The appearance and expansion of donor white blood cells in a recipient after transfusion has many potential biologic ramifications. Although patients with HIV infection are ostensibly at high risk for microchimerism, transfusion-associated graft-versus-host disease (TA-GVHD) is rare. The purpose of this study was to search for sustained microchimerism in such patients. Blood samples were collected from 93 HIV-infected women (a subset from the Viral Activation Transfusion Study, an NHLBI multicenter randomized trial comparing leukoreduced versus unmodified red blood cell [RBC] transfusions) before and after transfusions from male donors. Donor lymphocytes were detected in posttransfusion specimens using a quantitative Y-chromosome–specific polymerase chain reaction (PCR) assay, and donor-specific human leukocyte antigen (HLA) alleles were identified with allele-specific PCR primers and probes. Five of 47 subjects randomized to receive nonleukoreduced RBCs had detectable male lymphocytes 1 to 2 weeks after transfusion, but no subject had detectable male cells more than 4 weeks after a transfusion. In 4 subjects studied, donor-specific HLA haplotypes were detected in posttransfusion specimens, consistent with one or more donors' cells. None of 46 subjects randomized to receive leukoreduced RBCs had detectable male lymphocytes in the month after transfusion. Development of sustained microchimerism after transfusion in HIV-infected patients is rare; HIV-infected patients do not appear to be at risk for TA-GVHD.

The appearance and persistence of foreign (allogeneic) white blood cells (WBCs) in a recipient through transplantation, transfusion, or pregnancy has the potential for far-reaching biologic ramifications.1 Transfused WBCs have been associated with febrile transfusion reactions, alloimmunization and subsequent platelet refractoriness,2 transmission of cytomegalovirus (CMV) and other infections,3 up-regulation or reactivation of latent host viruses,4 and immune suppression of the recipient.5,6 

For many years it has been observed that red blood cell components from allogeneic donors contain WBCs capable of survival and expansion.7,8 In immunologically intact persons, the life of such cells is usually short (6 or fewer days),9,10 and no clinical consequences result. However, prolonged survival of donor cells, sometimes for years, has occurred after intrauterine transfusion,11,12 and recent studies have demonstrated the asymptomatic persistence of minor populations of donor cells in a proportion of patients after massive transfusion for trauma.13 

In immunologically impaired recipients, however, such as children with severe combined immunodeficiency, the consequences of transfusing viable WBCs in blood components can include graft-versus-host disease (GVHD).14,15 This transfusion-associated complication results in expansion of donor WBCs that orchestrate destruction of recipient tissues, including the skin, gastrointestinal tract, and hematopoietic cells. Although rare, transfusion-associated GVHD is almost always lethal because of bleeding and infections associated with profound bone marrow aplasia, and no satisfactory treatment has been discovered. Prevention is critical and requires that, to prevent lymphocyte proliferation, patients at risk be restricted to the transfusion of cellular components that have been gamma-irradiated.16 Because of a small degree of injury inflicted on red blood cells (RBCs) during irradiation17and the expense and administrative complexities associated with the procedure, only a small portion of blood components is usually treated in this fashion. Diagnoses and conditions that put patients at increased risk for transfusion-associated GVHD include severe congenital immunodeficiencies, in utero and neonatal transfusions, Hodgkin and other lymphomas, bone marrow transplantation, and use of drugs with strong immunosuppressant effects, such as 2-deoxycoformycin.18,19 

Patients infected with HIV are also immunologically impaired and ostensibly at high risk for long-term persistence and expansion of donor WBCs. However, only one instance of transfusion-associated GVHD has been reported, in a child.20 To better understand this paradox, we designed and carried out a study to assess the survival and quantitation of transfused WBCs given to HIV-infected recipients.

Study design

Transfusion recipients in this study were a subset of those enrolled in the multicenter Viral Activation Transfusion Study (VATS) between 1995 and 1998 (see 1 for names of participating institutions and persons).21 The main objective of VATS, a randomized and double-blinded study, was a comparison of the effects of leukoreduced versus unmodified blood transfusions on the clinical and laboratory course of HIV-infected patients. In addition to the primary endpoints of overall mortality and changes in plasma HIV RNA, the investigators also collected data that allowed the evaluation of the survival and persistence of transfused WBCs from male donors in female recipients.

Eligible subjects for VATS were 14 years of age or older, had never received blood products before (except for immune globulin), and were about to be transfused with red blood cells because of symptomatic, nonsurgically induced anemia. Patients with the diagnosis of thrombotic thrombocytopenia purpura and those who received intravenous immune globulin in the past 6 months were excluded. Other eligibility requirements included evidence of previous exposure to, or current infection with, cytomegalovirus, as determined by the presence of antibodies to this virus or a history of CMV end-organ disease. This was to ensure that no enrolled subject was at risk for de novo transfusion-transmitted CMV, as might occur to CMV-naive patients in the unmodified (white-cell replete) study arm.22 Enrolled subjects were randomized by telephone assignment to receive either leukoreduced (less than 5 × 106 residual WBCs per unit) or unmodified RBCs. Leukoreduction of RBCs was achieved through filtration, within 72 hours of blood collection; no specific manufacturer's filter was required. All RBC components were expected to be transfused within 14 days of collection whenever possible. Gamma irradiation was not used in this substudy. If platelet transfusions were required, these were leukoreduced regardless of the study arm assignment.

Patients underwent transfusions as ordered by their personal physicians. A transfusion episode included 1 U (or more) RBCs given over 1 day (or multiple days); each transfusion episode ended once no RBCs were transfused for at least 7 days. Two successive transfusion episodes (T1 and T2) were studied; weekly blood samples were obtained for up to 4 weeks after transfusion and then every 3 months after enrollment until the end of the study (spring 1999).

Subjects included in the donor survival analysis subset reported here were female VATS participants whose study transfusions included at least one component collected from a male donor and whose pre- and posttransfusion blood samples were available for testing.

Cell and DNA preparation and processing

Leukocyte pellets from EDTA-anticoagulated whole blood specimens from donors, and EDTA- and ACD-anticoagulated whole blood specimens from recipients at baseline and after transfusion, were frozen as previously described.10 After thawing, DNA lysates were prepared by adding 50 μL PCR lysis solution (10 mM Tris, pH 8.3; 2.5 mM MgCl2; 1% Tween-20; 1% NP40; 0.4 mL proteinase K) to each pellet and incubating at 60°C for 1.5 hours with vortexing every 20 minutes, followed by 95°C incubation for 2 hours.

