Fusion between the NUP98 and NSD3genes in a patient with acute myeloid leukemia associated with t(8;11)(p11.2;p15), is reported for the first time. The t(8;11)(p11.2;p15) was identified by classical cytogenetics. Fluorescence in situ hybridization (FISH) analysis revealed a split signal with a mix of BAC 118H17 and 290A12, indicating the translocation disrupted NUP98. FISH restriction at 8p11-12 showed a split of BAC 350N15. Molecular investigations into candidate genes in this BAC showed the NUP98 fusion partner at 8p11.2 was the NSD3 gene. To date the NSD3 gene has never been implicated in hematologic malignancies.

Introduction

In myeloid malignancies several chromosomal translocations and corresponding chimeric genes have been identified between NUP98 at 11p15 and PMX1 at 1q23,HOXD13 at 2q31, NSD1 at 5q35, HOXA9 at 7p15, LEDGF at 9p22, DDX10 at 11q22, andTOP1 at 20q11.1-8 In lymphoid malignancies only a subset of T-cell acute lymphoblastic leukemia with a t(4;11)(q21;p15) and a NUP98-RAP1GDS1 fusion gene has been reported to date.9 

Chromosomal bands 8p11-p12 are involved in well-characterized leukemic syndromes, such as acute myeloid leukemia (AML) with erythrophagocytosis and t(8;16)(p11;p13.3)10and a chronic myeloproliferative disorder (CMPD) with eosinophilia, concomitant lymphoblastic leukemia–lymphoma, and t(8;13)(p11;q12).11 As a result of translocations,MOZ fuses with the CBP gene at 16p13.3 in AML, and FGFR1 rearranges with ZNF198 at 13q12 in the CMPD–lymphoma syndrome. Alternative recombinations withTIF2/8q13 and p300/22q13 for MOZ gene and with FOP/6q27 and CEP110/9q33 forFGFR1 have also been described.12-16 

We report the first patient with AML with recombination between the NUP98 gene and a new partner at 8p11.2, telomeric toFGFR1. NSD3 (nuclear receptor-binding su(var)3-9, enhancer of zeste, trithorax [SET] domain containing gene 3), also named WHSC1L1 (Wolf-Hirschhorn syndrome candidate-1–like-1), belongs to the same family asNSD1, whose mouse homolog is an RARα-interacting protein,17 and NSD2, named WHSC1(Wolf-Hirschhorn syndrome candidate-1) or MMSET(multiple myeloma SET domain).

Study design

Patient history

A 65-year-old man was admitted because of fever and malaise. Clinical examination disclosed slight hepatomegaly. Hematologic data were as follows: hematocrit, 22%; hemoglobin level, 9 g/dL; leukocyte count, 159 × 109/L with 84% blast cells, 5% promyelocytes, 3% myelocytes, 2% neutrophils, 2% basophils, 1% eosinophils, and 3% lymphocytes; platelet count, 81 × 109/L. Bone marrow aspirate was indicative of AML, M1-FAB, with multilineage dysplasia. Blast cells were CD7+, CD13+, CD15+, CD33+, CD34+, HLA-DR+ and CD2, CD3, CD19, CD41, CD61. The patient died of septic shock during drug-induced marrow aplasia.

Cytogenetics and fluorescence in situ hybridization

Karyotyping was performed on unstimulated bone marrow cells after short-term culture. Chromosomes were G-banded and classified according to the International System for Human Cytogenetic Nomenclature.18 Fluorescence in situ hybridization (FISH) studies were performed as described elsewhere.19 We used a mixture of 2 BAC clones (118H17 and 290A12) labeled with biotin for theNUP98 gene.19 

The 8p11-12 breakpoint was investigated using YAC 176C9 (Dr M. Chaffanet, Marseilles, France) spanning the MOZ gene, BAC 350N15 spanning the FGFR1 gene, and BAC 513D5 telomeric to the FGFR1 locus. Probes were biotin-labeled. A centromeric probe labeled with digoxigenin was added in each experiment for chromosome 8 (D8Z1) or for chromosome 11 (D11Z1) (Oncor, Gaithersburg, MD). At least 8 metaphases were analyzed using an Olympus fluorescence microscope equipped with a cooled CCD camera (Sensys, Photometrics, Tucson, AZ) run by Pathvysion (Vysis, Stuttgart, Germany).

