniGEM human (Kurabo Industries, Osaka, Japan)

Northern blot analysis

Northern blot analysis was performed according to the method described previously.14 Briefly, total RNA (20 μg) was separated by electrophoresis in 1.2% denaturing formaldehyde-agarose gels and transferred to nylon membrane (Hybond N+, Amersham). After prehybridization, the membrane was hybridized with the complementary DNA (cDNA) probes for ENA-78 labeled with 32P by using a random primer DNA labeling kit (Takara Biomedicals, Tokyo, Japan). The probed membrane was then washed and exposed to radiographic film. cDNA fragments for ENA-78 were amplified by reverse transcriptase–polymerase chain reaction, cloned into a TA cloning vector, and then used as probes for Northern blot assay. Polymerase chain reaction primers were as follows: ENA-78 forward, GGTTGGATGCTCTTGTCCAA; reverse, CCTTCCAGAAAGTCTTCTAT.

Flow-activated cell sorter analysis

After staining with anti–CXCR-2 antibody and fluorescence-conjugated second antibody, the cells were analyzed with a FACScaliber (Becton Dickinson, Mountain View, CA).

Transwell chamber assay

For examination of the chemotactic activities in the supernatants of neutrophils, the Transwell chamber (Coster, Cambridge, MA) assay was performed according to the previously described method.15 Supernatants were prepared by incubating the neutrophils for 24 hours after incubation with G-CSF for 24 hours and washing them twice with RPMI-1640 medium. Supernatants (600 μL) diluted to 20% and neutrophils suspended in 100 μL RPMI-1640 medium were placed in the lower and upper chambers, respectively. After 4 to 8 hours of incubation, transmigrated cells in the lower chambers were counted under an inverted microscope at least in 20 areas. As a positive control, recombinant ENA-78 was added in the lower chambers at 10 ng/mL. In some experiments, anti–ENA-78 antibody or anti–CXCR-2 antibody was added in the lower chambers at up to 2 μg/mL.

Results and discussion

Differentially expressed genes

One hundred twenty-two and 50 genes, including EST clones, were expressed 2-fold and 3-fold higher, respectively, in the neutrophils treated with G-CSF than in those untreated. Table1 shows 37 known genes among those expressed 3-fold higher in the neutrophils treated with G-CSF than in those untreated. In particular, ENA-78 and granulocyte chemotactic protein-2 (GCP-2), which were reported to be chemotactic factors for neutrophils,11,12,16,17 were expressed 17-fold and 4-fold higher, respectively, in the neutrophils treated with G-CSF than in those untreated. Previous reports demonstrated that mast cells, nonsmall cell lung cancer cells, monocytes, and osteosarcoma cells produced ENA-78 and GCP-2, respectively, whereas there has been no report demonstrating the production of ENA-78 and GCP-2 by neutrophils.12,16,18,19 Therefore, we focused on these molecules in this study. Urokinase-type plasminogen activator, which has been reported to play an important role in the recruitment of neutrophils to the inflammatory sites,20 was also expressed 16.5-fold higher in the neutrophils treated with G-CSF than in those untreated. The role of plasminogen activator is now under examination.

Table 1.