Laboratory testing

The adequacy of leukoreduction was assessed in each RBC component using quantitative PCR of a generic human leukocyte antigen (HLA) DQ-alpha sequence in a leukocyte pellet prepared and frozen at the time of transfusion.23 HIV RNA was quantitated from frozen plasma using a reverse transcription—PCR assay with a lower limit of quantification of 200 copies per milliliter (Roche Amplicor assay; Roche Diagnostics; Branchburg, NJ). CD4 cell counts were measured by flow cytometry (FACScan; Becton Dickinson, San Jose, CA) using whole blood samples cryopreserved in dimethyl sulfoxide.23 

Donor lymphocyte survival studies

To detect male donor lymphocytes in a female recipient's blood, we used a 125-μL sample of posttransfusion recipient blood for the amplification of a 148-bp region of the sex-determining region of the human Y chromosome (SRY)24 using the allele-specific primer pair SA (5′ CGCATTCATCGTGTGGTCTCGCG 3′) and SD (5′ CTGTGCCTCCTGGAAGAATGGCC 3′), as previously described.13Specific amplified product was detected by oligomer liquid hybridization using a 32P-labeled probe, SB (5′ GAGGCGCAAGATGGCTCTAGAG 3′). Hybridized samples were subjected to 6% polyacrylamide gel electrophoresis (PAGE) at 12.5 V/cm and overnight autoradiography. Testing of all specimens associated with a specific recipient and transfusion episode (through the week 4 posttransfusion samples) was performed as a batch. DNA lysates were tested in duplicate, both neat and at a 1:10 dilution, in a single PCR–hybridization–PAGE autoradiography run. Duplicate standard curves composed of known concentrations (10-fold serial dilutions) of male donor cells in pretransfusion female recipient cells were analyzed in parallel with clinical samples and used to interpolate donor leukocyte concentrations in the latter samples. Autoradiographs were analyzed using the Millipore BioImage Electrophoresis Analyzer application software (Millipore, Ann Arbor, MI) with Whole Band Analyzer application software (Millipore), as detailed elsewhere.13Results were reported as WBC/mL. To avoid false-positive results, we considered male donor cells to be present in a specimen if all replicate results were greater than 0 and at least one of the results showed 25 or more donor cells per milliliter (3 times the theoretical detection limit of the assay).

Quantitative allele-specific PCR for HLA typing of donor cells

In recipients with measurable numbers of male cells after transfusion by Y-chromosome PCR analysis, we pursued identification of a specific donor through the amplification of HLA-DNA. For each transfusion episode, we used primers and probes designed to selectively amplify and detect single-copy HLA class II gene alleles that were unique to any possible male donor target cell populations and that were not present in the recipient. Concentrations of Mg2+, amplification protocols, and reaction buffers were adapted to each specific primer pair to optimize the assay conditions. Sequences of primers and probes and amplification conditions have been previously reported.13 

Five hundred thirty-one subjects were enrolled in the VATS trial; 265 were randomized to receive leukoreduced components, and 266 were randomized to receive unmodified blood. Women comprised 21% of enrolled subjects (112 subjects), including 56 in the leukoreduced transfusion arm and 56 in the unmodified arm. Two enrolled women (one in each arm) did not receive transfusions. Of the remaining 110 (Figure1), 80 (73%) received at least one RBC component from a male donor during the first transfusion episode (T1) and provided at least one posttransfusion specimen available for study. Of these 80 subjects, 42 were randomized to receive leukoreduced cells and 38 to receive nonleukoreduced cells. Thirty-four of these women (17 in each arm) underwent a second transfusion of red blood cells and provided posttransfusion samples. Thirteen other women who had received only female cells during a first transfusion (including 4 in the leukoreduced arm and 9 in the nonleukoreduced arm) received male cells in a second transfusion and had posttransfusion samples drawn. Thus, a total of 63 transfusion episodes administered to 46 women in the leukoreduced arm had evaluable posttransfusion samples, as did 64 transfusion episodes to 47 women in the nonleukoreduced arm. These 93 subjects comprise the donor survival study population. Characteristics of these women are shown in Table 1.

Fig. 1.

Distribution of female blood recipients.

Patients were randomized to receive either leukoreduced or nonleukoreduced red blood cells. ▪, number of subjects who received blood transfusions from one or more male donors, with evaluable posttransfusion blood samples; ■, number of subjects who received blood from only female donors, did not have posttransfusion blood samples for study, or did not undergo a T2 transfusion.

Fig. 1.

Distribution of female blood recipients.

Patients were randomized to receive either leukoreduced or nonleukoreduced red blood cells. ▪, number of subjects who received blood transfusions from one or more male donors, with evaluable posttransfusion blood samples; ■, number of subjects who received blood from only female donors, did not have posttransfusion blood samples for study, or did not undergo a T2 transfusion.

Table 1.

Characteristics before study transfusions of women with evaluable posttransfusion donor cell survival data

LR arm (T1)NLR arm (T1)LR arm (T2)NLR arm (T2)
Transfused female subjects 55 55 24 29  
Female subjects transfused with ≥ 1 U male donor
cells and evaluable data 
42 38 21 26  
Days between start of T1 and T2 transfusions* NA NA 54 (27, 144) 68 (16, 273) 
Subject age (y)* 35 (28, 47) 38 (24, 48) 35 (27, 44) 37 (28, 48) 
Race/ethnicity     
 White (%) 13 (31) 16 (42)  8 (38)  9 (35)  
 Black (%) 20 (48) 17 (45)  9 (43) 14 (54)  
 Hispanic (%)  9 (21)  2 (5)  4 (19)  2 (8)  
 Other (%)  0  3 (8)  0  1 (4)  
Route of HIV infection     
 Intravenous drug use (%) 12 (29) 17 (45)  8 (38)  9 (35) 
 Heterosexual contact (%) 28 (67) 18 (47) 12 (57) 14 (54) 
 Other/unknown (%)  2 (5)  3 (8)  1 (5)  3 (11)  
Previous HAART (%) 11 (26)  7 (18)  5 (24)  8 (31) 
Log10 HIV RNA*  4.7 (2.6, 5.8)  4.9 (2.7, 5.9)  5.0 (3.8, 5.9)  4.7 (2.7, 5.8) 
CD4 cell count per μL* 19 (2, 156) 12 (2, 357) 14 (2, 84)  6 (1, 303) 
LR arm (T1)NLR arm (T1)LR arm (T2)NLR arm (T2)
Transfused female subjects 55 55 24 29  
Female subjects transfused with ≥ 1 U male donor
cells and evaluable data 
42 38 21 26  
Days between start of T1 and T2 transfusions* NA NA 54 (27, 144) 68 (16, 273) 
Subject age (y)* 35 (28, 47) 38 (24, 48) 35 (27, 44) 37 (28, 48) 
Race/ethnicity     
 White (%) 13 (31) 16 (42)  8 (38)  9 (35)  
 Black (%) 20 (48) 17 (45)  9 (43) 14 (54)  
 Hispanic (%)  9 (21)  2 (5)  4 (19)  2 (8)  
 Other (%)  0  3 (8)  0  1 (4)  
Route of HIV infection     
 Intravenous drug use (%) 12 (29) 17 (45)  8 (38)  9 (35) 
 Heterosexual contact (%) 28 (67) 18 (47) 12 (57) 14 (54) 
 Other/unknown (%)  2 (5)  3 (8)  1 (5)  3 (11)  
Previous HAART (%) 11 (26)  7 (18)  5 (24)  8 (31) 
Log10 HIV RNA*  4.7 (2.6, 5.8)  4.9 (2.7, 5.9)  5.0 (3.8, 5.9)  4.7 (2.7, 5.8) 
CD4 cell count per μL* 19 (2, 156) 12 (2, 357) 14 (2, 84)  6 (1, 303) 