Molecular characterization

Database searches and sequence analyses were performed using BLAST algorithms (http://www.ncbi.nlm.nih.gov/BLAST) and RepeatMasker (http://repeatmasker.genome.washington.edu/cgi-bin/RepeatMasker). AllNUP98 primers have been described previously19except NUP737F, AGTCACTAGAGGAACTTCG. NSD3 primers were designed on GenBank accession number AK022560 (FLJ536f, CAGAAATTCCAAACACAAGAC; FLJ940f, CCAGTTCAGCCAATACTATC; FLJ1856Af, AGCCAACGCAGAGTGTATCATC; FLJ2907Br, GGTGGGCCTCGTTAGACTGCTC; FLJ3081Cr, TTCCCCCAAAATTTCCATACAA; FLJ1204Df, GAAGAATTACTGGCTGAGGCAAC; FLJ1747Er, ATTTCCCATCCCCTGTAGCATTC) and GenBank accession number AF332469(W1L2863R1, AATTTGCGGACACAGGCTTC; W1L2685R2, TGCAGCACTCTCCCTCAC).

Total RNA was reverse-transcribed using SuperscriptII (Life Technologies, Gaithersburg, MD). Using the Expand Long Template PCR System (Roche, Mannheim, Germany) and the appropriate primers, cDNA aliquots were amplified in 10-μL polymerase chain reaction (PCR) as follows: 35 amplification cycles at 94°C for 5 minutes 10 seconds (94°C for 50 seconds, 58°C for 20 seconds, and 68°C for 4 minutes) and at 68°C for 5 minutes.

Nested PCR was carried out as follows: 35 amplification cycles at 94°C for 5 minutes (94°C for 30 seconds, 58°C for 20 seconds, 68°C for 2 minutes) and at 68°C for 5 minutes. Sequencing was performed with an automated ABI377 sequencing station after purification using Concert Rapid PCR Purification System (Life Technologies).

Results and discussion

The t(8;11)(p11.2;p15) translocation was found as an isolated anomaly in all 20 bone marrow karyotypes from this patient with de novo AML. The mixture of BAC 118H17 and 290A12 was split, thus generating 3 spots of fluorescence: on normal chromosome 11, on der(11), and on der(8) (Figure 1A, left panel). BAC 350N15 spanned the 8p11-12 breakpoint, showing hybridization signals on normal chromosome 8, on der(8), and on der(11) (Figure 1A, right panel).

Fig. 1.

FISH experiments and molecular characterization of fusion transcripts.

(Ai) FISH with probe D11Z1 (red) for the alpha satellite of centromere 11 and a mixture of BAC 118H17 and BAC 290A12 (green), to encompass theNUP98 gene at 11p15. Red signals are present on normal 11 and der(11), and green signals are present on normal 11, der(11) (arrow), and der(8) (arrowhead). (Aii) FISH with probe D8Z1 (red) for the alpha satellite of centromere 8 and BAC 350N15 (green), to encompass the FGFR1 and NSD3 genes at 8p11.2. Red signals are present on normal 8 and on der(8), and green signals are present on normal 8, der(8) (arrowhead), and der(11) (arrow). (Bi) Nested PCR detects NUP98-NSD3 short fusion transcripts. After primary amplification with primers NUP737F-FLJ3081Cr, diluted aliquots of PCR products were amplified with the following primers: lanes 1-2, NUP737F-FLJ2907Br (2477 base pair [bp]); lanes 3-4, NUP737F-FLJ1747Er (1317 bp); lanes 5-6, NUP1252F-FLJ3081Cr (2136 bp); lanes 7-8, NUP1252F- FLJ2907Br (1962 bp); lanes 9-10, NUP1252F- FLJ1747Er (802 bp). Lane M, molecular weight markers (lambda DNA digested with HindIII). Negative controls without cDNA are marked as (−). (Bii) Nucleotide and deduced amino acid sequences ofNUP98 and NSD3 cDNA at the fusion point. Sequence numbers refer to GenBank accession no. U41815 for NUP98 andAF332469 for NSD3.

