FLT3 receptor tyrosine kinase is expressed on lymphoid and myeloid progenitors in the hematopoietic system. Activating mutations in FLT3 have been identified in approximately 30% of patients with acute myelogenous leukemia, making it one of the most common mutations observed in this disease. Frequently, the mutation is an in-frame internal tandem duplication (ITD) in the juxtamembrane region that results in constitutive activation of FLT3, and confers interleukin-3 (IL-3)–independent growth to Ba/F3 and 32D cells. FLT3-ITD mutants were cloned from primary human leukemia samples and assayed for transformation of primary hematopoietic cells using a murine bone marrow transplantation assay. FLT3-ITDs induced an oligoclonal myeloproliferative disorder in mice, characterized by splenomegaly and leukocytosis. The myeloproliferative phenotype, which was associated with extramedullary hematopoiesis in the spleen and liver, was confirmed by histopathologic and flow cytometric analysis. The disease latency of 40 to 60 days with FLT3-ITDs contrasted with wild-type FLT3 and enhanced green fluorescent protein (EGFP) controls, which did not develop hematologic disease (> 200 days). These results demonstrate that FLT3-ITD mutant proteins are sufficient to induce a myeloproliferative disorder, but are insufficient to recapitulate the AML phenotype observed in humans. Additional mutations that impair hematopoietic differentiation may be required for the development of FLT3-ITD–associated acute myeloid leukemias. This model system should be useful to assess the contribution of additional cooperating mutations and to evaluate specific FLT3 inhibitors in vivo.

Introduction

FLT3 (FMS-like receptor tyrosine kinase) also referred to as fetal liver kinase 2 (FLK-2) or stem cell tyrosine kinase 1 (STK-1) was originally described as a tyrosine kinase receptor with strong sequence similarity to FMS, KIT, and platelet-derived growth factor receptor (PDGFR).1,2 These proteins are all members of the receptor tyrosine kinase type (RTK) III subfamily based on a common domain structure including an interrupted kinase domain (for review, see Rosnet and Birnbaum3). FLT3 is expressed by cells found in the hematopoietic stem cell compartment (Sca1+, Lin)1 and in more restricted progenitors of the lymphoid and myeloid series4,5 (for review, see Shurin et al6). Like the other RTK III family members, the stimulation of FLT3 by its ligand (FLT ligand, FL) has been proposed to play a role in cell proliferation.7,8 

It is therefore interesting that activating mutations in FLT3 have been found in approximately 25% to 30% of patients with acute myelogenous leukemia (AML).9,10 The majority of FLT3 mutations are internal tandem duplications (ITDs) in the juxtamembrane domain encoded by exon 11, and were first reported in patients with AML in 1996.11 This mutation appears to confer a poor prognosis in several studies reported to date.12-14 All ITD repeats were in-frame, but varied significantly in length. No such ITD abnormalities were detected in remission samples, indicating that these were acquired mutations.11 Subsequent studies have confirmed the presence of the juxtamembrane ITDs in human leukemias, with an overall incidence of approximately 20% in AML. In addition, substitution mutations in the FLT3 kinase domain at Asp835 have recently been reported in approximately 7% of patients with AML.10 Both the FLT3-ITD and FLT3-Asp835 mutations result in constitutive activation of the receptor and are associated with FLT3 autophosphorylation and phosphorylation of downstream targets such as STAT5 and mitogen-activated protein (MAP) kinase.15-18 FLT3-ITD mutations are also found but at much lower frequencies in related diseases such as myelodysplastic syndrome (< 5%)9,10,19 and have rarely been identified in acute lymphocytic leukemia (ALL) unless they are biphenotypic.20 

Constitutive activation of RTKs is not unprecedented in leukemias; however, the vast proportion of activated RTKs studied thus far are associated with chronic myelogenous leukemia (CML) phenotypes and occur as a result of a chromosomal translocation. Examples include the BCR/ABL, TEL/PDGFβR, TEL/JAK2, HIP1/PDGFβR, H4/PDGFβR, and TEL/ABL fusion proteins that are expressed as a consequence of the t(9;22)(q34;q22),21-25 t(5;12)(q33;p13),26-30t(9;12)p(24;p13),31-33t(5;7)(q33;q11.2),34,35t(5;10)(q33;q11.2),36,37 and t(9;12)(q34;p13)38 translocations, respectively. Each of these fusion proteins contains a carboxy-terminal tyrosine kinase domain and an amino terminal oligomerization domain that constitutively activates the respective tyrosine kinase (for a review, see Sawyers39). These fusion proteins are all localized to the cytoplasm, and constitutive activation of the respective tyrosine kinase confers factor-independent growth to cultured hematopoietic cell lines.21-38,40,41 Furthermore, each of these fusions is capable of conferring a myeloproliferative phenotype in murine bone marrow transplant (BMT) assays for leukemia,21-38,40,41 indicating that tyrosine kinase fusions are sufficient to induce a myeloproliferative phenotype. Mutational analysis has demonstrated that transformation in cell culture, or in the murine BMT assay, is absolutely dependent on kinase activity.21-38,40,41 

Activating mutations in FLT3 differ from tyrosine kinase fusions associated with the CML phenotypes. FLT3-ITD and activating loop mutants are localized to the plasma membrane as opposed to the cytoplasmic localization of tyrosine kinase fusions. The residual tyrosine kinase allele in the tyrosine kinase fusions associated with chromosomal translocations is typically either expressed at low levels or is localized to a different subcellular compartment than the tyrosine kinase fusion. In contrast, both the wild-type and FLT3-ITD alleles are expressed at comparable levels and are localized to the plasma membrane where they may interact. Perhaps most importantly, activating mutations in FLT3 are most frequently associated with AML rather than CML phenotypes.9Furthermore, FLT3-ITDs are most often observed in AML patients negative for other cytogenetic abnormalities.14 Taken together, these data suggest that FLT3-ITDs may play a critical role in the development of AML.

We have investigated the transforming properties of the FLT3-ITD in primary hematopoietic cells using a murine BMT assay. We report that the FLT3-ITDs cloned from primary human myeloid leukemias confer factor-independent growth to Ba/F3 cells and induce a myeloproliferative phenotype similar to that observed with the translocation-associated tyrosine kinase fusions. These data have important implications for the contribution of the FLT3-ITD to the pathogenesis of human AML. Furthermore, this model should provide a useful system for analysis of cooperativity of FLT3 with other mutations and gene rearrangements associated with human leukemia and for testing of FLT3-specific low molecular weight inhibitors.