Of 110 female subjects transfused during the VATS, 80 had evaluable samples after their first (T1) transfusions, and 47 had evaluable samples after their second (T2) transfusions.

*

Median values are followed by 10th and 90th percentiles in parentheses.

Highly active antiretroviral therapy exposure before transfusion.

LR, leukoreduced study arm; NLR, nonleukoreduced study arm.

Leukoreduced RBCs had a median of 1.08 × 105 residual WBCs per component, and more than 99% of these components (1854 of 1869) had fewer than 5 × 106 WBCs per unit. The median age of a RBC component at the time of transfusion was 9 days (10th percentile, 3 days; 90th percentile, 14 days). Four percent of RBC components (157 of 3812 U in the full VATS study set) were older than 14 days at the time of transfusion.

Detection of male donor cells using Y-chromosome amplification is outlined in Table 2, and representative amplification gels are shown in Figure 2. Five transfusion episodes (of 64 total episodes) in 5 subjects receiving nonleukoreduced RBCs were associated with evidence of posttransfusion male donor cell survival. Four of these subjects (NLR-1, NLR-2, NLR-3, and NLR-5) had detectable cells at day 7, all after T2 transfusions. In 2 of these subjects (NLR-1 and NLR-2), the cells could no longer be detected 1 week later. NLR-3 had male cells detected on days 4 and 7 (the day 4 specimen was drawn as a quarterly specimen after T1); day 14, day 21, and day 28 samples were unavailable. NLR-5 had male cells on days 7 and 21 (day 14 results showed inconsistent reactivity and were not considered positive); cells were undetectable by day 28. For a T1 transfusion, NLR-4 received 2 U blood older than stipulated by the study protocol (24 days old). On day 14, male donor cells were readily detected, but by day 21 the sample was no longer considered positive. No male donor cells were detected in the nonleukoreduced arm during follow-up quarterly studies.

Table 2.

Detection of male donor WBCs after transfusion of red blood cells to female subjects

RecipientFirst transfusion episode (T1)Transfusion
interval
(start of T1
to start of
T2)
Second transfusion episode (T2)
Donor gender:
component age
(d)
Cell count (male cells/mL recipient blood)Donor gender:
component age
(d)
Cell count (male cells/mL recipient blood)
PreD7D14D21D28PreD7D14D21D28
NLR-1 M:10; F:7 0, 0 8, 0 (NT) (NT) (NT) 13 days M:12; F:12 0, 0 64, 71.5 0, 0 0, 0 0, 0 
NLR-2 M:3; M:5 NT (NT) 22 days M:3; M:3 0, 0; 0 25, 55; 20 0, 0; 0 NT NT 
NLR-3 M:7; F:7 NT 66 days M:7; F:10 0, 0 23; 49 NT NT NT 
NLR-4 M:24; F:24 0, 0 0, 0 1830, 2110 16, 0 0, 0 70 days M:11; F:11 NT  
NLR-5 M:12; F:12* 0, 0; 0 NT 0, 0; 16, 0 17, 5; 15 9, 21; 0 61 days M:3; M:4 0, 0; 0 16.5, 362 0, 20; 10 8.5, 31 0, 0; 0  
LR-1 M:7; M:10;
M:13; F:3 
02-153 No second
transfusion 
      
RecipientFirst transfusion episode (T1)Transfusion
interval
(start of T1
to start of
T2)
Second transfusion episode (T2)
Donor gender:
component age
(d)
Cell count (male cells/mL recipient blood)Donor gender:
component age
(d)
Cell count (male cells/mL recipient blood)
PreD7D14D21D28PreD7D14D21D28
NLR-1 M:10; F:7 0, 0 8, 0 (NT) (NT) (NT) 13 days M:12; F:12 0, 0 64, 71.5 0, 0 0, 0 0, 0 
NLR-2 M:3; M:5 NT (NT) 22 days M:3; M:3 0, 0; 0 25, 55; 20 0, 0; 0 NT NT 
NLR-3 M:7; F:7 NT 66 days M:7; F:10 0, 0 23; 49 NT NT NT 
NLR-4 M:24; F:24 0, 0 0, 0 1830, 2110 16, 0 0, 0 70 days M:11; F:11 NT  
NLR-5 M:12; F:12* 0, 0; 0 NT 0, 0; 16, 0 17, 5; 15 9, 21; 0 61 days M:3; M:4 0, 0; 0 16.5, 362 0, 20; 10 8.5, 31 0, 0; 0  
LR-1 M:7; M:10;
M:13; F:3 
02-153 No second
transfusion 
      

Male donor cells were considered present in a specimen (shaded box) if all replicate test results were >0 and at least one of the results was ≥25 donor cells/mL. Results separated by commas represent replicates of the same specimen tube. Results separated by semicolon represent repeat testing on separate specimen tubes (results are listed in order of testing).

*

Subject NLR-5 also received 2 U RBCs (M:16; F15) 9 days after the T1 transfusion.

See T2.

Subject NLR-3. T2 day 4 results also available: 90, 241.

F2-153

Subject LR-1. At 3 months after T1, male cells were detected: 33, 40.

NT, not tested.

Fig. 2.

Autoradiographs depicting donor leukocyte survival in 3 HIV-infected female recipients (NLR-1, NLR-2, and NLR-4) (top 3 rows).

