The recently discovered de novo methyltransferases DNMT3a and DNMT3b have been shown to be critical to embryonic development. However, at a single gene level, little is known about how the methylation pattern is established during development. The avian embryonic ρ-globin gene promoter is completely unmethylated in 4-day-old chicken embryonic erythroid cells, where it is expressed at a high level, and completely methylated in adult erythroid cells, where it is silent. The methylation pattern of the ρ-globin gene promoter, proximal transcribed region, and distal transcribed region on both DNA strands was examined during development in chicken erythroid cells. It was found that de novo methylation targets the CpG-dense proximal transcribed region on the coding (top) strand initially, followed by spreading into the 3′ region and into the promoter region. Methylation of the template (bottom) strand lags behind that of the coding strand, and complete methylation of both strands occurs only after the gene has been silenced. The results of the study indicate that establishment of the de novo methylation pattern involves strand-specificity and methylation spreading.

DNA methylation in eukaryotes involves addition of a methyl group to the carbon 5 position of the cytosine ring. This reaction is catalyzed by DNA methyltransferase in the context of the sequence 5′-CG-3′, which is also referred to as a CpG dinucleotide.1 Eukaryotic genomes are not methylated uniformly but contain methylated regions interspersed with unmethylated domains.2 Approximately 70% to 80% of the CpG residues in most vertebrates are methylated.3 In contrast to the rest of the genome, smaller regions of DNA called CpG islands are unmethylated and possess the expected CpG frequency.4,5During early development a dramatic reduction in methylation levels occurs in the preimplantation embryo.6 This is followed by a wave of de novo methylation involving most CpG residues. However, CpG island–associated promoter regions are protected from methylation by mechanisms which remain unclear.7 The methylation profile of genes in the adult is stable over many cell generations. Genomic methylation patterns are conserved after DNA replication by the DNA methyltransferase Dnmt1, which is the major maintenance methyltransferase.8 Dnmt1 is recruited to replicating DNA to reproduce the methylation pattern of the parental strands in the daughter strands.9 Inactivation of the mouseDnmt1 gene by gene targeting resulted in extensive demethylation of all sequences examined.10,11 However, ES cells completely lacking Dnmt1 were still capable of methylating retroviral DNA de novo.11 The search for the de novo methyltransferases led to the discovery of Dnmt3aand Dnmt3b.12 These were found to be essential for de novo methylation and for mouse development.13However, it remains unclear how de novo methylation patterns are established during development, over what time intervals these changes occur, or if this process involves any strand- or sequence-specificity.

A recent study examined the methylation profile of the mouse skeletalα-actin promoter during development and differentiation.14 It was found that remethylation of theα-actin promoter after implantation occurs in a stochastic pattern, with some molecules being extensively methylated and others sparsely methylated. It was also found that tissue-specific expression of the skeletal α-actin gene did not correlate with the methylation state of the promoter. In contrast, we have previously shown that every cytosine within each CpG dinucleotide in a 235–base pair (bp) region of the embryonic ρ-globin gene promoter is methylated in normal adult (definitive) erythroid cells in which the gene is silent and completely unmethylated in 5-day (primitive) erythroid cells in which the gene is actively transcribed.15 Other studies have also demonstrated a strong inverse correlation between the methylation status of DNA sequences near globin genes and the transcriptional activity of these genes in different tissues.16-18 To understand the de novo methylation of theρ-globin gene, we have examined the strand-specific methylation pattern of the ρ-globin gene promoter, proximal transcribed region, and distal transcribed region on both DNA strands during development in chicken erythroid cells.

Blood collection

Eggs were purchased from Truslow Farms (Chestertown, MD) and incubated in a Lyon Roll-X Automatic Incubator (Lyon Electric, Chula Vista, CA) according to the manufacturer's instructions. Blood was collected with a sterile Pasteur pipette into room temperature phosphate buffered saline (PBS), washed twice with PBS, and spun at 320g for 5 minutes. Red blood cells (RBCs) were then resuspended in PBS and spun for 5 minutes at 720g to pellet cells.

RNA/DNA purification

Cells were resuspended in 10 volumes of RNA STAT-60 (Tel-Test, Friendswood, TX) and RNA and DNA were extracted according to the manufacturer's protocol. Briefly, cells were homogenized then the lysate was extracted with chloroform and the RNA was precipitated with isopropanol. DNA was precipitated with ethanol from the organic phase left over from the chloroform extraction, the pellet was washed 3 times with 100 mM sodium citrate in 10% ethanol then precipitated with ethanol and solubilized in 8 mM sodium hydroxide.

Reverse transcriptase–polymerase chain reaction

Reverse transcriptase–polymerase chain reaction (RT-PCR) was carried out using the Titan One-Tube RT-PCR System (Roche Molecular Biochemicals, Alameda, CA) as per the manufacturer's instructions.

Bisulfite conversion and methylation analysis

Bisulfite conversion and methylation analysis was carried out as previously described.15 The same template was used for methylation analysis of different regions of the ρ-globingene on both DNA strands. Sequencing of the PCR-amplified product was performed using the forward and reverse primers. The α-33P–labeled ddNTP terminator kit (United States Biochemical, Cleveland, OH) was used for sequencing. The sequencing gel was dried and exposed to a phosphorimager screen (Packard Instrument, Meriden, CT). Methylation analysis was carried out by quantitating the intensity of C and T bands using optiquant software (Packard Instrument), and calculating the percentage of C/C + T bands. At least 4 CpG sites were analyzed in each region and standard error of mean was calculated. The same sites were used for methylation analysis on the other DNA strand.