Materials and methods

Cloning and vector construction

The complementary DNA (cDNA) for human FLT3 was kindly provided by H. E. Broxmeyer (Indiana University School of Medicine) and amplified by polymerase chain reaction (PCR) using primers containing an additional HpaI site, flt5′HpaI: GTTAACCATGCCGGCGTTGGCGC and FLT3′HpaI: GTTAACTACGAATCTTCGACC and cloned into pGEM-T easy (Stratagene, La Jolla, CA) according to the manufacturer's instructions and sequenced. After informed consent was obtained, DNA taken from leukemic blasts from 12 patients was screened by PCR strategy for length mutations in exon 11 of the FLT3 gene using the primers, F1: GGTGTTTGTCTCCTCTTCATTGTCA and B1: AAAGCACCTGATCCTAGTACCTTCC, to give a 223-base pair (bp) PCR product following amplification of the wild-type exon. The PCR was performed with Taq polymerase (Perkin Elmer, Foster City, CA) in the manufacturer's buffer including 10% glycerol for 35 cycles at an annealing temperature of 50°C using 3 μM of each primer. Higher molecular weight PCR products, indicative of a length mutation, were subcloned into “pGEM-T easy” and sequenced. The ITD mutations were recreated in the FLT3 cDNA by amplifying 2 PCR products that overlap in the duplicated region within exon 11. To generate the W51 mutation, a PCR product from nucleotides 603 to 1801 was generated using primers FLT3/604F: CAGGGGGAAAGCTGTAAAG and W51B2: GATCATATTCATATTCTCTG. The product was digested withXhoI, which cleaves at nucleotide 874. The second PCR product spanned nucleotides 1781 to 2982 at the end of the cDNA using primers W51F2 (phosphorylated): TCAGAGAATATGAATATGAT and SP6: TATTTAGGTGACACTATAG (binds in pGEM). The second product was digested with SacI, which cleaves in the pGEM polylinker 3′ of the FLT3 cDNA. These 2 PCR fragments were ligated resulting in a fragment that contained the appropriate duplication and could be cloned into theXhoI and SacI sites in the FLT3 cDNA to replace the wild-type sequence. The same strategy was used to generate each of the mutants where the primers used to generate the W73, W78, T6, and POS mutant were W73B2: CCATATTCATATTCTCTGAAA and W73F2: GCTCTACGTTGATTTCAGAG; W78B2: CCTTCATATTCTCTGAAATCAACG and W78F2: GTTGGTACAGGTGACCGGCTC; T6B2: CCAAACTCTAAATTTTCTCTTGG and T6F2: TTACGTTGATTTCAGAGAATATG; POSB2: TAAATTTTCTCTTGGAAACTCCCATTTG and POSF2: TGCTCCTCAGATAATGAGTACTTC, respectively.

All FLT3 mutations were confirmed by sequencing and the entire cDNA was subcloned from pGEM to MSCV-EB neo42 or MSCV2.2 GFP (kindly provided by W. Pear, University of Pennsylvania)43into the HpaI site in each case.

Cell culture and virus production

The Ba/F3 cells were maintained in RPMI, 10% fetal calf serum (FCS), and interleukin-3 (IL-3) (0.5 ng/mL, R & D Systems, Minneapolis, MN). The 293T cells were maintained in Dulbecco modified Eagle medium (DMEM) with 10% FCS. Retroviral stocks were generated as described previously.32 Briefly, transient cotransfection of equimolar amounts of MSCV constructs and a packaging construct, pIK6 (Cell Genesys, Redwood City, CA), was performed in 293T cells using Superfect (Qiagen, Valencia, CA) according to the manufacturer's instructions. Supernatants were harvested 48 hours after transfection, filtered (0.45 μM), and aliquoted for storage at −80°C. Viral titers were estimated by transduction of Ba/F3 cells in the presence of Polybrene (10 μg/mL) as described previously.44 Briefly, cells (1 × 106) were infected for 48 hours and analyzed by flow cytometry to determine the percentage of enhanced green fluorescent protein-positive (EGFP+) cells. Viral titers for all constructs used were normalized to the lowest titer and were used at titers of 1 × 105 infectious units/mL. To test for transforming ability, Ba/F3 cells were transduced as above with MSCV-neo constructs, cultured for 48 hours, and selected with G418 (Life Technologies, Carlsbad, CA) for 14 days. Factor-independent growth was determined by washing resistant cells 3 times in phosphate-buffered saline (PBS) followed by plating in medium without IL-3. Live cells, determined by trypan blue dye exclusion, were counted daily for 7 days.

Mouse strains and BMT

BALB/c mice were purchased from Taconic (Germantown, NY). BMT assays were carried out as described previously.32,44Briefly, 4- to 6-week-old male donor mice were primed with intraperitoneal injection of 5′-fluorouracil (150 mg/kg, Sigma, St Louis, MO) and subsequently killed after 6 days by CO2 asphyxiation. Bone marrow was flushed from femurs and tibias, and red blood cells were lysed (Red Blood Cell Lysis, RBCL buffer, Sigma). Cells were cultured overnight with IL-3 (6 ng/mL, R & D Systems), IL-6 (10 ng/mL, R & D systems), and stem cell factor (10 ng/mL, Peprotech, Rocky Hill, NJ) in RPMI with 10% FCS (transplant medium). Cells were transduced by 2 rounds of spin-infection, at 24 hours and 48 hours after harvesting. Centrifugation of 1 mL viral supernatant and 4 × 106cells in 3 mL transplant media containing 5 μg/mL Polybrene and 7.5 mM HEPES buffer was carried out for 90 minutes at 1800g. Cells were washed in PBS, resuspended in Hanks balanced salt solution (Life Technologies) and injected (5 × 105 cells/0.5 mL) into the lateral tail vein of lethally irradiated (2 × 450 cGy) female recipient mice. Mice were housed in microisolator cages with autoclaved chow and acidified water.

Histopathology

Murine tissues were fixed for at least 72 hours in 10% neutral buffered formalin (Sigma), dehydrated in alcohol, cleared in xylene, and infiltrated with paraffin on an automated processor (Leica, Bannockburn, IL). The tissue sections (4 μm thick) from paraffin-embedded tissue blocks were placed on charged slides and deparaffinized in xylene, rehydrated through graded alcohol solutions, and stained with hematoxylin and eosin. To visualize the reticulin fibers, rehydrated sections were sequentially treated with potassium permanganate (0.5%), potassium metabisulfite (2%), ferric ammonium sulfate (2%), ammonical silver solution, formalin (10%), gold chloride (0.2%), potassium metasulfite (2%), sodium thiosulfate (2%), and counterstained with methyl green dye according to the published method.45 

Flow cytometric immunophenotyping and fluorescence-activated cell sorting

Single-cell suspensions of spleen, bone marrow, and blood were prepared as described previously.32,44 Briefly, red blood cells were lysed in RBCL buffer (Sigma) for 5 minutes at room temperature and frozen in 90% fetal bovine serum and 10% dimethyl sulfoxide. Prior to analysis, cells were washed in PBS/0.1% NaN3/0.1% bovine serum albumin (BSA) and preincubated for 20 minutes on ice with supernatant from the 2.4G2 hybridoma cell line (anti-CD16/CD32; American Type Culture Collection, Rockville, MD) to block nonspecific Fc receptor-mediated binding. Cells were stained for 20 minutes on ice with monoclonal antibodies, washed in staining buffer, and stained with secondary antibodies where necessary. Antibodies used were allophycocyanin (APC)–conjugated Gr-1 and CD4; phycoerythrin (PE)–conjugated Mac 1, Thy 1.2, and CD8; biotin-conjugated CD19; and APC-conjugated streptavidin. All antibodies were purchased from Pharmingen, San Diego, CA apart from APC-CD4 and APC streptavidin, which were purchased from Caltag, Burlingame, CA. Flow cytometric analysis was carried out using a 4-color FACSort cytometer (Becton Dickinson, Mountain View, CA) and analyzed using CellQuest software.

Fluorescence-activated cell sorting (FACS) was performed on a Coulter Epics Altra at approximately 15 000 cells/s. A single cell suspension from the spleen was resuspended in 1% BSA in PBS at 107cells/mL and sorted into EGFP+ and EGFPfractions. Gates were set around the clearly negative and positive cell populations and weakly EGFP+ cells not included in the gates were discarded (Figure 5C). The EGFP fraction was 98.3% pure and the EGFP+ fraction was 86.5% pure after sorting. DNA was prepared as described below.