Amplification of Y-chromosome DNA was performed using duplicate 125 μL whole blood samples collected at weekly intervals. All T00 (pretransfusion) samples were negative. The T07 blood sample from NLR-1 during the second study transfusion was positive (though a weak band was seen at T14, quantitation was below the definition of positive). NLR-2 was positive on T07, during the second study transfusion. NLR-4 was strongly positive on T14, during the first study transfusion. Lysate standards run with the clinical samples (NLR-1, standard run 2; NLR-2 and NLR-4, standard run 1) demonstrate 10-fold dilutions starting from the leftmost band equivalent to values of 1000, 100, 10, 1 and 0.1 genome equivalents (gEq)/lane.

Fig. 2.

Autoradiographs depicting donor leukocyte survival in 3 HIV-infected female recipients (NLR-1, NLR-2, and NLR-4) (top 3 rows).

Amplification of Y-chromosome DNA was performed using duplicate 125 μL whole blood samples collected at weekly intervals. All T00 (pretransfusion) samples were negative. The T07 blood sample from NLR-1 during the second study transfusion was positive (though a weak band was seen at T14, quantitation was below the definition of positive). NLR-2 was positive on T07, during the second study transfusion. NLR-4 was strongly positive on T14, during the first study transfusion. Lysate standards run with the clinical samples (NLR-1, standard run 2; NLR-2 and NLR-4, standard run 1) demonstrate 10-fold dilutions starting from the leftmost band equivalent to values of 1000, 100, 10, 1 and 0.1 genome equivalents (gEq)/lane.

In the leukoreduced arm, male donor cells were detected in 1 of 63 transfusion episodes involving leukoreduced RBCs. In this case (LR-1), no cells were detected during any of the 4 weekly samples after T1 transfusion but were found for the first and only time 3 months later. The residual white counts in the 4 filtered units given to LR-1 were all lower than 2.5 × 105 cells per component. Male donor cells were not detected in any other recipient in this arm at any time point.

Pretransfusion characteristics of the 6 women with detectable male donor cells after transfusion are shown in Table3; they were similar to those in the patient population as a whole (Table 1). With the exception of NLR-4, the median age of the transfused male donor components given to these women (6 days; 10th percentile, 3 days; 90th percentile, 14 days) was slightly younger than the median age of male donor components given to the other women (8 days; 10th percentile, 4 days; 90th percentile, 14 days).

Table 3.

Characteristics before study transfusions of women with detectable posttransfusion male donor cells

RecipientRaceHIV riskAgePrevious HAART use (start day, in relation to T1 transfusion)3-150Log10 HIV viral loadCD4 cells/μLDetection of male cells after transfusion episode
T1T2
NLR-1 Black Intravenous drug use 47 No 4.7 No Yes 
NLR-2 Black Intravenous drug use 28 −27 3.3 No Yes 
NLR-3 Black Heterosexual 34 −48 5.0 No Yes 
NLR-4 White Heterosexual 45 No 4.7 10 Yes No 
NLR-5 Black Heterosexual 44 No 4.7 No Yes 
LR-1 White Heterosexual 31 No < 2.33-152 52 Yes3-151 3-151 
RecipientRaceHIV riskAgePrevious HAART use (start day, in relation to T1 transfusion)3-150Log10 HIV viral loadCD4 cells/μLDetection of male cells after transfusion episode
T1T2
NLR-1 Black Intravenous drug use 47 No 4.7 No Yes 
NLR-2 Black Intravenous drug use 28 −27 3.3 No Yes 
NLR-3 Black Heterosexual 34 −48 5.0 No Yes 
NLR-4 White Heterosexual 45 No 4.7 10 Yes No 
NLR-5 Black Heterosexual 44 No 4.7 No Yes 
LR-1 White Heterosexual 31 No < 2.33-152 52 Yes3-151 3-151 
F3-150

Highly active antiretroviral therapy exposure before transfusion.

F3-151

LR-1 did not undergo T2 transfusion; male cells were detected only in the 3-month posttransfusion sample.

F3-152

Below lower limit of detection.

The detection of specific donor HLA genotypes is described in Tables 4through7. Posttransfusion samples were available for these experiments from 4 subjects (NLR-1, NLR-2, NLR-4, and NLR-5) at time points coinciding with dates when male cells were detected. No relevant samples were available from NLR-3 and LR-1 because all aliquots of frozen whole blood from the implicated time points had been used in other VATS-related research.

Table 4.

Detection of donor HLA class II genotypes after transfusion to recipient NLR-1

HLA alleleRecipient
NLR-1
Donor 1A
M, 10 days
Donor 1B
F, 7 days
Donor 1C
M, 12 days
Donor 1D
F, 12 days
Recipient, posttransfusion analysis day
TransfusionT1T1T2T2T2 day 7
(=T1 day 20)
DR1 POS  POS POS  NT 
DR11 POS     NT 
DQB501 POS POS POS POS  NT 
DQB7 POS     NT 
DR3  POS    Detected 
DQB201  POS POS POS  Detected 
DR7   POS POS POS NT 
DR4     POS NT 
DQB603     POS NT 
DQB8     POS NT 
HLA alleleRecipient
NLR-1
Donor 1A
M, 10 days
Donor 1B
F, 7 days
Donor 1C
M, 12 days
Donor 1D
F, 12 days
Recipient, posttransfusion analysis day
TransfusionT1T1T2T2T2 day 7
(=T1 day 20)
DR1 POS  POS POS  NT 
DR11 POS     NT 
DQB501 POS POS POS POS  NT 
DQB7 POS     NT 
DR3  POS    Detected 
DQB201  POS POS POS  Detected 
DR7   POS POS POS NT 
DR4     POS NT 
DQB603     POS NT 
DQB8     POS NT 

Allele-specific primers and probes were designed to detect HLA genotypes after transfusion that were not present in the recipient before transfusion. Donor gender and age of RBC component at time of transfusion are listed (eg, M, 10 days). Each recipient's genotype is indicated in the second column; corresponding genes found in the transfused blood donors are aligned with the recipient's.

POS, positive for gene; detected (not detected), identified (not identified) by respective primer/probe analysis of recipient's posttransfusion sample; NT, not tested.

Table 5.

