Abstract

Relative proportions of peripheral blood (PB) B lymphocytes (B220%) as well as CD4 (CD4%) and CD8 (CD8%) T lymphocytes differ significantly among inbred mouse strains: B220% is high in C57BL/6J (B6) and C57BR/cdJ, intermediate in BALB/cByJ (BALB) and DBA/2J (D2), and low in NOD/LtJ (NOD) and SJL/J (SJL) mice, whereas CD4% and CD8% are high in NOD and SJL mice and low in the other 4 strains. By following segregating genetic markers linked to these traits in (B6 × D2) recombinant inbred (BXD RI) mice, the study defined 2 quantitative trait loci (QTLs) for the B220% phenotype:Pbbcp1 (peripheral blood B cell percentage 1, logarithm of odds [LOD] 4.1, P < .000 01) and Pbbcp2(LOD 3.7, P < .000 04) on chromosome 1 (Chr 1) at about 63 cM and 48 cM; one suggestive locus for the CD4% phenotype (LOD 2.6,P < .000 57) on Chr 8 at about 73 cM; and one QTL for the CD8% phenotype: Pbctlp1 (peripheral blood cytotoxic T lymphocyte percentage 1, LOD 3.8, P < .000 02) on Chr 19 at about 12 cM. The study further segregated PB lymphocyte proportions in B6SJLF2 mice by using DNA markers adjacent to these mapped QTLs and found that the Pbbcp1 locus (LOD 5.6,P < .000 01) was also important in this mouse population. In both BXD RI and B6SJLF2 mice, QTLs regulating B-cell proportions showed no significant effect on T-cell proportions and vice versa. Thus, PB B- and T-lymphocyte proportions are regulated separately by different genetic elements.

Introduction

Mature leukocytes in mouse and human peripheral blood (PB) express specific cell surface molecules (markers) that can be detected by fluorescence-activated cell staining (FACS) using specific antibodies.1,2 The major categories of PB leukocytes include B lymphocytes that express B220, T-helper lymphocytes that express CD4, cytotoxic T lymphocytes that express CD8, and granulocytes that express Gr1. Under physiologic conditions, proportions of PB leukocyte subsets are relatively constant in mice from a particular genotype, showing a precise regulation of hematopoietic lineage commitment, differentiation, maturation, recruitment, and elimination.3 Proportions of PB leukocyte subsets can be dramatically altered by spontaneous and induced mutations; for example, a mutation in the DNA-dependent protein kinase gene in severe combined immune-deficient mice results in the absence of mature B and T lymphocytes in blood circulation.4-6 In addition, stromal cells, cytokines, receptors, ligands, signaling molecules, and transcription factors have been shown to affect levels of B and T lymphocytes.7-10 

Previous studies identified molecular factors that play important roles in the regulation of B-and T-cell commitment and balance such as cytokines interleukin-3 (IL-3) and IL-7, signaling receptor and ligandNotch and Jagged, paired-box genePax5, and the transcriptional factors E2A andEBF.3,11-13 Mutations that change the relative levels of other leukocyte subsets may also indirectly affect B- and T-cell proportions.14 Earlier studies found that the CD4/CD8 ratio is under genetic control in the mouse as well as in humans.15-17 A study using inbred mouse strains identified a quantitative trait locus (QTL) that regulates peripheral B220% on mouse chromosome 15 (Chr 15).18 Differences in the percentage of pre-B cells (BP-1+B220+) in the bone marrow of SL/Kh and NFS/N mice helped to map another regulatory QTL on mouse Chr 3.19 These studies illustrated that there are specific genetic loci that regulate CD4/CD8 ratio, B-cell apoptosis, and pre–B-cell expansion.

We and others have found significant strain differences in primitive immunohematopoietic progenitor cell functions between B6, BALB, and D2 mice and have defined QTLs that regulate hematopoietic stem cell development, proliferation, and senescence.20-23 It is important to also define strain differences in mature blood cell proportions. The current study is focused on the genetic elements that regulate strain differences in blood cell proportions and tests whether the same QTL affects both B- and T-cell proportions.

We examined PB B220%, CD4%, and CD8% in healthy young mice of 6 inbred strains from 3 separate original stocks and found significant strain differences. We then segregated these strain differences in 35 strains of (C57BL/6 × DBA/2) recombinant inbred (BXD RI) mice and mapped 2 QTLs for the B220% phenotype, one QTL for the CD8% phenotype, and one suggestive locus for the CD4% phenotype. We further analyzed 98 intercross F2 mice derived from C57BL/6J (B6) and SJL/J (SJL) inbred strains (B6SJLF2) and found that one of the QTLs for the B220% phenotype was also mapped to the same location in the B6SJLF2 mice. In both studies, PB B- and T-lymphocyte proportions are regulated separately by different QTLs.

Materials and methods

Mice

Mice of the B6, C57BR/cdJ, BALB/cByJ (BALB), DBA/2J (D2), NOD/LtJ (NOD), and SJL inbred strains, of 35 BXD RI strains, and of the B6SJLF2 intercross were all produced and raised at The Jackson Laboratory (Bar Harbor, ME) using standard animal care and nutrition.24 Mice of both genders were used as specified in each experiment.

Sample collection and FACS analysis

Procedures for FACS analysis were adapted from previous studies.25 In brief, 2 micro-hematocrit tubes (75 μL) of blood were taken from the orbital sinus of each mouse and mixed with 1350 μL Hanks balanced salt solution in the presence of 5 mM ethylenediaminetetraacetic acid. Diluted blood samples were incubated in Gey solution twice for 10 minutes each time to lyse erythrocytes. Leukocytes were stained with specific antibody cocktails in FACS buffer for 30 minutes. When a biotinylated antibody was used, samples were stained with streptavidin red 670 for an additional 30 minutes. Cells were kept on ice or at 4°C during incubation, staining, and centrifugation procedures. Monoclonal antibodies specific for mouse B220 (clone RA3-6B2), CD4 (clone GK1.5), CD8 (clone 53-6.72), Gr1 (clone RB6-8C5), and the streptavidin-conjugated dye red 670 were purchased from Pharmingen (San Diego, CA). Stained cells were analyzed by either FACScan II or FACScalibur flow cytometry (Becton Dickinson Immunocytometry Systems, Mansfield, MA). We collected 10 000 to 20 000 leukocytes for each sample.

