Abstract

Primary infection with the human herpesvirus, Epstein-Barr virus (EBV), may result in subclinical seroconversion or may appear as infectious mononucleosis (IM), a lymphoproliferative disease of variable severity. Why primary infection manifests differently between patients is unknown, and, given the difficulties in identifying donors undergoing silent seroconversion, little information has been reported. However, a longstanding assumption has been held that IM represents an exaggerated form of the virologic and immunologic events of asymptomatic infection. T-cell receptor (TCR) repertoires of a unique cohort of subclinically infected patients undergoing silent infection were studied, and the results highlight a fundamental difference between the 2 forms of infection. In contrast to the massive T-cell expansions mobilized during the acute symptomatic phase of IM, asymptomatic donors largely maintain homeostatic T-cell control and peripheral blood repertoire diversity. This disparity cannot simply be linked to severity or spread of the infection because high levels of EBV DNA were found in the blood from both types of acute infection. The results suggest that large expansions of T cells within the blood during IM may not always be associated with the control of primary EBV infection and that they may represent an overreaction that exacerbates disease.

Introduction

Epstein-Barr virus (EBV) is a γ herpesvirus that persists for life in humans as a latent infection of B cells under the immunosurveillance of CD8+ αβ cytotoxic T lymphocytes (CTLs) (reviewed in Khanna and Burrows1). An interesting enigma in EBV biology is the variable nature of primary infection. At one extreme, seroconversion can occur asymptomatically, whereas at the other extreme, mild to severe clinical manifestations of the lymphoproliferative disease infectious mononucleosis (IM) develop. Little is known about the immunologic and virologic parameters of silent infection except that it occurs most commonly in early childhood2,3 without significant blood lymphocytosis and with reduced and delayed titers of viral antibodies.2 In contrast, the overt clinical signs of IM (fever, lymphadenopathy, tonsillitis, and splenomegaly) have provided an experimental window for studying this form of primary infection. This self-limiting disease is typified by an increased systemic viral load4-6 and, in common with many other acute viral infections (eg, human immunodeficiency virus [HIV], lymphocytic choriomeningitis virus [LCMV], simian immunodeficiency virus),7-10 by a vigorous immune response of proliferating CD8+αβ-expressing T cells.11 Tracking studies using EBV-specific major histocompatibility complex class 1 tetramers have confirmed that most of these T-cell expansions are virus specific.12 It is unclear, however, whether these T cells play a pathologic or a protective role in IM. Resolution of the disease and transition to the long-term state of virus carrier are accompanied by a decrease in the numbers of virus-specific cytotoxic T lymphocytes (CTLs).

Precisely what factors (eg, preimmune precursor CTLs, burst size, affinity maturation, viral load) govern the extent of CTL expansion development, not only in IM but in other acute viral infections, remains largely unresolved. Infectious dose and degree of viral spread (systemic vs localized infection) appear to be important. Size or clonal burst of the antigen-specific CD8+ T-cell expansions in acute LCMV infection are determined by antigen load alone,13 whereas productive influenza A infection, which is largely restricted to the lung, elicits lower numbers of CTLs.14 In EBV, viral load may be important—high levels of virus are characteristic of IM, but levels are substantially lower in the healthy virus carrier state,6 and viral load is a prognosticator of lymphoproliferative disease progression in patients who have undergone transplantation.15 In addition, strong antibody responses to viral replication antigens are seen in acute IM, consistent with increased levels of virus replication in the oropharynx, but they are only rarely found among healthy EBV-seropositive donors (reviewed in Rickinson and Kieff16). Indeed, it has previously been hypothesized that IM donors receive high doses of EBV at the time of virus exposure and that they mobilize greater T-cell responses to control infection.16 

The variable clinical manifestations of acute EBV infection (asymptomatic vs mild to severe IM) offer an ideal opportunity to assess various virologic and immunologic parameters and their relation to the course of infection. Such comparative studies have been virtually unachievable, however, given the difficulty in finding donors without clinical symptoms at the time of EBV seroconversion. In the current study, a panel of patients undergoing silent seroconversion was serendipitously identified during screening for a phase 1 EBV vaccine trial. Using this unique cohort, we show that in contrast to the massive T-cell expansions elicited during the disease stage of acute IM, asymptomatic donors showed little evidence of blood repertoire perturbations. Furthermore, viral load studies revealed that this occurred despite high levels of circulating EBV at the time of seroconversion.

Materials and methods

Donors

Peripheral blood samples were taken from 3 different donor groups: healthy EBV seropositive control donors (designated HC), IM donors (designated IM), and asymptomatic donors undergoing primary EBV infection (designated AS). A panel of healthy donors was obtained by randomly selecting 6 healthy, HLA-unmatched subjects with lymphocyte counts, after Ficoll-Hypaque (Pharmacia Biotechnology, Melbourne, Australia) separation (see below), ranging from 1 to 2 × 106 cells/mL whole blood. From one of the HC donors, 2 consecutive samples were taken several months apart to test for T-cell repertoire stability. IM donors were initially bled (day 0) during the first 3 to 7 days of illness and were classified on clinical symptoms and serologic profiles consistent with early acute infection (immunoglobulin M+ [IgM+] viral capsid antigen [VCA] and IgG Epstein-Barr nuclear antigen [EBNA]). AS donors were serendipitously identified and exhibited serologic profiles consistent with early primary EBV infection (IgM+ VCA and IgG EBNA) in the absence of clinical symptoms. AS donors were also prospectively surveyed to confirm that IM symptoms did not subsequently develop. In IM and AS donors, the transition from primary to persistent infection was indicated by serology (IgM VCA; IgG+EBNA, IgG+VCA, or both). Note that in some patients with past EBV infection, EBNA IgG antibodies do not develop. Specific descriptions of the IM and AS donors are outlined in Table1. Peripheral blood mononuclear cells (PBMCs) were isolated from sodium-heparinized blood by centrifugation over Ficoll-Hypaque (Pharmacia Biotechnology). CD4+ and CD8+ lymphocyte levels within PBMCs were determined by FACS analysis using anti–human CD4 monoclonal antibody (mAb) conjugated with fluorescein isothiocyanate (clone SK4; Becton Dickinson, Sydney, Australia) and anti–human CD8 mAb conjugated with phycoerythrin (clone SK1; Becton Dickinson).