Detection of donor HLA class II genotypes after transfusion to recipient NLR-2

HLA alleleRecipient
NLR-2
Donor 2A
M, 3 days
Donor 2B
M, 5 days
Donor 2C
M, 3 days
Donor 2D
M, 3 days
Recipient, posttransfusion analysis day
TransfusionT1T1T2T2T2 day 7
(=T1 day 29)
DR2 POS POS    NT 
DR3 POS     NT 
DR15 POS POS    NT 
DQB201 POS  POS  POS NT 
DQB602 POS POS    NT 
DQB603 POS POS    NT 
DR7   POS  POS Detected 
DQB501    POS POS Detected 
DQB7    POS  Detected 
DR13  POS    Not detected 
DQB8   POS   Not detected 
DR4   POS POS  NT 
DR1    POS POS NT 
HLA alleleRecipient
NLR-2
Donor 2A
M, 3 days
Donor 2B
M, 5 days
Donor 2C
M, 3 days
Donor 2D
M, 3 days
Recipient, posttransfusion analysis day
TransfusionT1T1T2T2T2 day 7
(=T1 day 29)
DR2 POS POS    NT 
DR3 POS     NT 
DR15 POS POS    NT 
DQB201 POS  POS  POS NT 
DQB602 POS POS    NT 
DQB603 POS POS    NT 
DR7   POS  POS Detected 
DQB501    POS POS Detected 
DQB7    POS  Detected 
DR13  POS    Not detected 
DQB8   POS   Not detected 
DR4   POS POS  NT 
DR1    POS POS NT 

See footnote to Table 4.

Table 6.

Detection of donor HLA class II genotypes after transfusion to recipient NLR-4

HLA alleleRecipient NLR-4Donor 4A M, 24 daysDonor 4B F, 24 daysRecipient, posttransfusion analysis day
TransfusionT1T1T1 day 14
DR1 POS   NT 
DR7 POS POS POS NT 
DQB201 POS POS POS NT  
DQB501 POS   NT 
DR15  POS  Detected  
DR2  POS  Not detected  
DQB602  POS  Not detected 
DR4   POS NT  
DQB8   POS NT 
HLA alleleRecipient NLR-4Donor 4A M, 24 daysDonor 4B F, 24 daysRecipient, posttransfusion analysis day
TransfusionT1T1T1 day 14
DR1 POS   NT 
DR7 POS POS POS NT 
DQB201 POS POS POS NT  
DQB501 POS   NT 
DR15  POS  Detected  
DR2  POS  Not detected  
DQB602  POS  Not detected 
DR4   POS NT  
DQB8   POS NT 

See footnote to Table 4.

Table 7.

Detection of donor HLA class II genotypes after transfusion to recipient NLR-5

HLA alleleRecipient NLR-5Donor 5A
M, 12 days
Donor 5B
F, 12 days
Donor 5C
F, 15 days
Donor 5D
M, 16 days
Donor 5E
M, 3 days
Donor 5F
M, 4 days
Recipient, posttransfusion analysis dayRecipient, posttransfusion analysis day
Transfusion dayT1T1T1 (day 9)T1 (day 9)T2T2T2 day 7
(=T1 day 68)
T2 day 21
(=T1 day 82)
DR2 POS POS      NT NT 
DR15 POS POS      NT NT 
DQB602 POS POS  POS   POS NT NT 
DQB603 POS   POS   POS NT NT 
DR11    POS   POS Detected Detected 
DR3     POS POS  Detected Detected 
DQB501   POS  POS   Detected Not detected 
DQB7   POS POS   POS Detected Not detected  
DR7  POS      Detected Not detected  
DR13    POS   POS Not detected Detected  
DR12   POS     Not detected Not detected 
DR4     POS POS  Not detected Not detected  
DQB201  POS    POS  NT NT 
DR1   POS     NT NT 
DQB8     POS POS  NT NT 
HLA alleleRecipient NLR-5Donor 5A
M, 12 days
Donor 5B
F, 12 days
Donor 5C
F, 15 days
Donor 5D
M, 16 days
Donor 5E
M, 3 days
Donor 5F
M, 4 days
Recipient, posttransfusion analysis dayRecipient, posttransfusion analysis day
Transfusion dayT1T1T1 (day 9)T1 (day 9)T2T2T2 day 7
(=T1 day 68)
T2 day 21
(=T1 day 82)
DR2 POS POS      NT NT 
DR15 POS POS      NT NT 
DQB602 POS POS  POS   POS NT NT 
DQB603 POS   POS   POS NT NT 
DR11    POS   POS Detected Detected 
DR3     POS POS  Detected Detected 
DQB501   POS  POS   Detected Not detected 
DQB7   POS POS   POS Detected Not detected  
DR7  POS      Detected Not detected  
DR13    POS   POS Not detected Detected  
DR12   POS     Not detected Not detected 
DR4     POS POS  Not detected Not detected  
DQB201  POS    POS  NT NT 
DR1   POS     NT NT 
DQB8     POS POS  NT NT 

See footnote to Table 4.

We were able to detect DR3 and DQB201 in a sample of blood from NLR-1 collected 7 days after the T2 transfusion (20 days after the T1 transfusion), when male DNA had been identified by Y-chromosome analysis. The presence of DR3 was consistent only with the genotype of male donor 1A, associated with the T1 transfusion. However, it is possible that we could have been detecting DNA from the other male donor (1C) or from female donor 1B because all 3 donors were DQB201-positive.

We used 5 sets of donor HLA-specific primer pairs and probes to test blood from recipient NLR-2 one week after her T2 transfusion. DR7, DQB501, and DQB7 were found, consistent with cells from T2 donors 2C and 2D. Donor 2B (from the T1 transfusion) was also DR7 positive, but we did not find DQB8, another of his alleles, and we did not find DR13, a distinguishing allele of donor 2A. Thus, at least 2 male donors could have contributed to the posttransfusion DNA detected in this subject.

We studied recipient NLR-4 on day 14 after the T1 transfusion, using 3 sets of primer pairs and probes that would have distinguished donor 4A from the recipient (DR2, DR15, and DQB602). Only DR15 was detected.

Finally we studied recipient NLR-5 at 2 time points after the T2 transfusion (day 7 and day 21). On day 7, at least 3 donors appeared to have contributed to the DNA detected—DR7 from donor 5A; DQB7 and DR11, but not DR13, from either donor 5C or 5F, or both; DQB501 from either donor 5B or 5D, or both; and DR3 from either donor 5D or 5E, or both. On day 21, DNA from donors 5A and 5B was no longer detectable, whereas DNA was still evident consistent with donors 5C, 5D, 5E, and 5F.

In the VATS subpopulation of 93 women who received RBC components from one or more male donors, only 5 had detectable male cells in the first month after transfusion. All were in the nonleukoreduced RBC study arm, and this outcome might have been predicted from the comparatively higher WBC content of the unmodified components. Results of DNA studies suggested that more than one donor might have been involved in the microchimerism, though the limitations of this assay make firm donor identification difficult. Four of the 5 recipients demonstrated male chimerism only with the T2 transfusion; whether this was by chance or was related to a cumulative effect of allogeneic transfusions on the likelihood of microchimerism cannot be determined from such small numbers. However, with 47 participants receiving nonleukoreduced RBCs, these 5 who had posttransfusion donor cell survival represented only 11% of subjects; seen another way, this represented 8% of the 64 evaluable transfusion episodes involving nonleukoreduced male donor RBCs. Of key importance, sustained donor leukocyte microchimerism did not develop in any of these recipients. These data provide confirmatory laboratory evidence in support of clinical impressions that HIV-infected patients are not at risk for GVHD.