Polymerase chain reaction

Genomic DNA samples were prepared from mouse tail tips, and DNA markers were analyzed by polymerase chain reaction (PCR) for each of the 98 B6SJLF2 mice. Primers for the Gli2 locus,Gli2-pA: TTCAGGCAGACCAAAGATAGAACATT and Gli2-pB: CACTGACATATGTACCATTTTCAT and primers for the Bcl2 locus, 24.MMBCL2A: CATTATCAATGATGTAC CATG and 24.MMBCL2B: GCAGTAAATAGCTGATTCGAC were purchased from One Trick Pony Oligos (Ramona, CA). Primers for regular Mit DNA microsatellite markers were purchased from Research Genetics (Huntsville, AL). PCRs were carried out in a GeneAmp PCR system 9600 (Perkin Elmer) using Taq DNA polymerase. We used a program with a 97°C touchdown for 30 seconds followed by 40 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds + 1 second. A 10-minute enlongation at 72°C was added at the end of the reaction. Each sample was amplified in 10 μL volume, electrophoresed in a 3% agarose gel, and stained with ethidium bromide.

QTL mapping and statistical analysis

Genotype data for the 35 BXD RI mouse strains were retrieved online from the Mouse Genome Database, which is maintained at The Jackson Laboratory (http://www.bioinformatics.jax.org). We used Map Manager QTXb11 software, also available online at the same Web site, for QTL mapping analyses.26 Significance of linkage was judged by using the LOD (logarithm of odds) score in both the RI lines and the B6SJLF2 intercross mice.26-28 The B220%, CD4%, and CD8% of B6SJLF2 mice were also tested by variance analysis, using the JMP statistical discovery software (SAS Institute, Cary, NC) on the Fit Model platform to define allelic difference.29 

Results

Strain differences in PB lymphocyte proportions

We analyzed PB leukocyte proportions in healthy young (2-3 months) B6, C57BR/cdJ, BALB, D2, NOD, and SJL mice. Data presented in Table1 show that concentrations of circulating white blood cells (WBCs) were high in B6 and C57BR/cdJ mice, slightly lower in BALB and D2 mice, and significantly lower (P < .01) in NOD and SJL mice. Percentages of B cells (B220%) were significantly different among the 6 inbred strains (P < .01): high in B6 (67%) and C57BR/cdJ (60%) mice, intermediate in BALB (46%) and D2 (46%) mice, and low in NOD (18%) and SJL (16%) mice. Percentages of CD4 (CD4%) and CD8 (CD8%) T lymphocytes were significantly higher (P < .01,P < .01) in NOD (50%, 17%) and SJL (58%, 20%) mice than in the other 4 strains (CD4, 13%-30%; CD8, 6%-11%), whereas percentages of granulocytes (Gr1%) were similar in the 6 strains (Table 1, Figure 1). Thus, there are significant strain differences in mouse PB B220%, CD4%, and CD8%, suggesting that PB lymphocyte proportions are genetically regulated.

Table 1.

Strain effects on peripheral blood lymphocyte composition

Strain WBCs (106/mL) B220% CD4% CD8% Gr1% 
C57BL/6J 11.2 ± 0.5 67.0 ± 1.1 13.3 ± 0.6 7.7 ± 0.3 11.1 ± 0.3 
C57BR/cdJ 14.4 ± 0.3 59.6 ± 1.3 23.2 ± 1.2 10.4 ± 1.5 13.2 ± 0.6 
BALB/cByJ 10.3 ± 0.6 45.8 ± 2.7 29.3 ± 1.7 10.8 ± 0.6 13.3 ± 1.2 
DBA/2J 8.6 ± 1.1 46.1 ± 4.6 18.3 ± 0.1 5.9 ± 0.2 15.5 ± 2.9 
NOD/LtJ 3.2 ± 0.6 17.6 ± 0.9 49.5 ± 1.5 17.1 ± 0.8 12.9 ± 2.8 
SJL/J 5.7 ± 1.0 16.1 ± 1.3 57.5 ± 1.1 20.1 ± 1.6 8.3 ± 1.2 
B6D2F1 9.6 ± 0.2 63.7 ± 1.0 14.9 ± 0.3 8.9 ± 0.4 12.1 ± 0.6 
CByB6F1 8.6 ± 1.3 59.3 ± 2.0 12.8 ± 0.7 6.2 ± 1.4 11.9 ± 1.6 
Strain effect P < .01 P < .01 P < .01 P < .01 NS 
Strain WBCs (106/mL) B220% CD4% CD8% Gr1% 
C57BL/6J 11.2 ± 0.5 67.0 ± 1.1 13.3 ± 0.6 7.7 ± 0.3 11.1 ± 0.3 
C57BR/cdJ 14.4 ± 0.3 59.6 ± 1.3 23.2 ± 1.2 10.4 ± 1.5 13.2 ± 0.6 
BALB/cByJ 10.3 ± 0.6 45.8 ± 2.7 29.3 ± 1.7 10.8 ± 0.6 13.3 ± 1.2 
DBA/2J 8.6 ± 1.1 46.1 ± 4.6 18.3 ± 0.1 5.9 ± 0.2 15.5 ± 2.9 
NOD/LtJ 3.2 ± 0.6 17.6 ± 0.9 49.5 ± 1.5 17.1 ± 0.8 12.9 ± 2.8 
SJL/J 5.7 ± 1.0 16.1 ± 1.3 57.5 ± 1.1 20.1 ± 1.6 8.3 ± 1.2 
B6D2F1 9.6 ± 0.2 63.7 ± 1.0 14.9 ± 0.3 8.9 ± 0.4 12.1 ± 0.6 
CByB6F1 8.6 ± 1.3 59.3 ± 2.0 12.8 ± 0.7 6.2 ± 1.4 11.9 ± 1.6 
Strain effect P < .01 P < .01 P < .01 P < .01 NS 

Data shown as mean ± SEM of 3 to 4 males measured for each strain at 2 to 3 months of age.