Table 1.

IM and AS donor descriptions

Donor Day(s) after diagnosis PBMC count CD8 (%) CD4 (%)1-153 Anti-VCA IgM Anti-VCA IgG Anti-EBNA IgG Health status
 
Infection stage1-155 
  IM1 6 × 106/mL 77 − − IM symptoms Primary 
 132 1 × 106/mL ND ND − Recovery Persistent 
  IM2 2.3 × 106/mL 70 24 − IM symptoms Primary 
 115 1 × 106/mL ND ND − − Recovery Persistent 
  IM3* 10 × 106/mL 67 24 − − IM symptoms Primary 
  IM4* 6 × 106/mL 53 − IM symptoms Primary 
  AS1 1 × 106/mL ND ND − Asymptomatic Primary 
 300 1 × 106/mL ND ND − − Asymptomatic Persistent 
  AS2 0.8 × 106/mL 32 14 − Asymptomatic Primary 
 73 1.6 × 106/mL 48 24 − − Asymptomatic Persistent 
  AS3 1.5 × 106/mL 27 53 − − Asymptomatic Primary 
 17 1.2 × 106/mL 28 45 − − Asymptomatic Primary 
  AS4* 2 × 106/mL ND ND − − Asymptomatic Primary 
Donor Day(s) after diagnosis PBMC count CD8 (%) CD4 (%)1-153 Anti-VCA IgM Anti-VCA IgG Anti-EBNA IgG Health status
 
Infection stage1-155 
  IM1 6 × 106/mL 77 − − IM symptoms Primary 
 132 1 × 106/mL ND ND − Recovery Persistent 
  IM2 2.3 × 106/mL 70 24 − IM symptoms Primary 
 115 1 × 106/mL ND ND − − Recovery Persistent 
  IM3* 10 × 106/mL 67 24 − − IM symptoms Primary 
  IM4* 6 × 106/mL 53 − IM symptoms Primary 
  AS1 1 × 106/mL ND ND − Asymptomatic Primary 
 300 1 × 106/mL ND ND − − Asymptomatic Persistent 
  AS2 0.8 × 106/mL 32 14 − Asymptomatic Primary 
 73 1.6 × 106/mL 48 24 − − Asymptomatic Persistent 
  AS3 1.5 × 106/mL 27 53 − − Asymptomatic Primary 
 17 1.2 × 106/mL 28 45 − − Asymptomatic Primary 
  AS4* 2 × 106/mL ND ND − − Asymptomatic Primary 

ND indicates not done.

*

No follow-up bleed was available.

Normal range for healthy control donors, 1-2 × 106 cells/mL blood.

Normal range for healthy control donors, 19% to 48% PBMCs.

F1-153

Normal range for healthy control donors, 28% to 58% PBMCs.

F1-155

Based on serologic profile (see “Materials and methods”).

T-cell receptor Vβ amplification and repertoire diversity analysis

PBMCs (1-2 × 106) were used for RNA extraction (Total RNA Isolation Reagent; Advanced Biotechnologies, London, United Kingdom). First-strand cDNA was synthesized using an antisense TCR Cβ primer (Cb1), as described previously.17 TCR Vβ-rearranged sequences were amplified with each of 26 different 5′ Vβ-specific primers (Vβ1-5.1, Vβ5.2-25) and a 3′ TCR Cβ constant primer.18,19 Amplifications were performed in 25-μL reactions using 0.5 μL cDNA, 5 pmol each primer, 200 μM dNTP, 1.5 mM MgCl2, 1.25 U Taq polymerase (Ampli-Taq Gold), and a GeneAmp PCR 9600 system (Perkin-Elmer Cetus, Norfolk, CT). Polymerase chain reaction (PCR) conditions consisted of an initial denaturation at 95°C for 9 minutes followed by 35 cycles of denaturation at 95°C for 15 seconds, annealing at 55°C for 40 seconds, extension at 72°C for 40 seconds, and a final extension at 72°C for 5 minutes.

The technique of CDR3 length determination and distribution to analyze TCR repertoire diversity is based on the methodology described previously.20 TCR Vβ PCR products were labeled with a nested 3′-FAM fluorophore-labeled primer specific for the TCR Cβ gene (CβP*: 5′-FAM-TTCTGATGGCTCAAACAC-3′; Research Genetics, Huntsville, AL) in a PCR run-off reaction. PCR conditions were identical to those described above except that 8% of TCR Vβ product was used as a template for 7 cycles of elongation (run-off) and a 5-minute final extension at 72°C. Fluorescent PCR run-off products were heat-denatured at 95°C for 5 minutes and were separated on a 6% acrylamide gel together with size standards (Genescan-1000 Rox; Applied Biosystems, Brisbane, Australia) on an Applied Biosystems 373A DNA sequencer. Data were processed using the Genescan Analysis 2.1 Software (Applied Biosystems), which records the fluorescence intensity in each peak. CDR3 length, defined by Chothia et al,21 was deduced from the fragment size.