Which factors might have protected most female transfusion recipients from detectable microchimerism or, conversely, placed 5 others at risk are unclear. In particular, the mean age of the components at transfusion was not meaningfully shorter in the 5 recipients with detectable donor cells than in other recipients in this substudy. On the contrary, the highest detectable number of male cells was found in the recipient of 2 old units (24 days old, NLR-4). Recipient factors such as age, race, HIV risk factor, previous HAART use, baseline viral load, and baseline CD4 cell count were also not uniquely slanted in this small population than in the rest of the sub-study group. In all 4 tested participants, one or more male donors shared some class II genes with the relevant recipient. It is possible that in some of these subjects, the degree of partial HLA matching between donor and recipient facilitated tolerance and allogeneic cell survival.25-27 However, the extent to which this occurred more frequently in these recipients than in other women in the study was not ascertained.

Of the 46 evaluable subjects assigned to the leukoreduced arm (and 63 evaluable transfusion episodes), male cells were detected in only one recipient after transfusion. The data were unusual in that no male cells were identified in her blood at any of the 4 weekly time points in the first month after transfusion. The sole positive sample was drawn 3 months after the transfusion, suggesting that alternative explanations for the presence of male donor cells must be considered in evaluating the results of our study. During pregnancy, 2-way trafficking of cells across the placenta—maternal to fetal circulation, and vice versa—has been documented. Fetal WBCs,28,29 and even free DNA of fetal origin,30 can be identified using DNA-based technology during and immediately after pregnancy. Long-term postpartum persistence of fetal cells also occurs, and the development of systemic sclerosis, with its marked preponderance in women, may be a consequence in some women of prolonged fetal cell survival and a fetal-versus-maternal (graft-versus-host) reaction.31,32In another study, 6 of 8 women with pregnancies more than 6 months earlier had evidence of CD34+ hematopoietic progenitor cells, in one woman as long as 27 years after delivery.33We were unfortunately unable to ascertain whether the subjects in our sub-study had given birth to male children before enrollment in VATS; this information had not been required in the original study database.

The use of male blood recipients could have circumvented the problem of long-term survival of male fetal cells in our female recipients and would have substantially increased our study population size (presumably without affecting the results; we are unaware of published data to suggest that transfusion-associated microchimerism has different features in males than in females). We used Y-chromosome DNA amplification for screening for microchimerism because of its ready applicability to female recipients receiving blood from one or more male donors of otherwise unknown genotype. Historically, the detection of microchimerism capitalized on such sex chromosome differences, primarily through cytogenetic identification of the Y chromosome8,11 or through PCR amplification of Y-chromosome DNA fragments.9,10 More recently, it has become possible to study other polymorphic genetic markers, such as HLA alleles,27,34 or non-HLA, highly polymorphic, or otherwise informative markers such as are found on human globin genes.14,28 However, if multiple donors or donors of unknown genotype are involved, a highly polymorphic system and many different probes must be used to consistently detect microchimerism. Even when a donor's genotype is known, careful choice of probes is required to ensure informative amplifications. In a recent side-by-side comparison of a selection of these approaches, Y-chromosome DNA amplification triumphed as the most sensitive and consistent assay for microchimerism.35 

Regardless of the assay used, the detection of rare populations of cells in blood remains challenging. Assays range in sensitivity from 0.1% male DNA in a female DNA background using single primer pairs for the Y chromosome to 0.0001% with nested primers.35Different primers may lead to different amplification efficiencies, and inadvertent mispriming of associated material, such as pseudogenes in the recipient, has led to false-positive results because of misinterpretation of the bands as of donor origin.36 We controlled for this possibility by running coded pre- and posttransfusion samples from each case together. In addition, the testing laboratory was blinded to the clinical assignment of patients to either the leukoreduced or the unmodified arm of the study. To minimize potential PCR carryover and to maximize specificity, we used nonnested assays with radiolabeled probes specific to the amplified product of the minor population under study.

We could also have missed the peak of donor lymphocyte proliferation in our transfusion recipients. In previous studies, the peak increase in concentration of donor lymphocytes has occurred from 3 to 7 days,7,8,10 and our choice of 7 days as the first posttransfusion assay point might have caused earlier transient proliferations to be missed. However, we expected and were looking for prolonged microchimerism that might have clinical relevance; hence, the absence of donor survival beyond 7 days was useful data.

Our subjects all had advanced acquired immunodeficiency syndrome. Given the inherent immunodeficiency of the illness and the severity of their conditions, they comprised a population theoretically likely to be at risk for GVHD. Despite this, measurable numbers of WBCs survived in only a small proportion, and then for only short periods, without amplification of cell numbers. These data are entirely in keeping with clinical observations that transfusion-associated GVHD does not develop in HIV-infected patients, almost without exception.37 In an isolated report in the literature, a child born with HIV received 6 nonirradiated RBC transfusions at age 30 months. Mild and transient GVHD associated with the appearance of additional HLA alleles in blood samples (presumably by serologic methods) linked to at least 4 different donors developed and persisted through 3 months after transfusion, when the symptoms disappeared.20 This single case report stands in stark contrast to statistics on blood usage in HIV infection. HIV infection has been diagnosed in more than 1 000 000 patients in the United States; moderate or severe anemia (hemoglobin level less than 9.4 g/dL) developed in an estimated 20% of them through 1996, and many became transfusion-dependent.38 The rarity of TA-GVHD may stem from infection with HIV, which could protect the infected patient from GVHD either by infecting and destroying transfused CD4+cells or by rendering those cells less able to proliferate in the immunosuppressive environment that is a consequence of HIV-1 replication.39 

Of interest is the contrast between these results and those obtained in a small population of apparently immunocompetent women who, after transfusion of multiple units of fresh blood (4 to 18 U, all 15 days old or younger) after trauma, had sustained, asymptomatic, multilineage microchimerism for many months.13 Hemorrhage, trauma, and surgery might separately or synergistically have created a degree of immunosuppression that fostered donor cell survival in these patients. In addition, the exposure to larger numbers of donors should have increased the odds that a partially HLA-matched donor was chosen to whom the recipient was tolerant.