Genes induced by granulocyte colony-stimulating factor in neutrophils

GenesFold inductionAccession no.
Epithelial cell–derived neutrophil attractant-78 (ENA-78) 17.0 NM_002994  
Plasminogen activator, urokinase 16.5 D11143 
Plasminogen activator inhibitor, type II 15.1 J02685 
LIM and senescent cell antigenlike domains 1 13.5 NM_004987  
Solute carrier family 21 member 3 12.6 U21943 
Interleukin 1, alpha 12.3 M28983 
EGF-like module containing, hormone receptor-like sequence 9.9 X81479 
Tumor necrosis factor, alpha-induced protein 6 9.5 M31165 
CD44 antigen 8.7 X66733 
Protein geranylgeranyltransferase type I 8.1 AA481712 
Leukocyte-associated immunoglobulinlike receptor 1 7.0 AF013249 
Chemokine (C-C motif) receptor-like 2 6.7 AF015524 
Complement component 3 6.6 K02765 
Complement component 3a receptor 1 6.3 Z73157 
Activating transcription factor B 5.8 AF016898 
Insulin-induced gene 1 5.5 AW663903 
Thyroid receptor interacting protein 10 4.2 D63485 
Granulocyte chemotactic protein-2 (GCP-2) 4.0 NM_002993  
Kynureninase (L-kynurenine hydrolase) 3.8 U57721 
Orosomucoid 1 3.7 X02544 
Basic helix-loop-helix domain containing, class B 3.7 NM_003670  
Glycerol kinase 3.7 AJ252550 
Interleukin 6 signal transducer (gp130) 3.6 NM_002184 
cAMP responsive element-binding protein-like 2 3.6 AF039081 
CD48 antigen (B-cell membrane protein) 3.5 NM_001778 
Ubiquitin-activating enzyme E1-like protein 3.5 NM_006395 
RAN-binding protein 2 3.4 D42063 
Toll-like receptor 2 3.4 U88878 
Fc fragment of IgE, high affinity I, receptor 3.3 NM_004106  
Adenosine A2a receptor 3.3 S46950 
Peptidylprolyl isomerase F 3.2 M80254 
Flotillin 1 3.2 NM_005803  
TNF receptor–associated factor 3 3.2 U19260 
Annexin A7 3.2 J04543 
Sialyltransferase 4B 3.1 U63090 
Hepatoma-derived growth factor 3.1 A1720570  
Tissue inhibitor of metalloproteinase 1 3.0 AW261830 
GenesFold inductionAccession no.
Epithelial cell–derived neutrophil attractant-78 (ENA-78) 17.0 NM_002994  
Plasminogen activator, urokinase 16.5 D11143 
Plasminogen activator inhibitor, type II 15.1 J02685 
LIM and senescent cell antigenlike domains 1 13.5 NM_004987  
Solute carrier family 21 member 3 12.6 U21943 
Interleukin 1, alpha 12.3 M28983 
EGF-like module containing, hormone receptor-like sequence 9.9 X81479 
Tumor necrosis factor, alpha-induced protein 6 9.5 M31165 
CD44 antigen 8.7 X66733 
Protein geranylgeranyltransferase type I 8.1 AA481712 
Leukocyte-associated immunoglobulinlike receptor 1 7.0 AF013249 
Chemokine (C-C motif) receptor-like 2 6.7 AF015524 
Complement component 3 6.6 K02765 
Complement component 3a receptor 1 6.3 Z73157 
Activating transcription factor B 5.8 AF016898 
Insulin-induced gene 1 5.5 AW663903 
Thyroid receptor interacting protein 10 4.2 D63485 
Granulocyte chemotactic protein-2 (GCP-2) 4.0 NM_002993  
Kynureninase (L-kynurenine hydrolase) 3.8 U57721 
Orosomucoid 1 3.7 X02544 
Basic helix-loop-helix domain containing, class B 3.7 NM_003670  
Glycerol kinase 3.7 AJ252550 
Interleukin 6 signal transducer (gp130) 3.6 NM_002184 
cAMP responsive element-binding protein-like 2 3.6 AF039081 
CD48 antigen (B-cell membrane protein) 3.5 NM_001778 
Ubiquitin-activating enzyme E1-like protein 3.5 NM_006395 
RAN-binding protein 2 3.4 D42063 
Toll-like receptor 2 3.4 U88878 
Fc fragment of IgE, high affinity I, receptor 3.3 NM_004106  
Adenosine A2a receptor 3.3 S46950 
Peptidylprolyl isomerase F 3.2 M80254 
Flotillin 1 3.2 NM_005803  
TNF receptor–associated factor 3 3.2 U19260 
Annexin A7 3.2 J04543 
Sialyltransferase 4B 3.1 U63090 
Hepatoma-derived growth factor 3.1 A1720570  
Tissue inhibitor of metalloproteinase 1 3.0 AW261830 

ENA-78 mRNA expression and chemotaxis of neutrophils

As shown in Figure 1A, the untreated neutrophils did not express ENA-78 mRNA, but the neutrophils treated with G-CSF expressed ENA-78 mRNA. ENA-78 mRNA expression was induced by G-CSF in a dose-dependent manner (data not shown). mRNA expression of GCP-2 was not observed in the treated or untreated neutrophils (data not shown). Figure 1B shows that CXCR2, a receptor for ENA-78, was expressed at the same level both on the neutrophils treated with and without G-CSF. As shown in Figure 1C, chemotaxis of neutrophils enhanced by recombinant ENA-78 was abrogated by anti–ENA-78 and anti–CXCR-2 antibodies. Chemotaxis was also enhanced by the supernatants of the G-CSF–treated neutrophils. Reversely, anti–ENA-78 and anti–CXCR-2 antibodies abrogated the enhanced chemotaxis. These results indicate that the neutrophils stimulated by G-CSF secrete ENA-78 and consequently stimulate the chemotaxis of neutrophils, suggesting that neutrophils accumulated in the inflammatory sites secrete ENA-78 and then augment the accumulation of neutrophils when treated with G-CSF.