Southern analysis

DNA was prepared using a PUREGENE DNA isolation kit according to the manufacturer's protocol (Gentra Systems, Minneapolis, MN). After enzymatic digestion of 20 μg DNA with either EcoRI orXhoI and electrophoretic separation, the genomic DNA was blotted to Hybond-N+ nylon membranes (Amersham, Arlington Heights, IL) by capillary transfer.46 The green fluorescent protein (GFP) probe was a 750-bp fragment isolated using aNcoI/SalI digest from MSCV-EGFP. The 500-bp granzyme A probe was a kind gift from J. Pollock and T. Ley, Washington University. Probes were labeled with 32P by random priming using Radprime (Life Technologies), and Southern hybridization was performed as described.32 

Western analysis

The Ba/F3 cells were washed 3 times in PBS and lysed in 10 mM Tris pH 7.5, 130 mM NaCl, 1% Triton X-100, 10 mM NaF, 10 mM sodium phosphate, 10 mM sodium pyrophosphate, 10 mM EDTA, 1 mM sodium vanadate, and protease inhibitor cocktail tablets (Roche-Boehringer, Indianapolis, IN). Total cell lysate (150 μg) was separated on a 7.5% gel and Western analysis was performed as described previously44 using a 1:200 dilution of anti-FLT3 SC-479 (Santa Cruz, Santa Cruz, CA) as the primary antibody, followed by horseradish peroxidase–conjugated secondary antibody (Amersham Life Science) and visualization by enhanced chemoluminescence (Amersham Life Science).

Results

Cloning of FLT3-ITD mutations from primary human AML cells

The DNA samples from peripheral blood of 12 patients with AML were screened by PCR (see “Materials and methods”) for length mutations in the juxtamembrane region, encoded by exon 11. Four independent FLT3-ITD mutants were cloned, which had a duplicated sequence of between 7 and 25 amino acids (Figure1). The length and position of the duplication varied between samples and differed from other published FLT3-ITD mutants.9,11,13,15 No abnormalities were observed in samples from 54 healthy individuals, consistent with published data.9 Each FLT3-ITD mutant, including a previously reported FLT3-ITD mutant (Npos is Mut117) positive control, and the wild-type FLT3 gene were subcloned into a MSCV murine ecotropic retrovirus that expressed either the neomycin selectable marker or the EGFP under the control of an internal ribosome entry site (IRES).

Fig. 1.

A schematic diagram of the FLT3 receptor tyrosine kinase.

The extracellular domain is labeled and shaded light gray, arrows point to the transmembrane (hatched box) and juxtamembrane domains, and the 2 protein kinase domains (PTK) are shaded dark gray and labeled. The amino acid sequence of exon 11, which encodes the juxtamembrane sequence, is shown below. WT is the wild-type sequence and W78, W73, W51, Npos, and T6 are the FLT3-ITD mutations where the duplicated residues are shown, together with an arrow indicating the duplication position with respect to wild-type exon 11. The amino terminus is labeled NH2 and the carboxy terminus is labeled COOH.

Fig. 1.

A schematic diagram of the FLT3 receptor tyrosine kinase.

The extracellular domain is labeled and shaded light gray, arrows point to the transmembrane (hatched box) and juxtamembrane domains, and the 2 protein kinase domains (PTK) are shaded dark gray and labeled. The amino acid sequence of exon 11, which encodes the juxtamembrane sequence, is shown below. WT is the wild-type sequence and W78, W73, W51, Npos, and T6 are the FLT3-ITD mutations where the duplicated residues are shown, together with an arrow indicating the duplication position with respect to wild-type exon 11. The amino terminus is labeled NH2 and the carboxy terminus is labeled COOH.

Expression and transforming properties of FLT3 and FLT3 mutants in Ba/F3 cells

To confirm that the FLT3-ITD mutants we cloned had similar properties to those previously reported, Ba/F3 cells were stably transduced with MSCV-neo retrovirus containing either the wild-type FLT3 or FLT-ITD cDNAs. Pools of transduced cells were maintained in IL-3 and selected with G418 for 2 weeks prior to analysis of factor-independent growth. Each of the FLT3-ITD mutants including the previously reported positive control Npos,17 conferred IL-3 factor–independent growth to Ba/F3 cells. Parental cells or cells stably transduced with the wild-type FLT3 died after IL-3 deprivation (Figure 2A). There were no significant differences in growth rates in replicate experiments over the time course of this assay. A point mutation in the activation loop that inhibits kinase activity of wild-type FLT347 abrogated transforming activity of FLT3-ITD when mutated in the context of W51 (data not shown). Western blot analysis confirmed that the cell pools expressed comparable levels of FLT3 and each FLT3-ITD mutant at the expected molecular weights of approximately 130 and 155 kd (Figure 2B), and that parental Ba/F3 cells did not express FLT3 (Figure 2B). The FLT3 wild-type protein was identified by immunoprecipitation analysis as 2 distinct bands of approximately 130 and 155 kd, respectively. It has been previously demonstrated by expression in COS-1 and COS-7 cells that these 2 bands are generated from a predicted 110-kd protein via posttranslational glycosylation.15,47 

Fig. 2.

Growth rate of Ba/F3 cells expressing wild-type and ITD mutant FLT3 receptor.

(A) Cell number is indicated on the y-axis, and time in days on the x-axis. Ba/F3 cells transduced with MSCV-neo retroviruses containing FLT3 wild-type and ITD mutant cDNAs were selected for 14 days with G418 in the presence of IL-3. The cell numbers plotted represent the viable cells in each population over 5 days when cells were cultured in the absence of IL-3. The legend on the right indicates the symbols used for the curves of Ba/F3 cells, cells transduced with wild-type Flt3 (Wt) and each of the FLT3-ITD mutants, W51, W73, W78, T6, and Npos. (B) Western analysis of Ba/F3 cells expressing either wild-type (Wt) or ITD mutant FLT3 using an anti-FLT3 antibody. Two FLT3-specific bands are detected in cells transduced with the FLT3 constructs as indicated by arrows, where the upper band is a more glycosylated form. The position of molecular weight markers of 216 and 91 kd is indicated.

Fig. 2.

Growth rate of Ba/F3 cells expressing wild-type and ITD mutant FLT3 receptor.

(A) Cell number is indicated on the y-axis, and time in days on the x-axis. Ba/F3 cells transduced with MSCV-neo retroviruses containing FLT3 wild-type and ITD mutant cDNAs were selected for 14 days with G418 in the presence of IL-3. The cell numbers plotted represent the viable cells in each population over 5 days when cells were cultured in the absence of IL-3. The legend on the right indicates the symbols used for the curves of Ba/F3 cells, cells transduced with wild-type Flt3 (Wt) and each of the FLT3-ITD mutants, W51, W73, W78, T6, and Npos. (B) Western analysis of Ba/F3 cells expressing either wild-type (Wt) or ITD mutant FLT3 using an anti-FLT3 antibody. Two FLT3-specific bands are detected in cells transduced with the FLT3 constructs as indicated by arrows, where the upper band is a more glycosylated form. The position of molecular weight markers of 216 and 91 kd is indicated.

Two independent FLT3-ITD mutants, but not wild-type FLT3, induce a lethal myeloproliferative disease in a murine BMT assay

Donor mice were treated with 5-fluorouracil to increase the number of cycling stem cells for retroviral transduction, as described in “Materials and methods.” Equivalent titers of FLT3-ITD or FLT3 were then transduced into primary mouse bone marrow cells using the MSCV-EGFP retrovirus. Transduced bone marrow for each construct was also analyzed by flow cytometry to confirm EGFP expression in a comparable fraction of the transplanted cells. Transduced bone marrow cells were transferred by injection into the lateral tail vein of lethally irradiated syngeneic recipient mice. Mice receiving transplants of cells transduced with retrovirus containing the wild-type FLT3 or the MSCV vector expressing EGFP engrafted normally and had a normal survival with a follow-up of more than 200 days (Figure 3). In contrast, animals transduced with cells containing either the FLT3-ITD/51 or FLT3-ITD/78 developed a lethal hematopoietic disease with a median latency of approximately 40 to 50 days (Figure 3 and Table1).