Statistical analysis

CDR3 expansion was only considered significant if it satisfied the following criteria—at least a 2-fold magnitude change from the acute to the persistent infection phase and probability indicating statistical significance (P < .05) against a control background. The control background was calculated from data generated from the HC donors.

T-cell receptor V-D-J junctional region sequencing

Qiaex-purified TCR Vβ PCR products were ligated into the pGEM-T Vector System (Promega, Madison, WI) and were used to transform Epicurian Coli Sure Competent Cells (Stratagene, La Jolla, CA) according to the respective manufacturers' instructions. Plasmid inserts were amplified by PCR and were sequenced in both directions using the respective Vβ primers and Cβ with a Prism Ready Reaction Dyedeoxy Terminator Cycle Sequencing Kit and an ABI377 DNA sequencer (Applied Biosystems). Monoclonal expansions were also identified by direct sequencing of TCR Vβ PCR products, which showed that only a single nucleotide sequence was amplified.

Semiquantitative determination of EBV DNA load by polymerase chain reaction–enzyme-linked immunosorbent assay

EBV DNA load was determined by amplification of a 304-bp segment of the BMLF1 region of the EBV genome using 5′ and 3′ primers, GTCAACCAACAAGGACACAT and CACCACCTTGTTTTGACGGG, respectively.22 The oligonucleotide probe, CCGCGGGAGCTAGGGGCAGG, specific for an internal region of the 304-bp product,22 was biotinylated at the 5′ end during synthesis. Amplification of the BMLF1 region was carried out in a 25-μL reaction consisting of Ampgold buffer (Perkin-Elmer Cetus), 2 mM MgCl2, 0.5 μM each primer, and 200 μM dATP, dCTP, dGTP, 5.7 μM dUTP, 0.3 μM digoxigenin-dUTP (Boehringer-Mannheim, Castle Hill, Australia), 2.5 U Amplitaq Gold (Perkin-Elmer Cetus), and 100 ng genomic DNA as template. Genomic DNA was extracted (Qiagen Blood Kit; Qiagen, Clifton Hill, Australia) from donor PBMCs and from the EBV-positive cell line, Raji, which harbors 50 copies of EBV per cell. Raji DNA was added to 100 ng EBV seronegative PBMC DNA such that EBV copy numbers ranged from 1000 copies to 7.8 copies in doubling dilutions. These standards were used in the same PCR and acted as reference standards to determine EBV DNA load, which then was quantitatively assessed by using a PCR–enzyme-linked immunosorbent assay kit (DIG-detection; Boehringer-Mannheim) according to the manufacturer's instructions. All samples were made in a masked fashion, and in duplicate and negative controls they included water and PBMCs from an EBV-seronegative donor (EBV PBMC) and from the EBV B-cell line BJAB.

Results

Presence of blood lymphocytosis in infectious mononucleosis but not AS donors

Primary infection with EBV can occur either asymptomatically, when only serologic evidence confirms infection, or symptomatically, when serology and clinical symptoms consistent with IM confirm diagnosis. The current study compares several features of the asymptomatic and symptomatic states. Four IM and 4 AS donors were included in the analysis. Peripheral blood samples from patients with IM were taken within 3 to 7 days of the onset of clinical symptoms (day 0). Consistent with early acute infection, a serologic pattern of primary infection (IgM+ VCA and IgG EBNA) was detectable in IM and AS donors at the time of initial sampling (day 0) (Table 1). For IM donors, the transition from primary to persistent infection was accompanied by resolution of disease, and for IM and AS donors it was accompanied by the disappearance of anti-VCA IgM antibodies and the emergence of either an EBNA-specific or a VCA-specific IgG response (Table 1). Total blood lymphocyte counts differed significantly between IM and AS donors during the seroconversion period. IM donors displayed striking lymphocytosis and elevated levels of CD8+ lymphocytes at day 0 that were observed to resolve to normal total lymphocyte levels (≤2 × 106/mL) on disease recovery (Table 1). In contrast, primary infection in the 4 AS seroconvertants occurred in the absence of significant lymphocytosis, with PBMC levels and CD8+ lymphocyte counts falling within the normal range (Table 1). Donor AS2 did show unusually low levels of circulating CD4+ lymphocytes (Table 1), but this was not associated with EBV seroconversion because the decrease was consistently observed on serial measurements taken before day 0 sampling, when the donor was EBV seronegative (data not shown).

Major T-cell receptor expansions are common in infectious mononucleosis

To determine the global impact of EBV infection on PBMC repertoire diversity, PBMCs from 3 donors undergoing acute symptomatic infection were subjected to TCR analysis by immunoscope. This is a PCR-based technique that determines the distribution of CDR3 lengths within a given TCR Vβ family. Gaussian-shaped profiles represent a diverse array of clonotypes of varying CDR3 lengths, whereas oligoclonal peak profiles have been shown to represent clonally expanded T cells (reviewed in Pannetier et al23). Because the uniquely rearranged CDR3 region directly contacts the peptide antigen,24,25 this technique provides a sensitive indicator of antigen-specific clonal expansion. CDR3 profiles were compared between primary infection and after disease recovery to confirm whether they represented EBV-induced changes or formed part of the normal TCR repertoire for the patient. Because the Vβ repertoire of CD8+ cells26 and CD8+CD45RO+ memory cells27 in healthy adults is often skewed, presumably as a result of previous antigen challenge (eg, after EBV infection),28 repertoire perturbations were monitored at the PBMC level, which rarely showed any deviation from a polyclonal, Gaussian-shaped profile. As shown in Figure1, dramatic distortions in repertoire distribution were evident for at least 50% of the TCR Vβ families for each of the IM donors. These perturbations represented at least a 2-fold magnitude change and were statistically significant (P < .05) against a normal control background. For donor IM3, in whom a follow-up bleed was unavailable, expansions were confirmed based on statistical significance to normal control background levels. Overall, as expected for an HLA-unmatched cohort of IM donors, each donor exhibited a largely unique pattern of Vβ expansions of a particular CDR3 length that were found to resolve to normal Gaussian-like TCR profiles after disease recovery.