Fig. 1.

FISH experiments and molecular characterization of fusion transcripts.

(Ai) FISH with probe D11Z1 (red) for the alpha satellite of centromere 11 and a mixture of BAC 118H17 and BAC 290A12 (green), to encompass theNUP98 gene at 11p15. Red signals are present on normal 11 and der(11), and green signals are present on normal 11, der(11) (arrow), and der(8) (arrowhead). (Aii) FISH with probe D8Z1 (red) for the alpha satellite of centromere 8 and BAC 350N15 (green), to encompass the FGFR1 and NSD3 genes at 8p11.2. Red signals are present on normal 8 and on der(8), and green signals are present on normal 8, der(8) (arrowhead), and der(11) (arrow). (Bi) Nested PCR detects NUP98-NSD3 short fusion transcripts. After primary amplification with primers NUP737F-FLJ3081Cr, diluted aliquots of PCR products were amplified with the following primers: lanes 1-2, NUP737F-FLJ2907Br (2477 base pair [bp]); lanes 3-4, NUP737F-FLJ1747Er (1317 bp); lanes 5-6, NUP1252F-FLJ3081Cr (2136 bp); lanes 7-8, NUP1252F- FLJ2907Br (1962 bp); lanes 9-10, NUP1252F- FLJ1747Er (802 bp). Lane M, molecular weight markers (lambda DNA digested with HindIII). Negative controls without cDNA are marked as (−). (Bii) Nucleotide and deduced amino acid sequences ofNUP98 and NSD3 cDNA at the fusion point. Sequence numbers refer to GenBank accession no. U41815 for NUP98 andAF332469 for NSD3.

BAC 350N15 was found to contain 2 candidate genes, FGFR1 andNSD3, which were screened for an in-frame fusion transcript with NUP98. PCR experiments excluded FGFR1involvement. The NSD3 gene, like NSD2, is known to encode 2 splicing isoforms, a long form and a short form.20,21 Primers were first designed on the short form (FLJ1856Af, FLJ2907Br, FLJ3081Cr, FLJ1204Df, FLJ1747Er). As reports suggest, the 5′ end of NUP98 bears the oncogenic-related portion. PCR experiments investigated whether (5′)NUP98-NSD3(3′) chimeric transcripts were present in patient-derived cDNA.

Results showed NUP98-NSD3 fusion transcripts (Figure 1B, upper panel). The NUP1252F-FLJ1747Er amplification product was sequenced, confirming an in-frame fusion between the 2 genes (Figure1B, lower panel). Breakpoints were located between exons 3 and 4 in theNSD3 gene and between exons 11 and 12 in NUP98(Figure 2A-B). Successful amplification from primer FLJ3081Cr implied the expression of short-form chimericNSD3 (Figure 2C).

Fig. 2.

NSD3 and NUP98 exon structures and chimeric transcripts.