Fig. 3.

Kaplan Meier plot of survival.

Mice receiving transplants of bone marrow transduced with wild-type FLT3 (n = 8), EGFP (n = 4), FLT3-ITD/51 (n = 9), or FLT3-ITD/78 (n = 8). The percentage of surviving mice (y-axis) is plotted with respect to time in days (x-axis).

Fig. 3.

Kaplan Meier plot of survival.

Mice receiving transplants of bone marrow transduced with wild-type FLT3 (n = 8), EGFP (n = 4), FLT3-ITD/51 (n = 9), or FLT3-ITD/78 (n = 8). The percentage of surviving mice (y-axis) is plotted with respect to time in days (x-axis).

Table 1.

Analysis of mice that received transplants of wild-type FLT3 or FLT3-ITD-transduced bone marrow

ConstructNo. of miceWBC count, per μL (median)Spleen weight, mg (median)Phenotype
Wt-FLT3 3.5-5.5 × 103 (5 × 103100-171 (113) Normal 
FLT3-ITD/51 28-145 × 103 (36 × 103300-1000 (800) Myeloproliferation 
FLT3-ITD/78 6.5-129 × 103 (75 × 103250-900 (670) Myeloproliferation 
ConstructNo. of miceWBC count, per μL (median)Spleen weight, mg (median)Phenotype
Wt-FLT3 3.5-5.5 × 103 (5 × 103100-171 (113) Normal 
FLT3-ITD/51 28-145 × 103 (36 × 103300-1000 (800) Myeloproliferation 
FLT3-ITD/78 6.5-129 × 103 (75 × 103250-900 (670) Myeloproliferation 

The construct used is listed in column 1, followed by the number of mice analyzed in column 2. The phenotype is listed as normal or myeloproliferation based on the histologic and immunologic phenotype.

Animals receiving transplants of FLT3-ITD developed marked leukocytosis, with a white blood cell (WBC) count ranging from 28 to 145 × 103/μL (Table 1). Differential counts analyzed by the scatter property of peripheral blood of several animals indicated that the increase in WBCs was due almost entirely to neutrophils, which were increased from between 13.7% to 21.8% in 3 controls to 75.7% to 87% in 3 FLT3-ITD–diseased animals analyzed. Animals with FLT3-ITD–induced disease appeared to have a higher proportion of mature neutrophils with fewer immature myeloid cells observed than in animals with myeloproliferative disease associated with other tyrosine kinase fusions.28 The absolute numbers of other blood cells were unchanged and no abnormality in erythrocyte count or composition was observed. Wright-Giemsa stains of peripheral blood demonstrated leukocytosis with myeloid lineage cells in all stages of maturation, predominantly terminally differentiated neutrophils (Figure 4A).

Fig. 4.

Histopathology of mice receiving transplants of FLT3-ITD–transduced bone marrow.

(A) Peripheral blood smear (Wright-Giemsa stain, original magnification × 400) from a representative FLT3-ITD mouse (mouse 51.1) reveals marked leukocytosis comprised predominantly of maturing myeloid elements. (B) Bone marrow from the femur of the same mouse (hematoxylin and eosin, original magnification × 500) reveals features of a myeloproliferative disorder with marked hypercellularity and myeloid hyperplasia consisting predominantly of mature granulocytic elements. Spleen (C) and liver (D) (hematoxylin and eosin, original magnification, × 500) also reveal an identical myeloid infiltrate in the Flt3-ITD mouse (mouse 51.1). (E) Bone marrow of a Flt3-ITD mouse (mouse 78.5) and (F) bone marrow from a wild-type FLT3 mouse. Both were stained to highlight reticulin fibers (black) (original magnification, × 500). There is a marked increase in reticulin fibrosis in the FLT3-ITD mice compared to wild-type FLT3 mice.

Fig. 4.

Histopathology of mice receiving transplants of FLT3-ITD–transduced bone marrow.

(A) Peripheral blood smear (Wright-Giemsa stain, original magnification × 400) from a representative FLT3-ITD mouse (mouse 51.1) reveals marked leukocytosis comprised predominantly of maturing myeloid elements. (B) Bone marrow from the femur of the same mouse (hematoxylin and eosin, original magnification × 500) reveals features of a myeloproliferative disorder with marked hypercellularity and myeloid hyperplasia consisting predominantly of mature granulocytic elements. Spleen (C) and liver (D) (hematoxylin and eosin, original magnification, × 500) also reveal an identical myeloid infiltrate in the Flt3-ITD mouse (mouse 51.1). (E) Bone marrow of a Flt3-ITD mouse (mouse 78.5) and (F) bone marrow from a wild-type FLT3 mouse. Both were stained to highlight reticulin fibers (black) (original magnification, × 500). There is a marked increase in reticulin fibrosis in the FLT3-ITD mice compared to wild-type FLT3 mice.

Gross pathologic examination demonstrated emaciation, ruffled fur, and marked splenomegaly, with spleen weights ranging from 300 to 1000 mg in FLT3-ITD/51 and 250 to 900 mg in FLT3-ITD/78 compared to 100 to 171 mg in wild-type FLT3 or EGFP controls (Table 1). The slight increase in spleen weight in the controls was typical for animals after irradiation and BM transplantation. Bone marrow stained with hematoxylin-eosin demonstrated hypercellularity with a marked predominance of maturing myeloid lineage cells, consistent with a myeloproliferative disease (Figure 4B). In addition, the bone marrow, as in other mouse models of myeloproliferative disease,48 displayed a significant degree of reticulin fibrosis as demonstrated by silver stain when compared to control FLT3 mice (Figure 4E,F). A reduced yield of cells was obtained from the marrow of FLT3-ITD animals compared to EGFP and wild-type FLT3 controls. Splenic architecture was effaced by a marked expansion of red pulp comprised of maturing myeloid cells (Figure 4C) and scattered admixed megakaryocytes (not shown). Analysis of the liver demonstrated a perivascular parenchymal infiltration comprised predominantly of maturing myeloid elements, with admixed erythroid and megakaryocytic elements similar to that seen in the spleen (Figure 4D). The lungs showed evidence of pulmonary hemorrhage, as observed in BMT assays with other tyrosine kinase fusions such as with TEL/PDGFβR28 and TEL/JAK2.48 FLT3-ITD disease was not transplantable into lethally irradiated secondary recipient mice (n = 16) when 1 × 106 spleen cells from 4 independent mice with myeloproliferative disease were used as donors with a follow-up of more than 80 days. This is consistent with observations made in other tyrosine kinase fusion models of myeloproliferative disease.29,32 

Flow cytometric analysis of blood and spleen cells from FLT3-ITD mice further confirmed the myeloproliferative phenotype. Several FLT3-ITD animals were examined in detail showing 57% to 70% of cells in the spleen (n = 3) and 70% to 90% of cells in the blood (n = 5) were positive for the late myeloid markers Gr-1 (Ly 6-G) and Mac-1, indicative of mature neutrophils, compared to 5% to 9% and 16% to 24% Gr-1, Mac-1 double-positive cells in spleen and blood of controls, respectively. A representative set of samples of one EGFP control, one wild-type FLT3, and one FLT3-ITD are presented in Figure5. Gr-1+ cells were also EGFP+, consistent with proviral integration in these cells. In addition, significant proportions of Gr-1+ cells were EGFP (Figure 5). Potential explanations for this observation include cell nonautonomous contributions to myeloid proliferation,49 lower undetectable levels of EGFP in some clones due to lower expression levels depending on integration site of the provirus, or loss of EGFP by leaching from the short-lived neutrophils, which are highly overrepresented in this disease.50 To address this issue, we sorted cells from the spleen into EGFP and EGFP+ fractions and carried out Southern analysis for the presence of the provirus in both populations. Hybridization with a probe for EGFP shows that cells both positive and negative for EGFP by flow cytometry carry the provirus (Figure 5C). The blot was hybridized with a second probe (granzyme A) as a control for DNA loading and relative copy number. This indicates that the expansion in the Gr-1+, EGFP population observed (Figure 5A, B) is probably due to a cell autonomous effect as a direct result of FLT3-ITD expression.