Fig. 1.

TCR Vβ repertoire analysis of PBMCs from IM donors during acute infection and recovery.

Depicted are the Vβ values of the known 1 to 25 families with significant expansions. Significance was based on at least a 2-fold magnitude change and P < .05 against a control background (see “Materials and methods”). Profiles are displayed of fluorescence intensity (x-axis, arbitrary units) as a function of CDR3 size (y-axis, amino acids). CDR3 peaks are spaced 3 nucleotides apart. ND indicates not done; NP, not present.

Fig. 1.

TCR Vβ repertoire analysis of PBMCs from IM donors during acute infection and recovery.

Depicted are the Vβ values of the known 1 to 25 families with significant expansions. Significance was based on at least a 2-fold magnitude change and P < .05 against a control background (see “Materials and methods”). Profiles are displayed of fluorescence intensity (x-axis, arbitrary units) as a function of CDR3 size (y-axis, amino acids). CDR3 peaks are spaced 3 nucleotides apart. ND indicates not done; NP, not present.

A single expanded peak in any given Vβ profile may represent either a monoclonal expansion of a single TCR clonotype or an oligoclonal expansion of different TCR clonotypes. To define the clonal nature of the observed perturbations, the TCR V-D-J junctional region sequences of recombinant clones that contained select TCR Vβ inserts from the 3 IM donors were examined (Figure 2). Expansions of Vβ 22 and 25 from IM1, Vβ 1, 12, and 23 from IM2, and Vβ 17 from IM3 were found to be clonal, indicating that the expansions resulted from antigen-driven T-cell selection.

Fig. 2.

TCR clonotype sequences from acute IM donors.

TCR CDR3 region sequences of selected Vβ expansions that were found by direct sequencing and recombinant cloning to be monoclonal (see “Materials and methods”). TCR Vβ and Jβ gene elements were assigned according to Arden et al52 and Toyonaga et al,53 respectively. FW signifies framework branches that putatively support the CDR3 region. Nucleotide sequences of each these clones are available from EMBL/GenBank/DDBJ under accession numbersAJ308532 to AJ308537.

Fig. 2.

TCR clonotype sequences from acute IM donors.

TCR CDR3 region sequences of selected Vβ expansions that were found by direct sequencing and recombinant cloning to be monoclonal (see “Materials and methods”). TCR Vβ and Jβ gene elements were assigned according to Arden et al52 and Toyonaga et al,53 respectively. FW signifies framework branches that putatively support the CDR3 region. Nucleotide sequences of each these clones are available from EMBL/GenBank/DDBJ under accession numbersAJ308532 to AJ308537.

Major T-cell receptor expansions are uncommon in asymptomatic infection

To investigate whether TCR repertoire perturbations eventuate in the absence of a detectable lymphocytosis, the PBMC repertoires of the 4 donors undergoing asymptomatic primary infection were assessed by immunoscope. In stark contrast to the dramatic and selective expansions observed in IM, most asymptomatic donors showed Gaussian-like profiles that remained unperturbed from the primary to the persistent stage of infection (Figure 3). Occasionally, minor repertoire perturbations were observed, but, despite lowering the cut-off criteria from a 2-fold to a 1.75-fold change in magnitude, these were not found to be statistically significant. The exception was donor AS4, who exhibited 6 Vβ families that proved to be significantly skewed (P < .05). The TCR V-D-J junctional sequencing showed that several of these represented clonal expansions (Figure 4).

Fig. 3.

TCR Vβ repertoire analysis of PBMCs from asymptomatic donors during acute and persistent infection.

Depicted are those Vβ values of the 1 to 25 known families who demonstrated a 2-fold magnitude change (see “Materials and methods”). Expansions that were statistically significant (P < .05) are indicated by an asterisk. Profiles are displayed of fluorescence intensity (x-axis, arbitrary units) as a function of CDR3 size (y-axis, amino acids). All CDR3 peaks are spaced 3 nucleotides apart.

Fig. 3.

TCR Vβ repertoire analysis of PBMCs from asymptomatic donors during acute and persistent infection.

Depicted are those Vβ values of the 1 to 25 known families who demonstrated a 2-fold magnitude change (see “Materials and methods”). Expansions that were statistically significant (P < .05) are indicated by an asterisk. Profiles are displayed of fluorescence intensity (x-axis, arbitrary units) as a function of CDR3 size (y-axis, amino acids). All CDR3 peaks are spaced 3 nucleotides apart.

Fig. 4.

TCR clonotype sequences from acute asymptomatic donor AS4.

TCR CDR3 region sequences of selected Vβ expansions that were found by direct sequencing and recombinant cloning to be monoclonal (see “Materials and methods”). TCR Vβ and Jβ gene elements were assigned according to Arden et al52 and Toyonaga et al,53 respectively. FW signifies framework branches that putatively support the CDR3 region. Nucleotide sequences of each of these clones are available from EMBL/GenBank/DDBJ under accession numbers AJ308538 to AJ308539.