Fig. 1.

Expression of ENA-78 and CXCR-2 and chemotaxis of neutrophils.

(A) mRNA expression of ENA-78 in neutrophils treated with or without G-CSF. Total RNAs were obtained from the untreated neutrophils and those treated with 10 ng/mL G-CSF for 24 hours and then used for Northern blot analysis. Representative result of 3 different experiments is shown. (B) Expression of CXCR-2 on neutrophils. The untreated neutrophils and those treated with 10 ng/mL G-CSF for 24 hours were stained with anti–CXCR-2 antibody and fluorescein isothiocyanate–conjugated second antibody and then analyzed for expression of CXCR-2 with a FACScaliber. Representative result of 2 different experiments is shown. (C) Chemotaxis of neutrophils stimulated by conditioned medium of neutrophils. Supernatants of neutrophils treated with or without G-CSF (G+ or G, respectively) at 10 ng/mL were placed at 20% in the lower chambers. Anti–ENA-78 or anti–CXCR-2 antibody was added in the lower chambers at 2 μg/mL. Recombinant ENA-78 (10 ng/mL) was used as a positive control. Results are presented as percentage of numbers of transmigrated neutrophils treated with G CM. Data present the mean ± SD of 3 different experiments.

Fig. 1.

Expression of ENA-78 and CXCR-2 and chemotaxis of neutrophils.

(A) mRNA expression of ENA-78 in neutrophils treated with or without G-CSF. Total RNAs were obtained from the untreated neutrophils and those treated with 10 ng/mL G-CSF for 24 hours and then used for Northern blot analysis. Representative result of 3 different experiments is shown. (B) Expression of CXCR-2 on neutrophils. The untreated neutrophils and those treated with 10 ng/mL G-CSF for 24 hours were stained with anti–CXCR-2 antibody and fluorescein isothiocyanate–conjugated second antibody and then analyzed for expression of CXCR-2 with a FACScaliber. Representative result of 2 different experiments is shown. (C) Chemotaxis of neutrophils stimulated by conditioned medium of neutrophils. Supernatants of neutrophils treated with or without G-CSF (G+ or G, respectively) at 10 ng/mL were placed at 20% in the lower chambers. Anti–ENA-78 or anti–CXCR-2 antibody was added in the lower chambers at 2 μg/mL. Recombinant ENA-78 (10 ng/mL) was used as a positive control. Results are presented as percentage of numbers of transmigrated neutrophils treated with G CM. Data present the mean ± SD of 3 different experiments.

Several previous reports demonstrating that the chemotaxis of neutrophils was decreased by the treatment with G-CSF seem to be inconsistent with our present result.8,9 However, in those previous studies they examined the chemotaxis of newly developed neutrophils after the in vivo treatment with G-CSF; it is not surprising that the chemotaxis of newly developed immature neutrophils was low. In contrast, we demonstrated that the treatment with G-CSF induced the production of a chemotactic factor, ENA-78, in the neutrophils. Our present results, in combination with the findings of survival-inducing activity of G-CSF, suggest that G-CSF is effective for the treatment of infection through the augmentation of the neutrophil accumulation in the inflammatory sites in addition to the increase of neutrophils and the activation of effector functions.