The unexpected survival of, and host perturbation by, transplanted or transfused WBCs can have important repercussions for a recipient. GVHD resulting from the expansion of donor WBCs after solid organ or bone marrow transplantation can cause death or serious morbidity. By contrast, microchimerism, the steady-state survival of smaller numbers of donor cells, may be of critical value after organ transplantation in that these cells may facilitate donor tolerance and graft acceptance.40,41 Transfusion-associated GVHD in the already immunocompromised patient with HIV infection should presumably be a devastating adverse complication. However, our data suggest that donor WBCs are not able to proliferate in the HIV-infected patient. As a result, gamma irradiation or other methods (such as photochemical treatment)42 that prevent transfusion-associated graft-versus-host disease through the inhibition of T-cell proliferation appear unnecessary in this population.

We thank the patients who participated in this study for their efforts, and we thank the transfusion service personnel and nurses at each medical center, without whose assistance the study could not have been accomplished. Please see the for further information about the Viral Activation Transfusion Study Group.

The Viral Activation Transfusion Study Group is the responsibility of the following persons.

Clinical sites

Case Western Reserve University, Cleveland, OH (N01-HB-57115): Michael Lederman, MD; Roslyn Yomtovian, MD; Michael Chance, RN; Donna Hendrix, RN. Georgetown University, Washington, DC (N01-HB-57116): Princy N. Kumar, MD; S. Gerald Sandler, MD; Karyn Hawkins, RN. Miriam Hospital/Brown University, Providence, RI (N01-HB-57117): Timothy P. Flanigan, MD; Joseph Sweeney, MD; Maria D. Mileno, MD; Melissa Di Spigno, RN; Michelle Dupuis, MT (SSB). Mt Sinai School of Medicine, New York, NY (N01-HB-57118): Henry S. Sacks, PhD, MD; Kala Mohandas, MD; Frances R. Wallach, MD; Letty Mintz, ANP. Ohio State University, Columbus (N01-HB-57119): Michael F. Para, MD; Melanie S. Kennedy, MD; Jane Russell, RN; Dave Krugh, MT. University of California, San Diego (N01-HB-57120): Thomas A. Lane, MD; W. Christopher Mathews, MD; Peggy Mollen-Rabwin, RN. University of California, San Francisco (N01-HB-57121): Edward L. Murphy, MD, MPH; Steven G. Deeks, MD; Maurene Viele, MD; Chaolun Han, MD; Joanne Moore, MT (ASCP) SBB. University of North Carolina, Chapel Hill (N01-HB-57122): Charles van der Horst, MD; Meera Kelley, MD; Mark E. Brecher, MD; Linh Ngo, FNP. University of Pittsburgh, PA (N01-HB-57123): John W. Mellors, MD; Darrell J. Triulzi, MD; Deborah K. McMahon, MD; Sharon Riddler, MD. University of Texas Medical Branch, Galveston (N01-HB-57124): David M. Asmuth, MD; Richard B. Pollard, MD; Janice Curry, PAC; Gerald Shulman, MD. University of Washington/Puget Sound Blood Center, Seattle (N01-HB-57125): Ann Collier, MD; Terry Gernsheimer, MD; Dee Townsend-McCall, RN; Jill Corson, RN.

Central laboratory

Blood Centers of the Pacific, San Francisco, CA (N01-HB-57126): Michael P. Busch, MD, PhD; Tzong-Hae Lee, MD, PhD; W. Lawrence Drew, MD, PhD (UCSF Mt Zion Medical Center, San Francisco); Megan Laycock.

Coordinating center

New England Research Institutes, Watertown, MA (N01-HB-57127): Leslie A. Kalish, ScD; Susan F. Assmann, PhD; Jane D. Carrington, RN, BS; Margot S. Kruskall, MD (Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA); Ruth Eisenbud, BA.

Sponsoring agency

National Heart, Lung and Blood Institute: George J. Nemo, PhD, project officer; Paul R. McCurdy, MD; Dean Follmann, PhD.

Steering committee

Paul V. Holland, MD (chair), Sacramento Medical Foundation Blood Centers, CA.

Data Safety Monitoring Board

Jeffrey McCullough, MD (chair), University of Minnesota, Minneapolis; Victor DeGruttola, ScD; Peter Frame, MD; Janice G. McFarland, MD; Ronald T. Mitsuyasu, MD; Elizabeth J. Read, MD; Dorothy E. Vawter, PhD.

Supported by contracts N01-HB-57126, N01-HB-57127, and N01-HB-57115 from the National Heart Lung and Blood Institute (National Institutes of Health).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