WBC indicates white blood cell.

Fig. 1.

Peripheral blood leukocyte composition.

Peripheral blood from 2- to 3-month-old mice were stained with B220-FITC + CD4-Cy3 + CD8-PE +Gr1-biotin and streptavidin-red 670 after erythrocytes were lysed with Gey solution. Data shown are dot plots of representatives from 3 to 4 male mice measured for each strain.

Fig. 1.

Peripheral blood leukocyte composition.

Peripheral blood from 2- to 3-month-old mice were stained with B220-FITC + CD4-Cy3 + CD8-PE +Gr1-biotin and streptavidin-red 670 after erythrocytes were lysed with Gey solution. Data shown are dot plots of representatives from 3 to 4 male mice measured for each strain.

To define the pattern of inheritance, we measured B220%, CD4%, CD8%, Gr1%, and total WBCs in B6D2F1 and CByB6F1 hybrid mice. Interestingly, both hybrid F1 stocks had leukocyte proportions similar to those of B6 mice (Table 1), indicating that B6 genetic elements are dominant to those of the BALB or D2 genetic elements in the regulation of PB lymphocyte proportions.

Mapping QTLs for PB lymphocyte proportions in BXD RI mice

To segregate the genetic factors that regulate lymphocyte proportions, we measured B220%, CD4%, and CD8% in PB of healthy young mice from 35 BXD RI strains. Individuals from the same RI strain share the same genotype and are homozygous at almost all (> 99.99%) loci, with about half of the loci carrying alleles from each parental strain.30,31 Many polymorphic loci and DNA markers have been analyzed in the BXD RI strains, and the allele information is available online through the Mouse Genome Database. The mean B220%, CD4%, and CD8% values for the 35 BXD RI strains shown in Table2 were used in mapping analyses, which relied heavily on data from BXD 1-32 (Table 2) because many marker loci have not been defined in BXD 33-42.

Table 2.

Concurrence of B220%, CD4%, and CD8% with marker loci in BXD RI mice

BXD Pbbcp2 B% Pbbcp1 CD4% D8Mit156 CD8% Pbctlp1 
 1 60 20 7.7 
 2 64 6.1 
 5 49 25 11.5 
 6 38 18 9.0 
 8 58 14 6.4 
 9 61 14 11.7 
11 44 18 7.1 
12 61 16 7.1 
13 55 12 5.6 
14 67 2.5 
15 53 16 7.5 
16 34 19 14.6 
18 44 11 7.1 
19 60 10 6.4 
20 25 25.4 
21 48 13 6.9 
22 58 19 10.0 
23 39 15 9.0 
24 44 20 8.0 
25 69 11 4.5 
27 — 53 11 13.5 
28 — 56 — 10 6.9 
29 52 15 11.7 
30 49 16 11.7 
31 61 6.7 
32 46 12 5.4 
33 — 58 — 12 8.4 
34 — 46 — 20 7.3 
35 — 42 — 18 15.7 
36 — 54 — 16 9.6 
37 — 44 — 21 14.9 
38 — 43 — 18 15.7 
39 — 49 — 19 9.0 
40 — 63 — 11 7.3 
42 — 50 — 12 7.6 
BXD Pbbcp2 B% Pbbcp1 CD4% D8Mit156 CD8% Pbctlp1 
 1 60 20 7.7 
 2 64 6.1 
 5 49 25 11.5 
 6 38 18 9.0 
 8 58 14 6.4 
 9 61 14 11.7 
11 44 18 7.1 
12 61 16 7.1 
13 55 12 5.6 
14 67 2.5 
15 53 16 7.5 
16 34 19 14.6 
18 44 11 7.1 
19 60 10 6.4 
20 25 25.4 
21 48 13 6.9 
22 58 19 10.0 
23 39 15 9.0 
24 44 20 8.0 
25 69 11 4.5 
27 — 53 11 13.5 
28 — 56 — 10 6.9 
29 52 15 11.7 
30 49 16 11.7 
31 61 6.7 
32 46 12 5.4 
33 — 58 — 12 8.4 
34 — 46 — 20 7.3 
35 — 42 — 18 15.7 
36 — 54 — 16 9.6 
37 — 44 — 21 14.9 
38 — 43 — 18 15.7 
39 — 49 — 19 9.0 
40 — 63 — 11 7.3 
42 — 50 — 12 7.6 

Two males 3 to 5 months of age were measured for each BXD RI line.

Pbbcp2 indicates peripheral blood B cell percentage 2;Pbbcp1, peripheral blood B cell percentage 1;Pbctlp1, peripheral blood cytotoxic T lymphocyte percentage 1; B, B6 allele; D, D2 allele; and —, genotype data not available.

For the B220% phenotype, we mapped 2 QTLs. One of these QTLs showed linkage to the 62- to 64-cM segment of Chr 1 with the strongest linkage to the D1Mit188 marker at 63.1 cM (LOD 4.1,P < .000 01). We have provisionally designated this locus peripheral blood B cell percentage 1, or Pbbcp1(Figure 2A). The other locus also mapped to Chr 1 with the strongest linkage to the D1Ncvs45 marker at 48.4 cM (LOD 3.7, P < .000 04). We designated this locus Pbbcp2 (Figure 2A). Both P values passed the P < .0001 threshold and are considered significant in genome-wide mapping analyses.27,32 The Bcl2locus is located in between the 2 QTLs at 59.8 cM.