Fig. 5.

Immunophenotype of cells from the peripheral blood and spleen of FLT3-ITD mice.

Spleen (A) and blood (B) cells from mice that received bone marrow transduced with retroviruses encoding EGFP only, wild-type FLT3 and EGFP, or FLT3-ITD (mouse N78.5) and EGFP. Cells were stained with APC-conjugated anti-Gr-1 alone, APC-anti-Gr-1 and PE-conjugated Mac-1, APC-conjugated CD4 and PE-conjugated CD8 or the combination of biotinylated anti-CD19 and PE-conjugated anti-Thy-1.2 followed by APC-conjugated streptavidin. The dot plots are gated for live cells based on forward and side scatter profiles. (C) Retroviral integration. EGFP and EGFP+ fractions of spleen cells were sorted and the purity of each population is shown using EGFP fluorescence and forward scatter. Southern analysis of these samples, where an EGFP probe demonstrates viral integration or a granzyme A probe demonstrates DNA loading, is shown on the right.

Fig. 5.

Immunophenotype of cells from the peripheral blood and spleen of FLT3-ITD mice.

Spleen (A) and blood (B) cells from mice that received bone marrow transduced with retroviruses encoding EGFP only, wild-type FLT3 and EGFP, or FLT3-ITD (mouse N78.5) and EGFP. Cells were stained with APC-conjugated anti-Gr-1 alone, APC-anti-Gr-1 and PE-conjugated Mac-1, APC-conjugated CD4 and PE-conjugated CD8 or the combination of biotinylated anti-CD19 and PE-conjugated anti-Thy-1.2 followed by APC-conjugated streptavidin. The dot plots are gated for live cells based on forward and side scatter profiles. (C) Retroviral integration. EGFP and EGFP+ fractions of spleen cells were sorted and the purity of each population is shown using EGFP fluorescence and forward scatter. Southern analysis of these samples, where an EGFP probe demonstrates viral integration or a granzyme A probe demonstrates DNA loading, is shown on the right.

No abnormalities were observed in T-cell (Figure 5A) or B-cell (Figure5A, B) populations. Comparable results were obtained from immunophenotypic analysis of cells from the bone marrow (n = 4), with an increase in Gr-1+ cells from 54% on average in controls to 87% average in FLT3-ITD mice.

Southern blot analysis of spleen, bone marrow, and blood demonstrated proviral integration in all affected tissues. Data from the spleen are shown in Figure 6, where the DNA was digested to excise the proviral DNA as a single band (3 kb for MSCV-EGFP or 6 kb for the FLT3 series in MSCV-EGFP) or cleaved once within the construct and randomly in the flanking DNA, according to the insertion position, which demonstrated the clonality. DNA integrity and equal loading was demonstrated by reprobing the blot for an endogenous gene, granzyme A (Figure 6, lower panel). Southern blot analysis of control mice sacrificed at the same time confirmed transduction of bone marrow cells with FLT3-ITD and MSCV-EGFP, although these animals did not develop disease. Restriction digests designed to determine clonality indicated that the myeloproliferative disease induced by the FLT3-ITD was oligoclonal (Figure 6, upper panel).

Fig. 6.

Southern analysis of proviral integration in the spleen cells of animals that received transplants of wild-type FLT3 and FLT3-ITD.

For each animal analyzed 2 digests were performed; AnXhoI digest (X) cleaves in the retroviral long terminal repeats (LTRs) releasing a fragment corresponding to the intact retrovirus and an EcoRI (E) digest cleaves within the proviral sequence and in the flanking genomic sequence allowing the clonality of the disease to be estimated. The mouse identity number for each construct is shown above the enzyme digest. The upper panel shows hybridization with a probe for EGFP. In the lower panel hybridization of the same blot with a probe for granzyme A exon I and II. The size of molecular weight marker bands is indicated on the left of each panel.

Fig. 6.

Southern analysis of proviral integration in the spleen cells of animals that received transplants of wild-type FLT3 and FLT3-ITD.

For each animal analyzed 2 digests were performed; AnXhoI digest (X) cleaves in the retroviral long terminal repeats (LTRs) releasing a fragment corresponding to the intact retrovirus and an EcoRI (E) digest cleaves within the proviral sequence and in the flanking genomic sequence allowing the clonality of the disease to be estimated. The mouse identity number for each construct is shown above the enzyme digest. The upper panel shows hybridization with a probe for EGFP. In the lower panel hybridization of the same blot with a probe for granzyme A exon I and II. The size of molecular weight marker bands is indicated on the left of each panel.

Discussion

This is the first demonstration that expression of FLT3-ITD, but not wild-type FLT3, has transforming properties in primary bone marrow cells. FLT3-ITD expression causes a myeloproliferative phenotype characterized by leukocytosis and comprised mainly of mature neutrophils. Splenomegaly with extramedullary hematopoiesis in the spleen and the liver are also consistently observed. Myeloproliferative disease induced by FLT3-ITD has a latency of 40 to 60 days and is oligoclonal.

These findings demonstrate that FLT3-ITD is sufficient to induce a myeloproliferative disease. However, although the FLT3-ITD is primarily associated with AML in humans, it is not sufficient to induce an AML phenotype in the murine BMT assay. These data suggest that FLT3-ITDs may require additional cooperating mutations to generate the AML phenotype. Evidence supporting this hypothesis includes clinical observations that FLT3-ITD may coexist with virtually any known chromosomal translocation associated with AML, including the t(8;21), inv(16), and t(15;17) associated with the AML1/ETO, CBFβ/MHY11, and PML/RARα fusion proteins, respectively14 (S. Schnittger, abstract 3569, American Society of Hematology, 2000). Furthermore, several laboratories have convincingly demonstrated that each of these latter fusions alone is not sufficient to cause AML, but require secondary mutations.51-55 Taken together, these data support a 2-hit model of AML in which one mutation, such as FLT3-ITD, serves primarily to provide proliferative and survival signals to cells, with minimal effects on differentiation. A second mutation, such as theAML1/ETO gene rearrangement, which may confer subtle proliferative or survival advantage, serves primarily to impair hematopoietic differentiation. The combination of these mutations may generate the AML phenotype due to the unregulated proliferation of hematopoietic cells with impaired differentiation.