1
Bordin
JO
Heddle
NM
Blajchman
MA
Biologic effects of leukocytes present in transfused cellular blood products.
Blood.
84
1994
1703
1721
2
Trial to Reduce Alloimmunization to Platelets (TRAP) Trial Study Group
Leukocyte-reduction and UV-B irradiation of platelets to prevent alloimmunization and refractoriness to platelet transfusions.
N Engl J Med.
337
1997
1861
1869
3
Przepiorka
D
LeParc
GF
Werch
J
Lichtiger
B
Prevention of transfusion-associated cytomegalovirus infection: practice parameter.
Am J Clin Pathol.
106
1996
163
169
4
Busch
MP
Lee
T-H
Heitman
J
Allogeneic leukocytes but not therapeutic blood elements induce reactivation and dissemination of latent human immunodeficiency virus type 1 infection: implications for transfusion support of infected patients.
Blood.
80
1992
2128
2135
5
Opelz
G
Terasaki
PI
Improvement of kidney graft survival with increased numbers of blood transfusions.
N Engl J Med.
299
1978
799
803
6
Peters
WR
Fry
RD
Fleshman
JW
Kodner
IJ
Multiple blood transfusions reduce the recurrence rate of Crohn's disease.
Dis Colon Rectum.
32
1989
749
753
7
Schechter
GP
Soehnlen
F
McFarland
W
Lymphocyte response to blood transfusion in man.
N Engl J Med.
287
1972
1169
1173
8
Schechter
GP
Whang-Peng
J
McFarland
W
Circulation of donor lymphocytes after blood transfusion in man.
Blood.
49
1977
651
656
9
Adams
PT
Davenport
RD
Reardon
DA
Roth
MS
Detection of circulating donor white blood cells in patients receiving multiple transfusions.
Blood.
80
1992
551
555
10
Lee
T-H
Donegan
E
Slichter
S
Busch
MP
Transient increase in circulating donor leukocytes after allogeneic transfusions in immunocompetent recipients compatible with donor cell proliferation.
Blood.
85
1995
1207
1214
11
Hutchinson
DL
Turner
JH
Schlesinger
ER
Persistence of donor cells in neonates after fetal and exchange transfusion.
Am J Obstet Gynecol.
109
1971
281
284
12
Viëtor
HE
Hallensleben
E
van Bree
SPMJ
et al
Survival of donor cells 25 years after intrauterine transfusion.
Blood.
95
2000
2709
2714
13
Lee
T-H
Paglieroni
T
Ohto
H
Holland
PV
Busch
MP
Survival of donor leukocyte subpopulations in immunocompetent transfusion recipients: frequent long-term microchimerism in severe trauma patients.
Blood.
93
1999
3127
3139
14
Blazar
BR
Filipovich
AH
Identification of transfused blood cells in children with severe combined immunodeficiency syndrome by analysis of multiple cell lineages using restriction fragment length polymorphisms.
Bone Marrow Transplant.
5
1990
327
333
15
Petz
LD
Calhoun
L
Yam
P
et al
Transfusion-associated graft-versus-host disease in immunocompetent patients: report of a fatal case associated with transfusion of blood from a second-degree relative, and a survey of predisposing factors.
Transfusion.
33
1993
742
750
16
Moroff
G
Leitman
SF
Luban
NL
Principles of blood irradiation, dose validation, and quality control.
Transfusion.
37
1997
1084
1092
17
Davey
RJ
McCoy
NC
Yu
M
Sullivan
JA
Spiegel
DM
Leitman
SF
The effect of prestorage irradiation on posttransfusion red cell survival.
Transfusion.
32
1992
525
528
18
Anderson
KC
Weinstein
HJ
Transfusion-associated graft-versus-host disease.
N Engl J Med.
323
1990
315
321
19
Ohto
H
Anderson
KC
Survey of transfusion-associated graft-versus-host disease in immunocompetent recipients.
Transfus Med Rev.
10
1996
31
43
20
Klein
C
Fraitag
S
Foulon
E
Raffoux
C
Bodemer
C
Blanche
S
Moderate and transient transfusion-associated cutaneous graft-versus-host disease in a child infected by human immunodeficiency virus.
Am J Med.
101
1996
445
446
21
Busch
MP
Collier
A
Gernsheimer
T
et al
The Viral Activation Transfusion Study (VATS): rationale, objectives, and design overview.
Transfusion.
36
1996
854
859
22
Bowden
RA
Slichter
SJ
Sayers
M
et al
A comparison of filtered leukocyte-reduced and cytomegalovirus (CMV) seronegative blood products for the prevention of transfusion-associated CMV infection after marrow transplant.
Blood.
86
1995
3598
3603
23
Lee
T-H
Sakahara
NS
Fiebig
EW
et al
Quantitation of white cell subpopulations by polymerase chain reaction using frozen whole-blood samples.
Transfusion.
38
1998
262
270
24
Sinclair
AH
Berta
P
Palmer
MS
et al
A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif.
Nature.
346
1990
240
244
25
Lagaaij
EL
Hennemann
IP
Ruigrok
M
et al
Effect of one-HLA-DR-antigen-matched and completely HLA-DR-mismatched blood transfusions on survival of heart and kidney allografts.
N Engl J Med.
321
1989
701
705
26
Nelson
JL
Furst
DE
Maloney
S
et al
Microchimerism and HLA-compatible relationships of pregnancy in scleroderma.
Lancet.
351
1998
559
562
27
Vervoordeldonk
SF
Doumaid
K
Remmerswaal
EBM
et al
Long-term detection of microchimaerism in peripheral blood after pretransplantation blood transfusion.
Br J Haematol.
102
1998
1004
1009
28
Lo
YMD
Lo
ESF
Watson
N
et al
Two-way cell traffic between mother and fetus: biologic and clinical implications.
Blood.
88
1996
4390
4395
29
Aractingi
S
Berkane
N
Bertheau
P
et al
Fetal DNA in skin of polymorphic eruptions of pregnancy.
Lancet.
352
1998
1898
1901
30
Lo
DYM
Hjelm
NM
Fidler
C
et al
Perinatal diagnosis of fetal RhD status by molecular analysis of maternal plasma.
N Engl J Med.
339
1998
1734
1738
31
Maloney
S
Smith
A
Furst
DE
et al
Microchimerism of maternal origin persists into adult life.
J Clin Invest.
104
1999
41
47
32
Artlett
CA
Smith
JB
Jiminez
SA
Identification of fetal DNA and cells in skin lesions from women with systemic sclerosis.
N Engl J Med.
338
1998
1186
1191
33
Bianchi
DW
Zickwolf
GK
Weil
GJ
Sylvester
S
DeMaria
MA
Male fetal progenitor cells persist in maternal blood for as long as 27 years postpartum.
Proc Natl Acad Sci U S A.
93
1996
705
708
34
Artlett
CA
Cox
LA
Jimenez
SA
Detection of cellular microchimerism of male and female origin in system sclerosis patients by polymerase chain reaction analysis of HLA-Cw antigens.
Arthritis Rheum.
43
2000
1062
1067
35
Sahota
A
Yang
M
McDaniel
HB
et al
Evaluation of seven PCR-based assays for the analysis of microchimerism.
Clin Biochem.
31
1998
641
645
36
Carter
AS
Bunce
M
Cerundolo
L
Welsh
KI
Morris
PJ
Fuggle
SV
Detection of microchimerism after allogeneic blood transfusion using nested polymerase chain reaction amplification with sequence-specific primers (PCR-SSP): a cautionary tale.
Blood.
92
1998
683
689
37
Anderson
KC
Goodnough
LT
Sayers
M
et al
Variation in blood component irradiation practice: implications for prevention of transfusion-associated graft-versus-host disease.
Blood.
77
1991
2096
2102
38
Moore
RD
Keruly
JC
Chaisson
RE
Anemia and survival in HIV infection.
J Acquir Immune Defic Syndr Hum Retrovirol.
19
1998
29
33
39
Ammann
AJ
Hypothesis: absence of graft-versus-host disease in AIDS is a consequence of HIV-1 infection of CD4+ T cells.
J Acquir Immune Defic Syndr.
6
1993
1224
1227
40
Starzl
TE
Clinical and basic scientific implications of cell migration and microchimerism after organ transplantation.
Artif Organs.
21
1997
1154
1155
41
Sakurada
M
Okazaki
H
Sato
T
et al
Peripheral blood chimerism in renal allograft recipients transfused with donor-specific blood.
Transplant Proc.
29
1997
1187
1188
42
Fiebig
E
Hirschkorn
DF
Maino
JA
Grass
JA
Lin
L
Busch
MP
Assessment of donor T-cell function in cellular blood components by the CD69 induction assay: effects of storage, γ radiation, and photochemical treatment.
Transfusion.
40
2000
761
770

Author notes

Margot S. Kruskall, Division of Laboratory and Transfusion Medicine, Beth Israel Deaconess Medical Center, Yamins 309, 330 Brookline Ave, Boston, MA 02215.