Fig. 2.

QTLs for the B220%, CD4%, and CD8% phenotypes in BXD RI mice.

Peripheral blood B220%, CD4%, and CD8% were measured in 35 BXD RI strains for QTL mapping by using predetermined genotype data and the Map Manager QTXb11 software, both available from The Jackson Laboratory (http://www.bioinformatics.jax.org) Web site.56Two QTLs were defined for the B220% phenotype (A), designated peripheral blood B cell percentage 1 (Pbbcp1, LOD 4.1,P < .00001) and Pbbcp2 (LOD 3.7,P < .00004), on chromosome 1 (Chr 1) at 63.1 cM and 48.4 cM, respectively. A suggestive locus was found for the CD4% phenotype (LOD 2.6, P < .000 57) at 73 cM on Chr 8 (B). A QTL for the CD8% phenotype, peripheral blood cytotoxic T lymphocyte percentage 1 (Pbctlp1, LOD 3.8, P < .000 02), was mapped to the 9- to 24-cM region of Chr 19 (C).

Fig. 2.

QTLs for the B220%, CD4%, and CD8% phenotypes in BXD RI mice.

Peripheral blood B220%, CD4%, and CD8% were measured in 35 BXD RI strains for QTL mapping by using predetermined genotype data and the Map Manager QTXb11 software, both available from The Jackson Laboratory (http://www.bioinformatics.jax.org) Web site.56Two QTLs were defined for the B220% phenotype (A), designated peripheral blood B cell percentage 1 (Pbbcp1, LOD 4.1,P < .00001) and Pbbcp2 (LOD 3.7,P < .00004), on chromosome 1 (Chr 1) at 63.1 cM and 48.4 cM, respectively. A suggestive locus was found for the CD4% phenotype (LOD 2.6, P < .000 57) at 73 cM on Chr 8 (B). A QTL for the CD8% phenotype, peripheral blood cytotoxic T lymphocyte percentage 1 (Pbctlp1, LOD 3.8, P < .000 02), was mapped to the 9- to 24-cM region of Chr 19 (C).

For the CD4% phenotype, we found a putative linkage to a DNA markerD8Mit156 (LOD 2.6, P < .000 57) at 73 cM on Chr 8 (Figure 2B). This P value is considered suggestive and reportable but not fully significant.27,32 For the CD8% phenotype, we mapped a QTL to the 9- to 24-cM region of Chr 19 with the strongest linkage to the D19Mit28 marker at 12 cM (LOD 3.8,P < .000 02). We have designated this locus peripheral blood cytotoxic T lymphocyte percentage 1, or Pbctlp1(Figure 2C).

From the mapping analyses, we noted that the QTL for the B220% phenotype showed no linkage to either the CD4% or the CD8% phenotype. However, the Pbbctlp1 locus had no linkage to the B220% phenotype either. Thus, B- and T-cell proportions are regulated by different QTLs in the BXD RI mice.

Mapping of the Pbbcp1 locus to the same location in B6SJLF2 mice

The existence of RI lines with preanalyzed genotype data provides a good resource for QTL mapping. However, other genetic methods should be used to test QTLs defined by RI lines. Toward this end, we produced a panel of B6SJLF2 mice and measured PB B220%, CD4%, and CD8% at 2 to 3 months of age. We then tested DNA markers on each mouse near each putative locus defined earlier by using the BXD RI lines. When a marker of interest was not polymorphic between B6 and SJL mice, a nearby polymorphic marker was analyzed.

We first tested the hypothesis that Pbbcp1 andPbbcp2 are important loci in the regulation of B220% difference between B6 and SJL mice. This test was done by analyzing 12 polymorphic markers in the 41- to 70-cM region of Chr 1 on 98 B6SJLF2 mice, followed by a mapping analysis. Three markers adjacent to thePbbcp1 locus, D1Mit387 (62 cM), Gli2(63 cM), and D1Mit419 (63.1 cM), all showed strong linkage to the B220% phenotype (LOD 5.4, 5.6, and 5.6, all atP < .000 01), whereas the linkages to the B220% were lower but still significant at Bcl2 (59.8 cM, LOD 4.9).D1Mit139 (65 cM, LOD 5.4), D1Mit286 (67 cM, LOD 5.2), and D1Mit446 (70 cM, LOD 4.9) loci (Figure3). Note that the Gli2 andD1Mit419 loci overlap on Figure 3. At the Gli2locus where Pbbcp1 showed the strongest linkage (LOD 5.6), B220% was significantly higher (P < .01) in the carriers of the B6 (36.6% ± 1.8%) and F1 (32.6% ± 1.0%) alleles than in the carriers of the SJL (6.3% ± 1.3%) allele. Thus, we mapped thePbbcp1 locus to the same 60- to 70-cM Chr 1 location in the B6SJLF2 intercross mouse population. It is of particular interest to note that the Pbbcp1 locus had no effect on either the CD4% or the CD8% phenotype in B6SJLF2 mice, further indicating that PB B- and T-lymphocyte proportions are regulated by different genetic elements.

Fig. 3.

Mapping the

Pbbcp1 locus in B6SJLF2 mice. A total of 98 B6SJLF2 mice (51 males, 47 females) were produced; measured for PB B220%, CD4%, and CD8% phenotypes at 2 to 3 months of age; tested for selected polymorphic markers adjacent to the Pbbcp1,Pbbcp2, and Pbctlp1 QTL regions; and proceeded for linkage analyses with the use of the Map Manager QTXb11 software. Only the Pbbcp1 locus was mapped to the same Chr 1 region with statistic significance (LOD 5.6,P < .000 01).

Fig. 3.