Initial analysis suggests that FLT3 and FLT3-ITD use the same signal transduction pathways. On stimulation with FL, FLT3 activates signal transduction pathways through engagement of SH2-containing proteins, including PLCγ, RAS-GTPase activating protein, the p85 subunit of PI3K, SHC, GRB2, STAT5, VAV, FYN, and SRC, among others.17,18,56,57 The consequence of the ITD, regardless of length, appears to be a constitutive increase in FLT3 tyrosine autophosphorylation. Expression of various FLT3-ITD mutants in the murine 32D and Ba/F3 hematopoietic cell lines demonstrates this autophosphorylation, activation of known downstream effectors of FLT3 activation, including PI3K, STAT5, and transformation to growth factor independence.16-18,58 Wild-type FLT3 is expressed at high levels in blast cells of more than 75% of AML patients,59and is also expressed in a significant proportion of patients with ALL and in leukemia-lymphoma cell lines.11,16,60 The physiologic consequences of FLT3 activation by the ITD differ from activation of wild-type FLT3 by its ligand. The wild-type receptor, when overexpressed in Ba/F3 and 32D cells, may be weakly tyrosine phosphorylated and may activate downstream effectors, but it does not confer factor independent growth. Furthermore, stimulation of FLT3-overexpressing cells with FL is also not sufficient to confer IL-3–independent growth.17,61 In contrast each of the FLT3 mutants that we and others have tested confer factor-independent growth to Ba/F3 cells. It has also been suggested that FLT3-ITD but not wild-type FLT3 activates STAT5 and could be responsible for its constitutive activation in AML samples analyzed.17,62Furthermore, in the murine BMT assay, FLT3-ITD but not wild-type FLT3, induces a myeloproliferative phenotype. These data indicate that there are qualitative or quantitative differences in signal transduction mediated by FLT-ITD compared to wild-type FLT3.

The mechanism by which the ITD activates the FLT3 tyrosine kinase is not understood. However, insertion of the duplicated residues may disrupt a kinase inhibitory domain, resulting in kinase activation. Several lines of evidence support this hypothesis. First, FLT3-ITD in-frame mutations in patients with AML may range in size from several to more than 40 amino acids and vary in position within the juxtamembrane domain. In addition, it has recently been demonstrated that deletion of several amino acid residues in the juxtamembrane domain of FLT3 also results in constitutive activation of FLT3.58 The observation that a spectrum of insertions or deletions in the JM domain serve to activate the kinase is most consistent with loss of function of a kinase inhibitory domain through disruption of the tertiary structure. Second, in-frame deletions in the juxtamembrane domain of c-KIT, a related type III receptor tyrosine kinase, results in constitutive activation of c-KIT in gastrointestinal stromal cell tumors and mastocytoses.63,64 Third, regulation of the FLT1 receptor tyrosine kinase through an autoinhibitory function of the JM domain has recently been reported.65 Collectively, these data support the hypothesis that disruption of an autoinhibitory motif in the JM domain, either by deletion or insertion, results constitutive activation of the FLT3 kinase. Structural analysis of FLT3 and related mutants will be required to confirm this hypothesis. An additional question regarding the mechanism of FLT3-ITD transformation relates to the involvement of the wild-type FLT3 in modulating the signal transduction by the mutant. It is plausible that wild-type FLT3 could potentiate or impair signal transduction by FLT3-ITD.

The data from the FLT3-ITD murine BMT assay are consistent with previously reported data on the role of FL and FLT3 receptor in hematopoiesis. FL synergizes with other growth factors in colony assays to stimulate proliferation of hematopoietic progenitors and myeloid precursors but not erythroid precursors.66,67 Furthermore, mice that do not express the FLT3 receptor have reduced B lymphopoiesis.68 On transplantation, reduced T lymphopoiesis and myelopoiesis are also observed.68 Mice that lack FL have reduced numbers of myeloid and B-lymphoid progenitors and a deficiency in natural killer and dendritic cells.69In addition, mice treated with exogenous FL accumulate progenitor cells in the peripheral blood.70 Overexpression of FL in a BMT assay induces a proliferative phenotype71 and can predispose animals to leukemia after a 5-month latency period where the malignant cells were all shown to express FLT3.72 Taken together these data suggest that the FLT3-FL signaling pathway has a unique role in expansion of stem and progenitor cells and sustained activation of FLT3 can lead to hyperproliferation of cells expressing the FLT3 receptor.

Our findings confirm the role of FLT3 in cellular proliferation and support the hypothesis that FLT3-ITD mutations contribute to the pathogenesis of human leukemias. Each independent FLT3-ITD mutant tested was sufficient to induce a myeloproliferative disease in the murine BMT assay, a phenotype similar to that generated by the activated tyrosine kinases that result from chromosomal translocations.21-38,40,41 These data suggest that it may be worthwhile to investigate other myeloproliferative syndromes, such as myeloid metaplasia with myelofibrosis, polycythemia vera, and essential thrombocythemia, for the presence of activating mutations in FLT3.

Finally, the recently reported successes in the therapy of chronic myelogenous leukemias associated with the BCR/ABL gene rearrangement with the ABL-specific kinase inhibitor STI57173,74 suggest that small molecule inhibitors of FLT3 may have therapeutic efficacy in AML.75 This murine model should also allow pharmacologic and therapeutic properties of small molecule inhibitors to be tested in vivo.

We thank L. Seaton for administrative assistance. We thank J. Daley and S. Lazo for expert cell sorting, and D. Cain and S. Amaral for technical support. We also thank E. Anastasiadou, A. Dash, D. Sternberg, and other members of the Gilliland and Tenen laboratories for valuable discussions.

Supported in part by National Institutes of Health grants CA66996 and DK50654. L.M.K. is an associate and D.G.G. is an associate investigator of the Howard Hughes Medical Institute.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