(A, B) NSD3 and NUP98 exon structures showing encoded domains. Coding regions are depicted as dark gray; noncoding regions are light gray. Exon lengths are to scale, as indicated by ruler. Primers used in this study are positioned below the respective gene (only the end parts of the names are indicated). (A)NSD3 exon structure. All transcript sequences start at various points in exon 0. Ending points are indicated for the following GenBank accession numbers: (a) (WHSC1L1s), AF332468; (b) (WHSC1L1l),AF332469; (c) (FLJ12498), AK022560; (d) (NSD3S), AJ295992; (e) (NSD3L),AJ295990; (f) (NSD3L2, lacking exon 14), AJ295991. (B) NUP98exon structure, derived from GenBank accession number U41815. Exons 11 to 15 are also indicated as A-E by Arai et al.7 (C-F) Schematic representation of NSD3-NUP98 fusion transcripts.NUP98-derived exons are depicted as light gray;NSD3-derived exons are dark gray. (C) Short-form transcript, containing NUP98 exons 1 through 11 and NSD3exons 4 through 9a. (D) Long-form transcript, containingNUP98 exons 1 through 11 and NSD3 exons 4 through 23. (E) Alternatively spliced long-form transcript, lackingNSD3 exon 14. (F) Reciprocal transcript, containingNSD3 exons 0 through 3 and NUP98 exons 12 through 20.

Fig. 2.

NSD3 and NUP98 exon structures and chimeric transcripts.

(A, B) NSD3 and NUP98 exon structures showing encoded domains. Coding regions are depicted as dark gray; noncoding regions are light gray. Exon lengths are to scale, as indicated by ruler. Primers used in this study are positioned below the respective gene (only the end parts of the names are indicated). (A)NSD3 exon structure. All transcript sequences start at various points in exon 0. Ending points are indicated for the following GenBank accession numbers: (a) (WHSC1L1s), AF332468; (b) (WHSC1L1l),AF332469; (c) (FLJ12498), AK022560; (d) (NSD3S), AJ295992; (e) (NSD3L),AJ295990; (f) (NSD3L2, lacking exon 14), AJ295991. (B) NUP98exon structure, derived from GenBank accession number U41815. Exons 11 to 15 are also indicated as A-E by Arai et al.7 (C-F) Schematic representation of NSD3-NUP98 fusion transcripts.NUP98-derived exons are depicted as light gray;NSD3-derived exons are dark gray. (C) Short-form transcript, containing NUP98 exons 1 through 11 and NSD3exons 4 through 9a. (D) Long-form transcript, containingNUP98 exons 1 through 11 and NSD3 exons 4 through 23. (E) Alternatively spliced long-form transcript, lackingNSD3 exon 14. (F) Reciprocal transcript, containingNSD3 exons 0 through 3 and NUP98 exons 12 through 20.

To investigate the expression of long-form mRNA (Figure 2D), nested PCR was performed with primers W1L2685R2 and W1L2863R1 in combination withNUP98 forward primers. Only one band, of the appropriate length, was amplified (data not shown), confirming that the long transcript was present. Because no product was extended after exon 12, the presence of exon 14, which is involved in alternative splicing20 (Figure 2A,E), could not be determined. We also analyzed the expression of the reciprocal transcript (5′)NSD3-NUP98(3′) by matching primers NUP1811R and NUP2887R with 2 NSD3 forward primers FLJ536f and FLJ940f. A specific band of the correct length (data not shown) revealed the patient's cells expressed reciprocal fusion mRNA. The reciprocal transcriptNSD3-NUP98 maintained the 5′ part of NSD3, encoding for a split PWWP domain, and the 3′ part of NUP98, with few FG repeats and the RNA-binding domain (Figure 2F).

As far as we know, NSD3 is the eighth NUP98partner in myeloid malignancies, so NUP98, likeMLL and ETV6, is emerging as a promiscuous gene that recombines and fuses with different genomic sites. In the NSD family, NSD1, located at 5q35, has been shown to rearrange with NUP98 in childhood AML.3,NSD2, located at 4p16, is the fusion partner of immunoglobulin heavy- chain gene at 14q32 in a recurrent translocation of multiple myeloma.21,22 Angrand et al20 foundNSD3 as part of an amplicon in breast cancer with 8p karyotypic abnormalities. We also confirmed NSD3amplification in 1 of 30 unselected cases of breast cancer analyzed by semiquantitative PCR (unpublished data, May 2001). This is the first report of NSD3 rearrangements in hematologic malignancies.