Fig. 4.

TCR clonotype sequences from acute asymptomatic donor AS4.

TCR CDR3 region sequences of selected Vβ expansions that were found by direct sequencing and recombinant cloning to be monoclonal (see “Materials and methods”). TCR Vβ and Jβ gene elements were assigned according to Arden et al52 and Toyonaga et al,53 respectively. FW signifies framework branches that putatively support the CDR3 region. Nucleotide sequences of each of these clones are available from EMBL/GenBank/DDBJ under accession numbers AJ308538 to AJ308539.

High levels of EBV genomes circulate in asymptomatic primary infection

An important virologic parameter that may regulate the clinical outcome and the expansion or mobilization of T cells during primary EBV infection is viral load. To investigate whether the absence of major T-cell expansions during subclinical primary infection was associated with a low-level underlying viral infection, EBV genome copy number per microgram total cellular DNA was determined in PBMCs by semiquantitative PCR-ELISA. Three asymptomatic seroconvertants (AS1, AS3, AS4), 3 IM donors (IM1, IM3, IM4), and 3 seropositive healthy control donors (HC1, HC2, HC3) were assessed (Figure5). Consistent with previous reports, viral genomes were low or undetectable in healthy control donors, reflective of low-level latent infection,6,29 whereas the level of circulating EBV DNA was 500- to 1000-fold increased in those with IM. Surprisingly, very high viral loads were also detected in 2 (AS1, AS4) donors undergoing asymptomatic primary EBV infection, and the third (AS3), though not as intense, showed levels well above (greater than 70-fold) those of background healthy controls. These unexpectedly high levels of EBV DNA fell to undetectable levels on establishment of persistent latent infection. Overall, the data provide compelling evidence of high systemic EBV DNA levels in silent primary infection despite the lack of detectable peripheral T-cell expansions.

Fig. 5.

EBV load.

In peripheral blood of IM patients (IM), asymptomatic seroconvertants (AS), healthy control donors (HC), and negative controls (water, EBV PBMC, BJAB). EBV genome copies were estimated by semiquantitative BMLF1 PCR-ELISA on PBMCs (see “Materials and methods”). UN indicates undetectable (less than 0). Specific descriptions of the IM and AS donors are outlined in Table 1.

Fig. 5.

EBV load.

In peripheral blood of IM patients (IM), asymptomatic seroconvertants (AS), healthy control donors (HC), and negative controls (water, EBV PBMC, BJAB). EBV genome copies were estimated by semiquantitative BMLF1 PCR-ELISA on PBMCs (see “Materials and methods”). UN indicates undetectable (less than 0). Specific descriptions of the IM and AS donors are outlined in Table 1.

Discussion

This report highlights new findings regarding the biology of primary EBV infection. First, in contrast to acute IM, subclinical infection does not evoke a massive peripheral T-cell response, as evidenced by the lack of significant blood lymphocytosis and selective expansions of Vβ-expressing T cells. Second, high levels of systemic viral infection are common in both forms of primary infection despite the stark disparity in peripheral blood repertoire profiles.

The impressive mobilization of activated CD8+ T cells in response to acute EBV infection is well documented in IM. Consistent with the results of this study, selective expansions of dominant Vβ-expressing T cells are a feature of the acute immune response and do not persist after recovery from the disease.30 As much as 50% of the Vβ blood repertoire is distorted during the symptomatic phase, which supports the known multispecificity of CTL epitope reactivities in acute IM.18,31-33 Furthermore, many of these expansions are clonal in composition, a strong indicator of antigen-driven amplification rather than the result of bystander or superantigen-induced T-cell activation. Indeed, findings from major histocompatibility complex class I tetramer studies have confirmed that most of these expansions are reactive to viral antigens12and that their decline in numbers is paralleled by a drop in EBV genome load within the blood during disease recovery.34 What is unclear is whether the magnitude of lymphocytosis and virus-specific CTL response is directly linked to viremia level during the primary infection period. Our unexpected observation that donors undergoing subclinical primary EBV infection were heavily infected with the virus yet usually showed no evidence of major expansion of virus-specific T cells when compared with IM argued against this simple linear relationship. Moreover, the notion that massive CTL expansions are linked with widespread (not localized) viral infection is unlikely, at least in the subclinical EBV setting, in view of the abundance of virus within the circulation. Interestingly, in acute HIV infection, which also shows a mononucleosislike syndrome of variable severity, the extent of peripheral blood T-cell perturbations is also independent of initial viral load levels.35-37 However, the relation between these parameters changes once persistent infection is established, with HIV-specific CTL frequencies and viral load becoming inversely correlated38 and increased plasma viremia becoming a prognosticator of faster disease progression.39,40 