References

References
1
Matthews
W
Jordan
C
Gavin
M
Jenkins
N
Copeland
N
Lemischka
I
A receptor tyrosine kinase cDNA isolated from a population of enriched primitive hematopoietic cells and exhibiting close genetic linkage to c-kit.
Proc Natl Acad Sci U S A.
88
1991
9026
9039
2
Rosnet O, Marchetto S, deLapeyriere O, Birnbaum D. Murine Flt3, a gene encoding a novel tyrosine kinase receptor of the PDGFR/CSF1R family. Oncogene. 1991:641-650.
3
Rosnet
O
Birnbaum
D
Hematopoietic receptors of class III receptor-type tyrosine kinases.
Crit Rev Oncog.
4
1993
595
613
4
Zeigler
FC
Bennett
BD
Jordan
CT
et al
Cellular and molecular characterization of the role of the flk-2/flt-3 receptor tyrosine kinase in hematopoietic stem cells.
Blood.
84
1994
2422
2430
5
Rappold
I
Ziegler
BL
Kohler
I
et al
Functional and phenotypic characterization of cord blood and bone marrow subsets expressing FLT3 (CD135) receptor tyrosine kinase.
Blood.
90
1997
111
125
6
Shurin
M
Esche
C
Lotze
M
FLT3: receptor and ligand. Biology and potential clinical application.
Cytokine Growth Factor Rev.
9
1998
37
48
7
Muench
MO
Roncarolo
MG
Menon
S
et al
FLK-2/FLT-3 ligand regulates the growth of early myeloid progenitors isolated from human fetal liver.
Blood.
85
1995
963
972
8
Molineux
G
McCrea
C
Yan
XQ
Kerzic
P
McNiece
I
Flt-3 ligand synergizes with granulocyte colony-stimulating factor to increase neutrophil numbers and to mobilize peripheral blood stem cells with long-term repopulating potential.
Blood.
89
1997
3998
4004
9
Yokota
S
Kiyoi
H
Nakao
M
et al
Internal tandem duplication of the FLT3 gene is preferentially seen in acute myeloid leukemia and myelodysplastic syndrome among various hematological malignancies. A study on a large series of patients and cell lines.
Leukemia.
11
1997
1605
1609
10
Yamamoto
Y
Kiyoi
H
Nakano
Y
et al
Activating mutation of D835 within the activation loop of FLT3 in human hematologic malignancies.
Blood.
97
2001
2434
2439
11
Nakao
M
Yokota
S
Iwai
T
et al
Internal tandem duplication of the flt3 gene found in acute myeloid leukemia.
Leukemia.
10
1996
1911
1918
12
Kiyoi
H
Naoe
T
Nakano
Y
et al
Prognostic implication of FLT3 and N-RAS gene mutations in acute myeloid leukemia.
Blood.
93
1999
3074
3080
13
Abu-Duhier
FM
Goodeve
AC
Wilson
GA
et al
FLT3 internal tandem duplication mutations in adult acute myeloid leukaemia define a high-risk group.
Br J Haematol.
111
2000
190
195
14
Meshinchi
S
Woods
WG
Stirewalt
DL
et al
Prevalence and prognostic significance of Flt3 internal tandem duplication in pediatric acute myeloid leukemia.
Blood.
97
2001
89
94
15
Kiyoi
H
Towatari
M
Yokota
S
et al
Internal tandem duplication of the FLT3 gene is a novel modality of elongation mutation which causes constitutive activation of the product.
Leukemia.
12
1998
1333
1337
16
Fenski
R
Flesch
K
Serve
S
Mizuki
M
et al
Constitutive activation of FLT3 in acute myeloid leukaemia and its consequences for growth of 32D cells.
Br J Haematol.
108
2000
322
330
17
Hayakawa
F
Towatari
M
Kiyoi
H
et al
Tandem-duplicated Flt3 constitutively activates STAT5 and MAP kinase and introduces autonomous cell growth in IL-3-dependent cell lines.
Oncogene.
19
2000
624
631
18
Tse
K-F
Mukherjee
G
Small
D
Constitutive activation of FLT3 stimulates multiple intracellular signal transducers and results in transformation.
Leukemia.
14
2000
1766
1776
19
Horiike
S
Yokota
S
Nakao
M
et al
Tandem duplications of the FLT3 receptor gene are associated with leukemic transformation of myelodysplasia.
Leukemia.
11
1997
1442
1446
20
Xu
F
Taki
T
Yang
H
et al
Tandem duplication of the FLT3 gene is found in acute lymphoblastic leukaemia as well as acute myeloid leukaemia but not in myelodysplastic syndrome or juvenile chronic myelogenous leukaemia in children.
Br J Haematol.
105
1999
155
162
21
Daley
GQ
McLaughlin
J
Witte
ON
Baltimore
D
The CML-specific P210 bcr/abl protein, unlike v-abl, does not transform NIH/3T3 fibroblasts.
Science.
237
1987
532
535
22
Matulonis
U
Salgia
R
Okuda
K
Druker
B
Griffin
JD
Interleukin-3 and p210 BCR/ABL activate both unique and overlapping pathways of signal transduction in a factor-dependent myeloid cell line.
Exp Hematol.
21
1993
1460
1466
23
Pendergast
AM
Gishizky
ML
Havlik
MH
Witte
O
SH1 domain autophosphorylation of P210 BCR/ABL is required for transformation but not growth factor independence.
Mol Cell Biol.
13
1993
1728
1736
24
Pendergast
AM
Quilliam
LA
Cripe
LD
et al
BCR-ABL-induced oncogenesis is mediated by direct interaction with the SH2 domain of the GRB-2 adapter protein.
Cell.
75
1993
175
185
25
Ilaria
RLJ
Van Etten
RA
P210 and P190(BCR/ABL) induce the tyrosine phosphorylation and DNA binding activity of multiple specific STAT family members.
J Biol Chem.
271
1996
31704
31710
26
Carroll
M
Tomasson
MH
Barker
GF
Golub
TR
Gilliland
DG
The TEL/platelet-derived growth factor β receptor (PDGFβR) fusion in chronic myelomonocytic leukemia is a transforming protein that self-associates and activates PDGFβR kinase-dependent signaling pathways.
Proc Natl Acad Sci U S A.
93
1996
14845
14850
27
Carroll
M
Ohno-Jones
S
Tamura
S
et al
CGP 57148, a tyrosine kinase inhibitor, inhibits the growth of cells expressing BCR-ABL, TEL-ABL, and TEL-PDGFR fusion proteins.
Blood.
90
1997
4947
4952
28
Tomasson
MH
Williams
IR
Hasserjian
R
et al
TEL/PDGFβR induces hematologic malignancy in mice that responds to the tyrosine kinase inhibitor CGP57148.
Blood.
93
1999
1707
1714
29
Tomasson
MH
Sternberg
DW
Williams
IR
et al
Fatal myeloproliferation, induced in mice by TEL/PDGFβR expression, depends on PDGFβR tyrosines 579/581.
J Clin Invest.
105
2000
423
432
30
Wilbanks
AM
Mahajan
S
Frank
DA
Druker
BJ
Gilliland
DG
Carroll
M
TEL/PDGFbetaR fusion protein activates STAT1 and STAT5: a common mechanism for transformation by tyrosine kinase fusion proteins.
Exp Hematol.
28
2000
5
31
Lacronique
V
Boureux
A
Valle
VD
et al
A TEL-JAK2 fusion protein with constitutive kinase activity in human leukemia.
Science.
278
1997
1309
1312
32
Schwaller
J
Frantsve
J
Tomasson
M
et al
Transformation of hematopoietic cell lines to growth-factor independence and induction of a fatal myeloid and lymphoproliferative disease in mice by retrovirally transduced TEL/JAK2 fusion gene.
EMBO J.
17
1998
5321
5333
33
Schwaller
J
Parganas
E
Wang
D
et al
Stat5a/b is essential for the myelo- and lymphoproliferative disease induced by TEL/JAK2.
Mol Cell.
6
2000
693
704
34
Ross
TS
Bernard
OA
Berger
R
Gilliland
DG
Fusion of Huntingtin interacting protein 1 to PDGFβR in chronic myelomonocytic leukemia with t(5;7)(q33;q11.2).
Blood.
91
1998
4419
4426
35
Ross
TS
Gilliland
DG
Transforming properties of the Huntingtin interacting protein 1/platelet-derived growth factor beta receptor fusion protein.
J Biol Chem.
274
1999
22328
22336
36
Kulkami
S
Heath
C
Partker
SEA
Fusion of H4/D10S170 to the platelet-derived growth factor receptor beta in BCR/ABL negative myeloproliferative disorders with a t(5;10)(q33;q21).
Cancer Res.
60
2000
3592
3598
37
Schwaller J, Anastasiadou A, Cain D, et al. H4(D10S170), a gene frequently rearranged in papillary thyroid carcinoma, is fused to the platelet-derived growth factor receptor β gene in atypical chronic myeloid leukemia with t(5;10)(q33;q22). Blood. 2001. In press.