These 3 NSD family members have a common region of conserved architecture3,20,21—PHD fingers I-IV, PWWP, SAC/SET, PHD-V, and C5HCH (Figure 2A)—which suggests their involvement in chromatin remodeling and regulation of transcription. The fusion transcripts NUP98-NSD1 in t(5;11)3 andNUP98-NSD3 in t(8;11) both show this region fused to NUP98 FG repeats, which are known to bind transcription factors such as cyclic adenosine 3′,5′-monophosphate response element binding protein (CREB)-binding protein.23 Moreover, transcriptional regulation genes, such as PMX1,1,HOXD13,2,HOXA9,4,5 andLEDGF,6 are other fusion partners forNUP98 in malignancies. Altogether, these data support the hypothesis that the transcription regulation function is critical forNUP98 fusion gene oncogenicity.

In conclusion, NSD3 has been observed for the first time as a translocation partner of NUP98 in acute myeloid leukemia. Further functional analysis of the chimeric transcripts will elucidate their specific role in leukemogenesis.

Supported by Associazione Italiana per la Ricerca sul Cancro (C.M., M.N.), Associazione Italiana contro le Leucemie-linfomi (C.M.), Ministero dell'Università e della Ricerca Scientifica e Tecnologica (C.M., M.N.), and Associazione Sergio Luciani (R.R.).

R.R. and R.L.S. contributed equally to this work.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