An important correlate with disease development in IM appears to be the development of a significant blood CD8+ T-cell lymphocytosis. Indeed, patients who undergo silent seroconversion have normal levels of blood mononuclear cells, whereas elevated levels are characteristic of symptomatic seroconversion. A similar observation is reported in children who asymptomatically contract EBV for the first time; transient lymphocytosis is noted in only a small number, and most demonstrate no hematologic disturbances.2 Although more quantitative studies are needed that measure the degree and duration of lymphocytosis with the severity of clinical symptoms, it appears that the severity of immunopathology in IM is modulated by participating T-cell numbers. In support, the disease course of IM closely parallels the lymphoproliferative phase in which activated T cells appear in the blood.41 Furthermore, our recent discovery that EBV-specific T cells cross-react with self-antigens strengthens the possibility that such cross-reactions in abundance could lead to lysis of uninfected host cells, thereby contributing to disease exacerbation.19 Also of likely importance are the as yet unidentified homeostatic regulatory mechanisms that bring the T-cell response under control. Interestingly, the presence of T-cell perturbations is not necessarily linked to increased numbers of T cells within the circulation. For example, dominant TCR expansion profiles are documented in PBMCs of HIV-infected patients without elevated levels of CD8+ cells.37 In the current study, major T-cell expansions were evident despite the absence of blood lymphocytosis in one of the asymptomatic donors studied (donor AS4; Figure 3). Therefore, homeostatic T-cell control may be maintained in some instances during active stimulation of an antiviral T-cell response. Clearly, our studies suggest that the magnitude of the CD8+ response to EBV is likely to be considerably lower in the asymptomatic form of primary EBV infection. Yet these donors responded to high levels of systemic virus infection without having clinical symptoms. Strong EBV-specific memory CTL responses to commonly targeted epitopes within several viral latent gene products have been detected in infants who previously had asymptomatic EBV infection.42 It remains to be seen whether the primary asymptomatic T-cell response is qualitatively different (eg, in breadth or specificity of CTL reactivity) than that in IM.

What then triggers the development of T-cell lymphocytosis and disease during primary EBV infection? It is highly likely that interdependent host and virologic factors are involved in the regulation of disease development. Polymorphisms of the interleukin-1 (IL-1) gene complex43 and of the IL-10 gene44have been linked to susceptibility to EBV infection and, in the case of IL-10, to lymphoproliferative disease severity. Similarly, disease severity after respiratory syncytial virus infection appears to be associated with the IL-8 gene region,45 and elevated serum levels of Fas ligand are associated with the asymptomatic stage of HIV infection.46 An important virologic parameter controlling the level of T-cell expansion development may be the type of life cycle adopted by the virus in vivo. EBV can establish latent or lytic infection, and the virus has evolved several gene regulatory mechanisms (eg, transcriptional, posttranscriptional, and posttranslational) for controlling its own gene expression (reviewed in Kieff47). Therefore, the tantalizing possibility exists that EBV establishes a different form of infection or pattern of gene expression in IM than it does during asymptomatic seroconversion. For instance, the high viral load observed in silent primary infection might result from an increase in the number of latently infected B cells in the blood, whereas in IM there may be more virus replication. Significantly, notable features of IM are the presence of lytically infected B cells within the blood,48 high titers of antibodies against lytic cycle proteins,16 and high amounts of free virus DNA in the serum.49,50 Furthermore, studies monitoring CTL responses during acute IM have established that a sizable proportion of the total CD8+ response is directed toward lytic rather than latent antigen recognition.12,32 Additional support for lytic infection, possibly contributing to disease etiology in IM, is the isolation of an EBV strain with an increased propensity for lytic rather than latent B cell infection from a patient with severe chronic active infection.51 

In conclusion, we have shown that the expansion of T cells in response to acute EBV infection differs depending on whether the infection progresses without clinical symptoms or develops into IM. Furthermore, the development of large peripheral T-cell expansions during IM—though largely virus specific, as shown by previous studies—are not necessary for controlling the high load of virus-infected cells in the blood during the acute phase. In this context, T cells may become immunopathogenic when expanded beyond homeostasis in IM. The mobilization of large expansions of virus-specific CTLs that contribute to pathologic conditions during infection appear counterproductive, but possibly they arise as a result of host genetic and virologic life cycle differences that effect the activation and expansion of antigen-specific T cells.

We thank Andrew Rosenstengel and Stephanie Pye for their valuable technical assistance with the EBV phase 1 vaccine trial.

Supported by grants from the National Health and Medical Research Council of Australia.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