38
Golub
TR
Goga
A
Barker
G
et al
Oligomerization of the ABL tyrosine kinase by the ETS protein TEL in human leukemia.
Mol Cell Biol.
16
1996
4107
4116
39
Sawyers
CL
Molecular abnormalities in myeloid leukemias and myelodysplastic syndromes.
Leuk Res.
22
1998
1113
1122
40
Papadopoulos
P
Ridge
SA
Boucher
CA
Stocking
C
Wiedemann
LM
The novel activation of ABL by fusion to an ets-related gene, TEL.
Cancer Res.
55
1995
34
38
41
Peeters
P
Raynaud
SD
Cools
J
et al
Fusion of TEL, the ETS-variant gene 6 (ETV6), to the receptor-associated kinase JAK2 as a result of t(9;12) in a lymphoid and t(9;15;12) in a myeloid leukemia.
Blood.
90
1997
2535
2540
42
Hawley
RG
Lieu
FH
Fong
AZ
Hawley
TS
Versatile retroviral vectors for potential use in gene therapy.
Gene Ther.
1
1994
136
138
43
Persons
DA
Allay
JA
Allay
ER
et al
Retroviral-mediated transfer of the green fluorescent protein gene into murine hematopoietic cells facilitates scoring and selection of transduced progenitors in vitro and identification of genetically modified cells in vivo.
Blood.
90
1997
1777
1786
44
Liu
Q
Schwaller
J
Kutok
J
et al
Signal transduction and transforming properties of the TEL-TRKC fusions associated with t(12;15)(p13;q25) in congenital fibrosarcoma and acute myelogenous leukemia.
EMBO J.
19
2000
1827
1838
45
Gomori
G
Silver impregnation of reticulum in paraffin sections.
Am J Pathol.
13
1937
993
1002
46
Sambrook
J
Maniatis
T
Molecular Cloning: A Laboratory Manual.
2nd ed.
1989
CSHL Press
New York
47
Maroc
N
Rottapel
R
Rosnet
O
et al
Biochemical characterization and analysis of the transforming potential of the FLT3/FLK2 receptor tyrosine kinase.
Oncogene.
8
1993
909
918
48
Schwaller
J
Parganas
E
Wang
D
et al
Stat5 is essential for the myelo- and lymphoproliferative disease induced by TEL/JAK2.
Mol Cell.
6
2000
693
704
49
Zhang
X
Ren
R
Bcr-Abl efficiently induces a myeloproliferative disease and production of excess interleukin-3 and granulocyte-macrophage colony-stimulating factor in mice: a novel model for chronic myelogenous leukemia.
Blood.
92
1998
3829
3840
50
Tomasson
MH
Williams
IR
Li
S
et al
Induction of myeloproliferative disease in mice by tyrosine kinase fusion oncogenes does not require granulocyte-macrophage colony-stimulating factor or interleukin-3.
Blood.
97
2001
1435
1441
51
Grisolano
JL
Wesselschmidt
RL
Pelicci
PG
Ley
TJ
Altered myeloid development and acute leukemia in transgenic mice expressing PML-RAR alpha under control of cathepsin G regulatory sequences.
Blood.
89
1997
376
387
52
He
LZ
Tribioli
C
Rivi
R
et al
Acute leukemia with promyelocytic features in PML/RARalpha transgenic mice.
Proc Natl Acad Sci U S A.
94
1997
5302
5307
53
Okuda
T
Cai
Z
Yang
S
et al
Expression of a knocked-in AML1-ETO leukemia gene inhibits the establishment of normal definitive hematopoiesis and directly generates dysplastic hematopoietic progenitors.
Blood.
91
1998
3134
3143
54
Castilla
LH
Garrett
L
Adya
N
et al
The fusion gene Cbfb-MYH11 blocks myeloid differentiation and predisposes mice to acute myelomonocytic leukaemia.
Nat Genet.
23
1999
144
146
55
Rhoades
KL
Hetherington
CJ
Harakawa
N
et al
Analysis of the role of AML1-ETO in leukemogenesis, using an inducible transgenic mouse model.
Blood.
96
2000
2108
2115
56
Dosil
M
Wang
S
Lemischka
IR
Mitogenic signaling and substrate specificity of the Flk2/Flt3 receptor tyrosine kinase in fibroblasts and interleukin 3-dependent hematopoietic cells.
Mol Cell Biol.
13
1993
6572
6585
57
Rottapel
R
Turck
C
Casteran
N
et al
Substrate specificities and identification of a putative binding site for PI3K in the carboxy tail of the murine Flt3 receptor tyrosine kinase.
Oncogene.
9
1994
1755
1765
58
Mizuki
M
Fenski
R
Halfter
H
et al
Flt3 mutations from patients with acute myeloid leukemia induce transformation of 32D cells mediated by the Ras and STAT5 pathways.
Blood.
96
2000
3907
3914
59
Birg
F
Courcoul
M
Rosnet
O
et al
Expression of the FMS/KIT-like gene FLT3 in human acute leukemias of the myeloid and lymphoid lineages.
Blood.
80
1992
2584
2593
60
Meierhoff
G
Dehmel
U
Gruss
HJ
et al
Expression of FLT3 receptor and FLT3-ligand in human leukemia-lymphoma cell lines.
Leukemia.
9
1995
1368
1372
61
Zhang
S
Mantel
C
Broxmeyer
H
Flt3 signaling involves tyrosyl-phosphorylation of SHP-2 and SHIP and their association with Grb2 and Shc in Baf3/Flt3 cells.
J Leukoc Biol.
65
1999
372
380
62
Zhang
S
Fukuda
S
Lee
Y
et al
Essential role of signal transducer and activator of transcription (Stat)5a but not Stat5b for Flt3-dependent signaling.
J Exp Med.
192
2000
719
728
63
Boissan
M
Feger
F
Guillosson
JJ
Arock
M
c-Kit and c-kit mutations in mastocytosis and other hematological diseases.
J Leukoc Biol.
67
2000
135
148
64
Hirota
S
Isozaki
K
Moriyama
Y
et al
Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors.
Science.
279
1998
577
580
65
Gille
H
Kowalski
J
Yu
L
et al
A repressor sequence in the juxtamembrane domain of Flt-1 (VEGFR-1) constitutively inhibits vascular endothelial growth factor-dependent phosphatidylinositol 3′-kinase activation and endothelial cell migration.
EMBO J.
19
2000
4064
4073
66
Jacobsen
SE
Okkenhaug
C
Myklebust
J
Veiby
OP
Lyman
SD
The FLT3 ligand potently and directly stimulates the growth and expansion of primitive murine bone marrow progenitor cells in vitro: synergistic interactions with interleukin (IL) 11, IL-12, and other hematopoietic growth factors.
J Exp Med.
181
1995
1357
1363
67
Piacibello
W
Fubini
L
Sanavio
F
et al
Effects of human FLT3 ligand on myeloid leukemia cell growth: heterogeneity in response and synergy with other hematopoietic growth factors.
Blood.
86
1995
4105
4114
68
Mackarehtschian
K
Hardin
JD
Moore
KA
Boast
S
Goff
SP
Lemischka
IR
Targeted disruption of the flk2/flt3 gene leads to deficiencies in primitive hematopoietic progenitors.
Immunity.
3
1995
147
161
69
McKenna
H
Stocking
K
Miller
R
et al
Mice lacking flt3 ligand have deficient hematopoiesis affecting hematopoietic progenitor cells, dendritic cells, and natural killer cells.
Blood.
95
2000
3489
3497
70
Brasel
K
McKenna
H
Morrissey
P
et al
Hematologic effects of flt3 ligand in vivo in mice.
Blood.
88
1996
2004
2012
71
Juan
T
McNiece
I
Van
G
et al
Chronic expression of murine flt3 ligand in mice results in increased circulating white blood cell levels and abnormal cellular infiltrates associated with splenic fibrosis.
Blood.
90
1997
76
84
72
Hawley
TS
Fong
AZ
Griesser
H
Lyman
SD
Hawley
RG
Leukemic predisposition of mice transplanted with gene-modified hematopoietic precursors expressing flt3 ligand.
Blood.
92
1998
2003
2011
73
Gambacorti-Passerini
C
Barni
R
Marchesi
E
et al
Sensitivity to the abl inhibitor STI571 in fresh leukaemic cells obtained from chronic myelogenous leukaemia patients in different stages of disease.
Br J Haematol.
112
2001
972
974
74
Druker
BJ
Talpaz
M
Resta
DJ
et al
Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia.
N Engl J Med.
344
2001
1031
1037
75
Zhao
M
Kiyoi
H
Yamamoto
Y
et al
In vivo treatment of mutant FLT3-transformed murine leukemia with a tyrosine kinase inhibitor.
Leukemia.
14
2000
374
378

Author notes

D. Gary Gilliland, Harvard Institutes of Medicine, 4 Blackfan Cir, Rm 418, Boston, MA 02115; e-mail:gilliland@calvin.bwh.harvard.edu.