References

References
1
Nakamura
T
Yamazaki
Y
Hatano
Y
Miura
I
NUP98 is fused to PMX1 homeobox gene in human acute myelogenous leukemia with chromosome translocation t(1;11)(q23;p15).
Blood.
94
1999
741
747
2
Raza-Egilmez
SZ
Jani-Sait
SN
Grossi
M
Higgins
MJ
Shows
TB
Aplan
PD
NUP98-HOXD13 gene fusion in therapy-related acute myelogenous leukemia.
Cancer Res.
58
1998
4269
4273
3
Jaju
RJ
Fidler
C
Haas
OA
et al. 
A novel gene, NSD1, is fused to NUP98 in the t(5;11)(q35;p15.5) in de novo childhood acute myeloid leukemia.
Blood.
98
2001
1264
1267
4
Borrow
J
Shearman
AM
Stanton
VP
Jr
et al. 
The t(7;11)(p15;p15) translocation in acute myeloid leukaemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9.
Nat Genet.
12
1996
159
167
5
Nakamura
T
Largaespada
DA
Lee
MP
et al. 
Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia.
Nat Genet.
12
1996
154
158
6
Ahuja
HG
Hong
J
Aplan
PD
Tcheurekdjian
L
Forman
SJ
Slovak
ML
t(9;11)(p22;p15) in acute myeloid leukemia results in a fusion between NUP98 and the gene encoding transcriptional coactivators p52 and p75-lens epithelium-derived growth factor (LEDGF).
Cancer Res.
60
2000
6227
6229
7
Arai
Y
Hosoda
F
Kobayashi
H
et al. 
The inv(11)(p15q22) chromosome translocation of the novo and therapy-related myeloid malignancies results in fusion of the nucleoporin gene, NUP98, with the putative RNA helicase RNA gene, DDX10.
Blood.
89
1997
3936
3944
8
Ahuja
HG
Felix
CA
Aplan
PD
The t(11;20)(p15;q11) chromosomal translocation associated with therapy-related myelodysplastic syndrome results in an NUP98-TOP1 fusion.
Blood.
94
1999
3258
3261
9
Hussey
DJ
Nicola
M
Moore
S
Peters
GB
Dobrovic
A
The t(4;11)(q21;p15) translocation fuses the NUP98 and RAP1GDS1 genes and is recurrent in T-cell acute lymphocytic leukemia.
Blood.
94
1999
2072
2079
10
Borrow
J
Stanton
VP
Jr
Andresen
JM
et al. 
The translocation t(8;16)(p11;p13) of acute myeloid leukaemia fuses a putative acetyltransferase to the CREB-binding protein.
Nat Genet.
14
1996
33
41
11
Xiao
S
Nalabolu
SR
Aster
JC
et al. 
FGFR1 is fused with a novel zinc-finger gene, ZNF198, in the t(8;13) leukaemia/lymphoma syndrome.
Nat Genet.
18
1998
84
87
12
Liang
J
Prouty
L
Williams
BJ
Dayton
MA
Blanchard
KL
Acute mixed lineage leukemia with an inv(8)(p11q13) resulting in fusion of the genes for MOZ and TIF2.
Blood.
92
1998
2118
2122
13
Carapeti
M
Aguiar
RC
Goldman
JM
Cross
NC
A novel fusion between MOZ and the nuclear receptor coactivator TIF2 in acute myeloid leukemia.
Blood.
91
1998
3127
3133
14
Chaffanet
M
Gressin
L
Preudhomme
C
Soenen-Cornu
V
Birnbaum
D
Pebusque
MJ
MOZ is fused to p300 in an acute monocytic leukemia with t(8;22).
Genes Chromosomes Cancer.
28
2000
138
144
15
Popovici
C
Zhang
B
Gregoire
MJ
et al. 
The t(6;8)(q27;p11) translocation in a stem cell myeloproliferative disorder fuses a novel gene, FOP, to fibroblast growth factor receptor 1.
Blood.
93
1999
1381
1389
16
Guasch
G
Mack
GJ
Popovici
C
et al. 
FGFR1 is fused to the centrosome-associated protein CEP110 in the 8p12 stem cell myeloproliferative disorder with t(8;9)(p12;q33).
Blood.
95
2000
1788
1796
17
Huang
N
vom Baur
E
Garnier
JM
et al. 
Two distinct nuclear receptor interaction domains in NSD1, a novel SET protein that exhibits characteristics of both corepressors and coactivators.
EMBO J.
17
1998
3398
3412
18
Mitelman
F
ISCN: An International System for Human Cytogenetic Nomenclature.
1995
S. Karger
Basel, Switzerland
19
Mecucci
C
La Starza
R
Negrini
M
et al. 
t(4;11)(q21;p15) translocation involving NUP98 and RAP1GDS1 genes: characterization of a new subset of T acute lymphoblastic leukaemia.
Br J Haematol.
109
2000
788
793
20
Angrand
PO
Apiou
F
Stewart
AF
Dutrillaux
B
Losson
R
Chambon
P
NSD3, a new set-domain containing gene, maps to 8p12 and is amplified in human breast cancer cell lines.
Genomics.
74
2001
79
88
21
Stec
I
Wright
TJ
van Ommen
GJ
et al. 
WHSC1, a 90 kb SET domain-containing gene, expressed in early development and homologous to a Drosophila dysmorphy gene maps in the Wolf-Hirschhorn syndrome critical region and is fused to IgH in t(4;14) multiple myeloma.
Hum Mol Genet.
7
1998
1071
1082
22
Chesi
M
Nardini
E
Lim
RS
Smith
KD
Kuehl
MW
Bergsagel
PL
The t(4;14) translocation in myeloma dysregulates both FGFR3 and a novel gene, MMSET, resulting in IgH/MMSET hybrid transcripts.
Blood.
92
1998
3025
3034
23
Kasper
LH
Brindle
PK
Schnabel
CA
Pritchard
CE
Cleary
ML
van Deursen
JM
CREB binding protein interacts with nucleoporin-specific FG repeats that activate transcription and mediate NUP98-HOXA9 oncogenicity.
Mol Cell Biol.
19
1999
764
776

Author notes

Cristina Mecucci, Hematology and Bone Marrow Transplantation Unit, Policlinico Monteluce, Via Brunamonti, 06123 Perugia, Italy; e-mail: crimecux@unipg.it.