Mapping the

Pbbcp1 locus in B6SJLF2 mice. A total of 98 B6SJLF2 mice (51 males, 47 females) were produced; measured for PB B220%, CD4%, and CD8% phenotypes at 2 to 3 months of age; tested for selected polymorphic markers adjacent to the Pbbcp1,Pbbcp2, and Pbctlp1 QTL regions; and proceeded for linkage analyses with the use of the Map Manager QTXb11 software. Only the Pbbcp1 locus was mapped to the same Chr 1 region with statistic significance (LOD 5.6,P < .000 01).

The other 5 Chr 1 markers we have tested on B6SJLF2 mice that cover thePbbcp2 locus region showed decreasing significance levels in the linkage analysis: D1Mit135 (59.7 cM, LOD 4.5,P < .000 01), D1Mit48 (54.0 cM, LOD 3.5,P < .000 05), D1Mit216 (49.7 cM, LOD 2.5,P < .000 87), D1Mit46 (43.1 cM, LOD 2.3,P < .001 18), and D1Mit24 (41.0 cM, LOD 2.0,P < .002 30). Thus, on the basis of the markers we have tested, Pbbcp2 was not an independent locus for the B220% phenotype in the B6SJLF2 mouse population.

For the suggestive CD4% locus, we tested 12 standard Mit markers in the 69- to 73-cM region of Chr 8: D8Mit140 andD8Mit324 at 69 cM; D8Mit122 at 70 cM;D8Mit42, D8Mit52, D8Mit92, D8Mit279, and D8Mit325 at 71 cM; D8Mit93,D8Mit245, and D8Mit326 at 72 cM; andD8Mit156 at 73 cM. None of these markers showed detectable polymorphism between B6 and SJL mice by using our assay.

For the Pbctlp1 locus, we tested 5 polymorphic markers in the 8- to 41-cM region of mouse Chr 19 on B6SJLF2 mice:D19Mit69 (8 cM), D19Mit61 (9 cM),D19Mit106 (22 cM), D19Mit40 (25 cM),D19Mit11 (41 cM), and we performed a mapping analysis. None of the 5 tested markers was linked to the CD8% phenotype in the B6SJLF2 intercross mouse population. It is possible that the SJL strain may not differ from the B6 strain at the Pbctlp1 locus.

Overall, we mapped 2 QTLs for the B220% phenotype, one QTL for the CD8% phenotype and one suggestive locus for the CD4% phenotype by using the BXD RI mice (Table 3). ThePbbcp1 locus was also mapped to the same Chr 1 region in the B6SJLF2 intercross mouse population.

Table 3.

Quantitative trait loci for peripheral blood lymphocyte proportions

Name Phenotype Chromosome Location LOD P In B6SJLF2  
Pbbcp1 B220% 63 cM 5.6 < .00001 Yes 
Pbbcp2 B220% 48 cM 3.7 < .00004 No 
Pbctlp1 CD8% 19 12 cM 3.8 < .00002 No 
— CD4% 73 cM 2.6 < .00057 No 
Name Phenotype Chromosome Location LOD P In B6SJLF2  
Pbbcp1 B220% 63 cM 5.6 < .00001 Yes 
Pbbcp2 B220% 48 cM 3.7 < .00004 No 
Pbctlp1 CD8% 19 12 cM 3.8 < .00002 No 
— CD4% 73 cM 2.6 < .00057 No 

LOD indicates logarithm of odds.

Discussion

Genetic regulation of PB lymphocyte proportions

Mouse PB B220%, CD4%, and CD8% are genetically regulated, as shown by the consistent differences among inbred mouse strains derived from different original stocks (Table 1). The B6 and C57BR/cdJ inbred strains both originated from the mating of female 57 with male 52 from Miss Abbie Lathrop's stock,24 and both have high levels of B cells and low levels of CD4 and CD8 T cells. The BALB and D2 inbred strains both originated from Castle mice received from Lathrop,24 and both have intermediate levels of B cells and low levels of CD4 and CD8 cells. The NOD and SJL inbred strains both originated from Swiss mice at the Pasteur Institute. NOD was derived from outbred ICR/Jcl mice in the 1970s, and SJL was derived from noninbred Swiss Webster mice in the 1960s.33Both of these Swiss-derived strains have low levels of B cells and high levels of CD4 and CD8 cells (Table 1). With low concentrations of circulating WBCs (Table 1), NOD and SJL mice have significantly lower levels of circulating B cells than the other 4 strains.

Importance in the regulation of PB lymphocyte proportions

Regulation of PB lymphocyte proportions may have biomedical significance. B6 and C57BR/cdJ mice have high B220%, low CD4% and CD8%, and low tumor incidences.34-39 BALB and D2 mice have intermediate B220%, CD4%, and CD8% and intermediate tumor incidences.34,35,39,40 SJL mice have low B220%, high CD4% and CD8%, and high tumor incidences, especially of the type B–reticulum cell sarcoma.41-43 NOD mice also have low B220% and high CD4% and CD8%. They develop many types of tumors when fed a specific diet to prevent diabetes.44 Thus, mouse PB B220%, CD4%, and CD8% measured early in life may be associated with tumor incidences later in life.

Regulation of PB lymphocyte proportion may also be related to average life span. In 22 strains of inbred mice and 5 F1 hybrids, we found that mean life span is positively correlated with B220% (r = 0.67, P < .0001), negatively correlated with CD4% (r = −0.54, P < .0040) and CD8% (r = −0.23, P = .26).24 These correlations may be related to tumor incidences because strains with high tumor incidences tend to die relatively early. In the BXD RI mice, however, average life spans showed no significant correlation with B220% (r = −0.16, P = .47), or CD4% (r = 0.13, P = .55), or CD8% (r = 0.29, P = .20).45 Thus, future studies are needed to clarify the relationship between B220%, CD4%, CD8%, and life expectancy.