References

References
1
Khanna
R
Burrows
SR
Role of cytotoxic T lymphocytes in Epstein-Barr virus-associated diseases.
Annu Rev Microbiol.
54
2000
19
48
2
Biggar
RJ
Henle
W
Fleisher
G
Bocker
J
Lennette
ET
Henle
G
Primary Epstein-Barr virus infections in African infants, II: clinical and serological observations during seroconversion.
Int J Cancer.
22
1978
244
250
3
Fleisher
G
Henle
W
Henle
G
Lennette
ET
Biggar
RJ
Primary infection with Epstein-Barr virus in infants in the United States: clinical and serologic observations.
J Infect Dis.
139
1979
553
558
4
Klein
G
Svedmyr
E
Jondal
M
Persson
PO
EBV-determined nuclear antigen (EBNA)-positive cells in the peripheral blood of infectious mononucleosis patients.
Int J Cancer.
17
1976
21
26
5
Katsuki
T
Hinuma
Y
Saito
T
et al. 
Simultaneous presence of EBNA-positive and colony-forming cells in peripheral blood of patients with infectious mononucleosis.
Int J Cancer.
23
1979
746
750
6
Kimura
H
Morita
M
Yabuta
Y
et al. 
Quantitative analysis of Epstein-Barr virus load by using a real-time PCR assay.
J Clin Microbiol.
37
1999
132
136
7
Chen
ZW
Kou
ZC
Lekutis
C
et al. 
T cell receptor V beta repertoire in an acute infection of rhesus monkeys with simian immunodeficiency viruses and a chimeric simian-human immunodeficiency virus.
J Exp Med.
182
1995
21
31
8
Wilson
JD
Ogg
GS
Allen
RL
et al. 
Oligoclonal expansions of CD8(+) T cells in chronic HIV infection are antigen specific.
J Exp Med.
188
1998
785
790
9
Sourdive
DJ
Murali-Krishna
K
Altman
JD
et al. 
Conserved T cell receptor repertoire in primary and memory CD8 T cell responses to an acute viral infection.
J Exp Med.
188
1998
71
82
10
Pantaleo
G
Demarest
JF
Soudeyns
H
et al. 
Major expansion of CD8+ T-cells with a predominant V beta usage during the primary immune response to HIV.
Nature.
370
1994
463
467
11
Tomkinson
BE
Wagner
DK
Nelson
DL
Sullivan
JL
Activated lymphocytes during acute Epstein-Barr virus infection.
J Immunol.
139
1987
3802
3807
12
Callan
MFC
Tan
L
Annels
N
et al. 
Direct visualization of antigen-specific CD8+ T cells during the primary immune response to Epstein-Barr virus in vivo.
J Exp Med.
187
1998
1395
1402
13
Gallimore
A
Glithero
A
Godkin
A
et al. 
Induction and exhaustion of lymphocytic choriomeningitis virus-specific cytotoxic T lymphocytes visualized using soluble tetrameric major histocompatibility complex class I-peptide complexes.
J Exp Med.
187
1998
1383
1393
14
Flynn
KJ
Belz
GT
Altman
JD
Ahmed
R
Woodland
DL
Doherty
PC
Virus-specific CD8+ T cells in primary and secondary influenza pneumonia.
Immunity.
8
1998
683
691
15
Riddler
SA
Breinig
MC
McKnight
JL
Increased levels of circulating Epstein-Barr virus (EBV)infected lymphocytes and decreased EBV nuclear antigen antibody responses are associated with the development of posttransplant lymphoproliferative disease in solid-organ transplant recipients.
Blood.
84
1994
972
984
16
Rickinson
AB
Kieff
E
Epstein-Barr virus.
Fields Virology.
Fields
BN
Knipe
DM
Howley
PM
1996
2397
2446
Lippincott-Raven
Philadelphia, PA
17
Argaet
VP
Schmidt
CW
Burrows
SR
et al. 
Dominant selection of an invariant T-cell antigen receptor in response to persistent infection by Epstein-Barr virus.
J Exp Med.
180
1994
2335
2340
18
Silins
SL
Cross
SM
Elliott
SL
et al. 
Selection of a diverse TCR repertoire in response to an Epstein-Barr virus-encoded transactivator protein BZLF1 by CD8+ cytotoxic T lymphocytes during primary and persistent infection.
Int Immunol.
9
1997
1745
1755
19
Misko
IS
Cross
SM
Khanna
R
et al. 
Cross-reactive recognition of viral, self and bacterial peptide ligands by human class I-restricted cytotoxic T lymphocyte clonotypes: implications for molecular mimicry in autoimmune diseases.
Proc Natl Acad Sci U S A.
6
1999
2279
2284
20
Pannetier
C
Cochet
M
Darche
S
Casrouge
A
Zoller
M
Kourilsky
P
The sizes of the CDR3 hypervariable regions of the murine T-cell receptor beta chains vary as a function of the recombined germ-line.
Proc Natl Acad Sci U S A.
90
1993
4319
4323
21
Chothia
C
Boswell
DR
Lesk
AM
The outline structure of the T-cell alpha beta receptor.
EMBO J.
7
1988
3745
3755
22
Pedneault
L
Katz
BZ
Comparison of polymerase chain reaction and standard Southern blotting for the detection of Epstein-Barr virus DNA in various biopsy specimens.
J Med Virol.
39
1993
33
43
23
Pannetier
C
Even
J
Kourilsky
P
T-cell repertoire diversity and clonal expansions in normal and clinical samples.
Immunol Today.
16
1995
176
181
24
Garcia
KC
Degano
M
Stanfield
R
et al. 
An alpha-beta T cell receptor structure at 2.5 angstrom and its orientation in the TCR-MHC complex.
Science.
274
1996
209
219
25
Garboczi
DN
Ghosh
P
Utz
U
Fan
QR
Biddison
WE
Wiley
DC
Structure of the complex between human T-cell receptor, viral peptide and HLA-A2.
Nature.
384
1996
134
141
26
Posnett
DN
Sinha
R
Kabak
S
Russo
C
Clonal populations of T cells in normal elderly humans: the T cell equivalent to “benign monoclonal gammapathy.”
J Exp Med.
179
1994
609
618
27
Bonfert
V
Cihak
J
Losch
U
Ziegler-Heitbrock
HWL
Preferential expression of V beta gene families in CD8 memory cells of apparently healthy donors.
Cell Immunol.
166
1995
165
171
28
Silins