We thank Kyowa Hakko for providing the G-CSF and Ms M. Yanome for assistance in preparing the manuscript.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

References

References
1
Moor
MA
The clinical use of colony stimulating factors.
Annu Rev Immunol.
9
1991
159
191
2
Stoltz
DA
Bagby
GJ
Nelson
S
Use of granulocyte colony-stimulating factor in the treatment of acute infectious diseases.
Curr Opin Hematol.
4
1997
207
212
3
Hartung
T
Granulocyte colony-stimulating factor: its potential role in infectious disease.
AIDS.
2
1999
S3
S9
4
Pitrak
DL
Effects of granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor on the bactericidal functions of neutrophils.
Curr Opin Hematol.
4
1997
183
190
5
Ogawa
M
Effects of hemopoietic growth factors on stem cells in vitro.
Hematol Oncol Clin North Am.
3
1989
453
464
6
Rapoport
AP
Abboud
CN
DiPersio
JF
Granulocyte-macrophage colony-stimulating factor (GM-CSF) and granulocyte colony-stimulating factor (G-CSF): receptor biology, signal transduction, and neutrophil activation.
Blood Rev.
6
1992
43
57
7
Kapp
A
Zeck-Kapp
G
Activation of the oxidative metabolism in human polymorphonuclear neutrophilic granulocytes: the role of immuno-modulating cytokines.
J Invest Dermatol.
95
1990
94S
99S
8
Spiekermann
K
Emmendoerffer
A
Elsner
J
et al
Altered surface marker expression and function of G-CSF-induced neutrophils from test subjects and patients under chemotherapy.
Br J Haematol.
87
1994
31
38
9
Azzara
A
Carulli
G
Rizzuti-Gullaci
A
et al
Motility of rhG-CSF-induced neutrophils in patients undergoing chemotherapy: evidence for inhibition detected by image analysis.
Br J Haematol.
92
1996
161
168
10
Itoh
Y
Kuratsuji
T
Tsunawaki
S
Aizawa
S
Toyama
K
In vivo effects of recombinant human granulocyte colony-stimulating factor on normal neutrophil function and membrane effector molecule expression.
Int J Hematol.
54
1991
463
469
11
Walz
A
Schmutz
P
Mueller
C
Schnyder-Candrian
S
Regulation and function of the CXC chemokine ENA-78 in monocytes and its role in disease.
J Leuk Biol.
62
1997
604
611
12
Lukacs
NW
Hogaboam
CM
Kunkel
SL
et al
Mast cells produce ENA-78, which can function as a potent neutrophil chemoattractant during allergic airway inflammation.
J Leuk Biol.
63
1998
746
751
13
Okabe
M
Asano
M
Kuga
T
et al
In vitro and in vivo hematopoietic effect of mutant human granulocyte colony-stimulating factor.
Blood.
75
1990
1788
1793
14
Choi
S
Kobayashi
M
Wang
J
et al
Activated leukocyte cell adhesion molecule (ALCAM) and annexin II are involved in the metastatic progression of tumor cells after chemotherapy with adriamycin.
Clin Exp Metastasis.
18
2000
45
50
15
Imai
K
Kobayashi
M
Wang
J
et al
Selective transendothelial migration of hematopoietic progenitor cells: a possible role in homing of progenitor cells.
Blood.
93
1999
149
156
16
Proost
P
De Wolf-Peeters
C
Conings
R
et al
Identification of a novel granulocyte chemotactic protein (GCP-2) from human tumor cells. In vitro and in vivo comparison with natural forms of GRO, IP-10, and IL-8.
J Immunol.
150
1993
1000
1010
17
Van Damme
J
Wuyts
A
Froyen
G
et al
Granulocyte chemotactic protein-2 and related CXC chemokines: from gene regulation to receptor usage.
J Leukoc Biol.
62
1997
563
569
18
Koch
AE
Kunkel
SL
Harlow
LA
et al
Epithelial neutrophil activating peptide-78: a novel chemotactic cytokine for neutrophils in arthritis.
J Clin Invest.
94
1994
1012
1018
19
Arenberg
DA
Keane
MP
DeGiovine
B
et al
Epithelial-neutrophil activating peptide (ENA-78) is an important angiogenic factor in non-small cell lung cancer.
J Clin Invest.
102
1998
465
472
20
Gyetko
MR
Sud
S
Kendall
T
Fuller
JA
Newstead
MW
Standiford
TJ
Urokinase receptor-deficient mice have impaired neutrophil recruitment in response to pulmonary Pseudomonas aeruginosa infection.
J Immunol.
165
2000
1513
1519

Author notes

Masanobu Kobayashi, Division of Cancer Pathobiology, Institute for Genetic Medicine, Hokkaido University, Kita-15, Nishi-7, Kita-Ku, Sapporo, 060-0815 Japan; e-mail:mkobaya@med.hokudai.ac.jp.