QTL mapping

Our mapping analyses on the BXD RI mice used 3 phenotypes; thus, the threshold P value for significant linkage on genome-wide scan should be adjusted to .000 03 for each phenotype (.0001 ÷ 3). Judging by this adjusted P value, the Pbbcp1and Pbctlp1 loci are still significant, whereas thePbbcp2 locus is marginally significant. Because thePbbcp1 locus was also mapped to the same chromosomal region by using the B6SJLF2 mice, this locus regulates B220% in both the B6-D2 and B6-SJL genetic combinations.

The Pbbcp2 locus had the strongest linkage to theD1Ncvs44 marker at 48.4 cM on Chr 1 in the BXD RI mice.46 Interestingly, another locus, Ncl, also located at 48.4 cM on Chr 1,47,48 showed no linkage to the B220% phenotype in the same BXD RI strains (data not shown) because 8 of the 26 BXD RI strains showed crossover between theD1Ncvs44 locus and the Ncl locus. Whether or not the D1Ncvs44 locus is polymorphic between B6 and SJL mice is yet to be defined. Thus, further analyses are needed to clarify whetherPbbcp2 is a real locus, and whether the Pbbcp2locus is really located at 48.4 cM on mouse Chr 1.

The fact that neither the Pbctlp1 nor the suggestive CD4% locus were found in the B6SJLF2 intercross mice indicates that the B6 and SJL mice are probably not polymorphic at these loci. It is possible that the suggestive CD4% locus may not be a real locus. It is also possible, although less likely, that the Pbctlp1 locus is a false-positive QTL for regulating the CD8% phenotype.

Importantly, in both the BXD RI and the B6SJLF2 mice, B220%, CD4%, and CD8% are each regulated by different genetic elements. ThePbbcp1 and Pbbcp2 loci had no significant effect on the CD4% and CD8% phenotypes, whereas the Pbctlp1 locus had no significant effect on the B220% and CD4% phenotypes.

Potential gene candidates for the Pbbcp1 locus

There are many genes in the 60- to 70-cM Chr 1 region that are potential candidates for the Pbbcp1 locus (Table4); however, we emphasize 2 possibilities: Gli2 at 63 cM and En1 at 64.1 cM, both of which are important genes in the regulation of embryonic development. The Gli2 locus is polymorphic between B6 and D2 and between B6 and SJL mice. It encodes the vertebrate GLI2 zinc finger protein that is a putative transcription factor responding to sonic hedgehog signaling.49,50 Mutant mice lackingGli2 function exhibit defects in embryonic development.49,51,52 To date, there has been no report showing that Gli2 is involved in lymphohematopoiesis. However, the Gli2 polymorphism marked the B220% phenotype in both BXD RI (LOD 3.7, P < .000 04, Figure 2A) and B6SJLF2 mice (LOD 5.6, P < .000 01, Figure 3), suggesting that Gli2 may be a candidate gene for thePbbcp1 locus. The En1 locus encodes a homeobox-containing transcriptional factor that controls pattern formation during development of the central nervous system.53-55 En1 showed significant linkage to the Pbbcp1 locus in the BXD RI lines (LOD 3.6,P < .000 05). Other potential candidate genes for thePbbcp1 locus and their locations and human homologies are listed in Table 4. However, all candidates are very tentative at the current level of genetic resolution.

Table 4.

Potential candidate genes and human homologies for thePbbcp1 locus

Gene name Mouse gene Mouse position Human gene Human position 
B-cell leukemia/lymphoma 2 Bcl2 59.8 cM BCL2 18q21.33 
Troponin I, skeletal, slow 1 Tnni1 60.0 cM TNNI1 1q32-q32  
Troponin T2, cardiac Tnnt2 60.0 cM TNNT2 1q32-q32  
Serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2 Serpinb2 61.1 cM SERPINB2 18q22.1  
GLI-Kruppel family memberGli2 Gli2 63.0 cM GLI2 2pter-qter 
5-Hydroxytryptamine (serotonin) receptor 5B Htr5b 63.0 cM HTR5B 2q11-q13  
Engrailed 1 Enzyme 64.1 cM Enzyme 2q13-q21  
Inhibin beta-B Inhbb 64.1 cM INHBB 2cen-q13  
Gastrulation brain homeobox 2 Gbx2 65.0 cM GBX2 2q37-q37  
Chemokine (C-X-C) receptor 4 Cmkar4 67.4 cM CXCR4 2pter-qter 
Gene name Mouse gene Mouse position Human gene Human position 
B-cell leukemia/lymphoma 2 Bcl2 59.8 cM BCL2 18q21.33 
Troponin I, skeletal, slow 1 Tnni1 60.0 cM TNNI1 1q32-q32  
Troponin T2, cardiac Tnnt2 60.0 cM TNNT2 1q32-q32  
Serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2 Serpinb2 61.1 cM SERPINB2 18q22.1  
GLI-Kruppel family memberGli2 Gli2 63.0 cM GLI2 2pter-qter 
5-Hydroxytryptamine (serotonin) receptor 5B Htr5b 63.0 cM HTR5B 2q11-q13  
Engrailed 1 Enzyme 64.1 cM Enzyme 2q13-q21  
Inhibin beta-B Inhbb 64.1 cM INHBB 2cen-q13  
Gastrulation brain homeobox 2 Gbx2 65.0 cM GBX2 2q37-q37  
Chemokine (C-X-C) receptor 4 Cmkar4 67.4 cM CXCR4 2pter-qter 

Pbbcp1 indicates peripheral blood B cell percentage 1.

Overall, the mapping of the Pbbcp1 locus in 2 independent studies suggests that this locus is important in the regulation of PB B220% in both the B6-D2 and B6-SJL genetic combinations. In both studies, B- and T-cell proportions are regulated independently by different QTLs. Such genetically based regulation of PB lymphocyte proportion may be associated with health and longevity. Because thePbbcp1 locus maps to a well-conserved chromosomal region that harbors genes regulating embryonic development, it is possible that the gene or genes encoded by this locus may regulate cell fate both during embryonic development and during adult lymphohematopoiesis.