SL
Cross
SM
Krauer
KG
Moss
DJ
Schmidt
CW
Misko
IS
A functional link for major TCR expansions in healthy adults caused by persistent Epstein-Barr virus infection.
J Clin Invest.
102
1998
1551
1558
29
Babcock
GJ
Decker
LL
Freeman
RB
Thorley-Lawson
DA
Epstein-Barr virus-infected resting memory B cells, not proliferating lymphoblasts, accumulate in the peripheral blood of immunosuppressed patients.
J Exp Med.
90
1999
567
576
30
Callan
MFC
Steven
N
Krausa
P
et al. 
Large clonal expansions of CD8+ T cells in acute infectious mononucleosis.
Nat Med.
2
1996
906
911
31
Silins
SL
Cross
SM
Elliott
SL
et al. 
Development of Epstein-Barr virus-specific memory T-cell receptor clonotypes in acute infectious mononucleosis.
J Exp Med.
184
1996
1815
1824
32
Steven
NM
Annels
NE
Kumar
A
Leese
AM
Kurilla
MG
Rickinson
AB
Immediate early and early lytic cycle proteins are frequent targets of the Epstein-Barr virus-induced cytotoxic T cell response.
J Exp Med.
185
1997
1605
1617
33
Khanna
R
Sherritt
M
Burrows
SR
EBV structural antigens, gp350 and gp85, as targets for ex vivo virus-specific CTL during acute infectious mononucleosis: potential use of gp350/gp85 CTL epitopes for vaccine design.
J Immunol.
162
1999
3063
3069
34
Hoshino
Y
Morishima
T
Kimura
H
Nishikawa
K
Tsurumi
T
Kuzushima
K
Antigen-driven expansion and contraction of CD8+-activated T cells in primary EBV infection.
J Immunol.
163
1999
5735
5740
35
Pantaleo
G
Demarest
JF
Schacker
T
et al. 
The qualitative nature of the primary immune response to HIV infection is a prognosticator of disease progression independent of the initial level of plasma viremia.
Proc Natl Acad Sci U S A.
94
1997
254
258
36
Gorochov
G
Neumann
AU
Kereveur
A
et al. 
Perturbation of CD4+ and CD8+ T-cell repertoires during progression to AIDS and regulation of the CD4+ repertoire during antiviral therapy.
Nat Med.
4
1998
215
221
37
Than
S
Kharbanda
M
Chitnis
V
Bakshi
S
Gregersen
PK
Pahwa
S
Clonal dominance patterns of CD8 T cells in relation to disease progression in HIV-infected children.
J Immunol.
162
1999
3680
3686
38
Ogg
GS
Jin
X
Bonhoeffer
S
et al. 
Quantitation of HIV-1–specific cytotoxic T lymphocytes and plasma load of viral RNA.
Science.
279
1998
2103
2106
39
Mellors
JW
Rinaldo
CRJ
Gupta
P
White
RM
Todd
JA
Kingsley
LA
Prognosis in HIV-1 infection predicted by the quantity of virus in plasma.
Science.
272
1996
1167
1170
40
Iuliano
R
Forastieri
G
Brizzi
M
Mecocci
L
Mazzotta
F
Ceccherini-Nelli
L
Correlation between plasma HIV-1 RNA levels and the rate of immunologic decline.
J Acquir Immune Defic Syndr Hum Retrovirol.
14
1997
408
414
41
Svedmyr
E
Ernberg
I
Seeley
J
Weiland
O
Masucci
G
Tsukuda
K
Virologic, immunologic, and clinical observations on a patient during the incubation, acute, and convalescent phases of infectious mononucleosis.
Clin Immunol Immunopathol.
30
1984
437
450
42
Tamaki
H
Beaulieu
BL
Somasundaran
M
Sullivan
JL
Major histocompatibility complex class I-restricted cytotoxic T lymphocyte responses to Epstein-Barr virus in children.
J Infect Dis.
172
1995
739
746
43
Hurme
M
Helminen
M
Polymorphism of the IL-1 gene complex in Epstein-Barr virus seronegative and seropositive adult blood donors.
Scand J Immunol.
48
1998
219
222
44
Helminen
M
Lahdenpohja
N
Hurme
M
Polymorphism of the interleukin-10 gene is associated with susceptibility to Epstein-Barr virus infection.
J Infect Dis.
180
1999
496
499
45
Hull
J
Thomson
A
Kwiatkowski
D
Association of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families.
Thorax.
55
2000
1023
1027
46
Bahr
GM
Capron
A
Dewulf
J
et al. 
Elevated serum level of Fas ligand correlates with the asymptomatic stage of human immunodeficiency virus infection.
Blood.
90
1997
896
898
47
Kieff
E
Epstein-Barr virus and its replication.
Virology.
Fields
BN
Knipe
DM
Howley
PM
1996
2343
2396
Lippincott-Raven
Philadelphia, PA
48
Prang
NS
Hornef
MW
Jager
M
Wagner
HJ
Wolf
H
Schwarzmann
FM
Lytic replication of Epstein-Barr virus in the peripheral blood: analysis of viral gene expression in B lymphocytes during infectious mononucleosis and in the normal carrier state.
Blood.
89
1997
1665
1677
49
Gan
YJ
Sullivan
JL
Sixbey
JW
Detection of cell-free Epstein-Barr virus DNA in serum during acute infectious mononucleosis.
J Infect Dis.
170
1994
436
439
50
Yamamoto
M
Kimura
H
Hironaka
T
et al. 
Detection and quantification of virus DNA in plasma of patients with Epstein-Barr virus-associated diseases.
J Clin Microbiol.
33
1995
1765
1768
51
Schwarzmann
F
von Baehr
R
Jager
M
et al. 
A case of severe chronic active infection with Epstein-Barr virus: immunologic deficiencies associated with a lytic virus strain.
Clin Infect Dis.
29
1999
626
631
52
Arden
B
Clark
SP
Kabelitz
D
Mak
TW
Human T-cell receptor variable gene segment families.
Immunogenetics.
42
1995
455
500
53
Toyonaga
B
Yoshikai
Y
Vadasz
V
Chin
B
Mak
TW
Organization and sequences of the diversity, joining, and constant region genes of the human T-cell receptor beta chain.
Proc Natl Acad Sci U S A.
82
1985
8624
8628

Author notes

Sharon L. Silins, Queensland Institute of Medical Research, PO Box Royal Brisbane Hospital, Australia 4029; e-mail:sharons@qimr.edu.au.