We thank Drs Edward H. Leiter and Brian Soper for critical review comments, Dr Stephen Sampson for technical editing, Mr Ted Duffy for technical assistance in FACS analyses, and Ms Elaine Shown for technical assistance in PCR analyses.

Supported by R01 grant HL58820 and a core grant CA34196 from the National Institutes of Health.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

References

References
1
Spangrude
GJ
Klein
J
Heimfeld
S
Aihara
Y
Weissman
IL
Two monoclonal antibodies identify thymic-repopulating cells in mouse bone marrow.
J Immunol.
142
1989
425
430
2
Wu
L
Scollay
R
Egerton
M
et al. 
CD4 expressed on earliest T-lineage precursor cells in the adult murine thymus.
Nature.
349
1991
71
74
3
Busslinger
M
Nutt
SL
Rolink
AG
Lineage commitment in lymphopoiesis.
Curr Opin Immunol.
12
2000
151
158
4
Kirchgessner
CU
Patil
CK
Evans
JW
et al. 
DNA-dependent kinase (p350) as a candidate gene for the murine SCID defect.
Science.
267
1995
1178
1183
5
Blunt
T
Gell
D
Fox
M
et al. 
Identification of a nonsense mutation in the carboxyl-terminal region of DNA-dependent protein kinase catalytic subunit in the SCID mouse.
Proc Natl Acad Sci U S A.
93
1996
10285
10290
6
Greiner
DL
Hesselton
RA
Shultz
LD
SCID mouse models of human stem cell engraftment.
Stem Cells.
16
1998
166
177
7
Obinata
M
Okuyama
R
Matsuda
KI
Koguma
M
Yanai
N
Regulation of myeloid and lymphoid development of hematopoietic stem cells by bone marrow stromal cells.
Leuk Lymphoma.
29
1998
61
69
8
Borge
OJ
Adolfsson
J
Jacobsen
AM
Lymphoid-restricted development from multipotent candidate murine stem cells: distinct and complimentary functions of the c-kit and flt3-ligands.
Blood.
94
1999
3781
3790
9
Metcalf
D
Lineage commitment in the progeny of murine hematopoietic preprogenitor cells: influence of thrombopoietin and interleukin 5.
Proc Natl Acad Sci U S A.
95
1998
6408
6412
10
Colucci
F
Di Santo
JP
The receptor tyrosine kinase c-kit provides a critical signal for survival, expansion, and maturation of mouse natural killer cells.
Blood.
95
2000
984
991
11
Thompson
A
Brouns
GS
Schuurman
RK
Borst
J
Timmers
E
A pro-B-cell stage characterized by germline Ig transcription without surrogate light chain expression.
Immunogenetics.
48
1998
305
311
12
Nutt
SL
Heavey
B
Rolink
AG
Busslinger
M
Commitment to the B-lymphoid lineage depends on the transcription factor Pax5.
Nature.
401
1999
556
562
13
Enver
T
B-cell commitment: Pax5 is the deciding factor.
Curr Biol.
9
1999
R933
935
14
Dave
VP
Allman
D
Keefe
R
Hardy
RR
Kappes
DJ
HD mice: a novel mouse mutant with a specific defect in the generation of CD4+ T cells.
Proc Natl Acad Sci U S A.
95
1998
8187
8192
15
Clementi
M
Forabosco
P
Amadori
A
et al. 
CD4 and CD8 T lymphocyte inheritance. Evidence for major autosomal recessive genes.
Hum Genet.
105
1999
337
342
16
Kraal
G
Weissman
IL
Butcher
EC
Genetic control of T-cell subset representation in inbred mice.
Immunogenetics.
18
1983
585
592
17
Amadori
A
Zamarchi
R
De Silvestro
G
et al. 
Genetic control of the CD4/CD8 T-cell ratio in humans.
Nat Med.
1
1995
1279
1283
18
Hoag
KA
Clise-Dwyer
K
Lim
YH
et al. 
A quantitative-trait locus controlling peripheral B-cell deficiency maps to mouse Chromosome 15.
Immunogenetics.
51
2000
924
929
19
Lu
LM
Shimada
R
Higashi
S
Zeng
Z
Hiai
H
Bone marrow ptr-B-1 (Bomb1): a quantitative trait locus inducing bone marrow pre-B-cell expansion in lymphoma-prone SL/Kh mice.
Cancer Research.
59
1999
2593
2595
20
Chen
J
Astle
CM
Harrison
DE
Development and aging of primitive hematopoietic stem cells in BALB/cBy mice.
Exp Hematol.
27
1999
928
935
21
Chen
J
Astle
CM
Harrison
DE
Genetic regulation of primitive hematopoietic stem cell senescence.
Exp Hematol.
28
2000
442
450
22
de Haan
G
Van Zant
G
Intrinsic and extrinsic control of hemopoietic stem cell numbers: mapping of a stem cell gene.
J Exp Med.
186
1997
529
536
23
de Haan
G
Nijhof
W
Van Zant
G
Mouse strain-dependent changes in frequency and proliferation of hematopoietic stem cells during aging: correlation between lifespan and cycling activity.
Blood.
89
1997
1543
1550
24
Staff of The Jackson Laboratory
Handbook on Genetically Standardized JAX Mice.
1997
The Jackson Laboratory
Bar Harbor, ME
25
Chen
J
Astle
CM
Harrison
DE
Delayed immune aging in diet-restricted B6CBAT6F1 mice is associated with preservation of naive T cells.
J Gerontol Biol Sci.
53A
1998
B330
337
26
Manly
KF
Olson
JM
Overview of QTL mapping software and introduction to Map Manager QT.
Mamm Genome.
10
1999
327
334
27
Lander
ES
Schork
NJ
Genetic dissection of complex traits.
Science.
265
1994
2037
2048
28
Kruglyak
L
Lander
ES
A nonparametric approach for mapping quantitative trait loci.
Genetics.
139
1995
1421
1428
29
SAS Institute Inc
JMP Statistics and Graphics Guide, Version 3.
1998
SAS Institute
Cary, NC
30
Taylor
BA
Recombinant inbred strains.
Genetic Variants and Strains of the Laboratory Mouse.
Lyon
MF
Rastan
S
Brown
SDM
2
1996
1597
1633
Oxford University Press
New York, NY
31
Bailey
DW
Recombinant inbred strains and bilineal congenic strains.
The Mouse in Biomedical Research.
Foster
HL
Small
JD
Fox
JG
I
1981
223
239
Academic Press
New York, NY
32
Belknap
JK
Mitchell
SR
O'Toole
LA
Helms
ML
Crabbe
JC
Type I and type II error rates for quantitative trait loci (QTL) mapping studies using recombinant inbred mouse strains.
Behav Genet.
26
1996
149
160
33
Committee on Immunologically Compromised Rodents, Institute of Laboratory Animal Resources, Commission on Life Science, and National Research Council
Immunodeficient Rodents: A Guide to Their Immunobiology, Husbandry, and Use.
1989
National Academy Press
Washington, DC
34
Hoag
WG
Spontaneous cancer in mice.
Ann N Y Acad Sci.
108
1963
805
831
35
Myers
DD
Meier
H
Huebner
RJ
Prevalence of murine C-type RNA virus group specific antigen in inbred strains of mice.
Life Sci.
9
1970
1071
1080
36
Murphy
ED
Characteristic tumors.
Biology of the Laboratory Mouse
2nd ed.
Green
EL
1966
521
562
McGraw-Hill
New York, NY
37
Festing
MFW
Blackmore
DK
Life span of specified-pathogen-free (MRc category 4) mice and rats.
Lab Anim.
5
1971
179
192
38
Staats
J
Standardized nomenclature for inbred strains of mice: sixth listing.
Cancer Res.
36
1976
4333
4377
39
Storer
JB
Longevity and gross pathology at death in 22 inbred strains of Mice.
J Gerontol.
21
1966
404
409
40
Heston
WE
Genetic aspects of experimental animals in cancer research.
Jpn Cancer Assoc Gann Monogr.
5
1968
3
15
41
Crispens
CG
Some characteristics of strain SJL/JDg mice.
Lab Animal Sci.
23
1973
408
413
42
Murphy
ED
SJL/J, a new inbred strain of mouse with a high, early incidence of reticulum-cell neoplasms.
Proc Am Assoc Cancer Res.
4
1963
46
43
Fujinaga
S
Poel
WE
Williams
WC
Dmochowski
L
Biological and morphological studies of SJL/J strain reticulum cell neoplasms induced and transmitted serially in low leukemia-strain mice.
Cancer Res.
30
1970
729
742
44
Leiter
EH
The NOD mouse meets the “Nerup hypothesis”: Is diabetogenesis the result of a collection of common alleles presented in unfavorable combinations? In Shafrir E, ed. Frontiers in Diabetes Research. Lessons from Animal Diabetes III.
1990
54
58
Smith-Gordon
London
45
Gelman
R
Watson
A
Bronson
R
Yunis
E
Murine chromosomal regions correlated with longevity.
Genetics.
118
1988
693
704
46
Hughes
DC
Allen
J
Morley
G
et al. 
Cloning and sequencing of the mouse Gli2 gene: localization to the Dominant hemimelia critical region.
Genomics.
39
1997
205
215
47
Aitman
TJ
Hearne
CM
McAleer
MA
Todd
JA
Mononucleotide repeats are an abundant source of length variants in mouse genomic DNA.
Mamm Genome.
1
1991
206
210
48
Huang
H
Acuff
CG
Steinhelper
ME
Isolation, mapping, and regulated expression of the gene encoding mouse C-type natriuretic peptide.
Am J Physiol.
271
1996
H1565
H1575
49
Ding
Q
Motoyama
J
Gasca
S
et al. 
Diminished Sonic hedgehog signaling and lack of floor plate differentiation in Gli2 mutant mice.
Development.
125
1998
2533
2543
50
Borycki
AG
Mendham
L
Emerson
CP
Jr
Control of somite patterning by Sonic hedgehog and its downstream signal response genes.
Development.
125
1998
777
790
51
Park
HL
Bai
C
Platt
KA
et al. 
Mouse Gli1 mutants are viable but have defects in SHH signaling in combination with a Gli2 mutation.
Development.
127
2000
1593
1605
52
Mo
R
Freer
AM
Zinyk
DL
et al. 
Specific and redundant functions of Gli2 and Gli3 zinc finger genes in skeletal patterning and development.
Development.
124
1997
113
123
53
Danielian
PS
McMahon
AP
Engrailed-1 as a target of the Wnt-1 signalling pathway in vertebrate midbrain development.
Nature.
383
1996
332
334
54
Joyner
AL
Engrailed, Wnt and Pax genes regulate midbrain—hindbrain development.
Trends Genet.
12
1996
15
20
55
Wurst
W
Auerbach
AB
Joyner
AL
Multiple developmental defects in Engrailed-1 mutant mice: an early mid-hindbrain deletion and patterning defects in forelimbs and sternum.
Development.
120
1994
2065
2075
56
Mouse Genome Database (MGD). Mouse genome informatics Web site, The Jackson Laboratory, Bar Harbor, ME. Available at:http://www.informatics.jax.org Accessed April 10, 2001.

Author notes

Jichun Chen, The Jackson Laboratory, Bar Harbor, ME 04609-1500; e-mail: jchen@jax.org.