Primer sequences

See Table 1 for primer sequences for RT-PCR and bisulfite genomic sequencing.

Table 1.

Primer sequences for RT-PCR and bisulfite genomic sequencing

ForwardReverseProduct size
RT-PCR    
ρ-globin GCTCTGAGTGCTCCCACAGCCGC CACACTGTGTCCTGCTCTGGGAGC 508 
βA-globin CACGGGAGCAAGAGCCCAGACCTC GTTGTAGGTGCTCCGTGATCTTTG 540 
β-actin CGCTCGTTGTTGACAATGGCTC CCAGTTGGTGACAATACCGTGTTC 216 
Bisulfite PCR, top strand    
 Promoter TGTAGGGGTGTTTTGTGTAAG CTATAAAAACACTCAAAACTTAAAAC 263 
 Exon 1 GGGGTGGGGAGGAGTTGTTAG AAATTATCAAAAAACCTCTAAATCCA 348 
 Exon 3 AGAAAGTAGGTGGGAGATAATGTAAGG TTTTATTAACTTTCACACTATATCCTACTC 358 
Bisulfite PCR, bottom strand    
 Promoter GTTGTGGGAGTATTTAGAGTTTGGAG CTTCTACAAAAATACTCTATACAAAAC 271 
 Exon 1 GTTATTAAAGAATTTTTGGGTTTAGGG CTCCAAACTCTAAATACTCCCACAAC 291 
 Exon 3 ATATTGTGTTTTGTTTTGGGAGTTTAGTGG AAACAAAAAATACTCCACACCTTACTTACC 207 
ForwardReverseProduct size
RT-PCR    
ρ-globin GCTCTGAGTGCTCCCACAGCCGC CACACTGTGTCCTGCTCTGGGAGC 508 
βA-globin CACGGGAGCAAGAGCCCAGACCTC GTTGTAGGTGCTCCGTGATCTTTG 540 
β-actin CGCTCGTTGTTGACAATGGCTC CCAGTTGGTGACAATACCGTGTTC 216 
Bisulfite PCR, top strand    
 Promoter TGTAGGGGTGTTTTGTGTAAG CTATAAAAACACTCAAAACTTAAAAC 263 
 Exon 1 GGGGTGGGGAGGAGTTGTTAG AAATTATCAAAAAACCTCTAAATCCA 348 
 Exon 3 AGAAAGTAGGTGGGAGATAATGTAAGG TTTTATTAACTTTCACACTATATCCTACTC 358 
Bisulfite PCR, bottom strand    
 Promoter GTTGTGGGAGTATTTAGAGTTTGGAG CTTCTACAAAAATACTCTATACAAAAC 271 
 Exon 1 GTTATTAAAGAATTTTTGGGTTTAGGG CTCCAAACTCTAAATACTCCCACAAC 291 
 Exon 3 ATATTGTGTTTTGTTTTGGGAGTTTAGTGG AAACAAAAAATACTCCACACCTTACTTACC 207 

RT-PCR indicates reverse transcriptase–polymerase chain reaction.

We examined the expression of avian β-type embryonicρ-globin and adult βA-globinduring development in primary erythroid cells using RT-PCR.ρ-globin mRNA is easily detected in 4-day to 5-day primitive embryonic erythroid cells but is barely detectable by day 11 of embryonic development (Figure 1). In contrast, the βA-globin starts expressing day 5 to day 6 and continues through adult life. These results are consistent with the earlier studies that examined the expression of avian β-type globin genes during development in erythroid cells.19,20 

Fig. 1.

Expression of ρ- andβA-globin genes during development in chicken erythroid cells.

RNA (10 ng) was used for RT-PCR analysis. Lane C indicates control lane with no template. For the loading control and RNA integrity, RT-PCR analysis was carried out with β-actin primers.

Fig. 1.

Expression of ρ- andβA-globin genes during development in chicken erythroid cells.

RNA (10 ng) was used for RT-PCR analysis. Lane C indicates control lane with no template. For the loading control and RNA integrity, RT-PCR analysis was carried out with β-actin primers.

Close modal

We have previously shown that the ρ-globin gene promoter is completely unmethylated in primitive erythroid cells and completely methylated in erythroid cells from adult chickens.15 To elucidate the strand- and sequence-specificity of DNA methylation of the ρ-globin gene during development, we employed the bisulfite genomic sequencing method.1,21 This technique is based on bisulfite-induced oxidative deamination of genomic DNA under conditions in which cytosine is converted to uracil and 5 mC remains unchanged. The target sequence is amplified by PCR using strand-specific primers. Upon sequencing of the amplified DNA, all uracil and thymine residues become detectable as thymine and only 5 mC residues amplify as cytosines. Unlike restriction enzyme–based techniques, bisulfite genomic sequencing also permits an independent methylation analysis of the 2 strands of DNA in a given sequence. DNA strands are no longer complementary after bisulfite treatment because of the conversion of unmethylated cytosines to uracils. The 2 strands were amplified separately with strand-specific primers. These primers amplify bisulfite-treated DNA irrespective of the methylation pattern of the CpG dinucleotides. Methylation analysis was carried out independently for the 2 strands using the same bisulfite-treated genomic DNA as a template. The percentage methylation refers to the overall methylation pattern of the CpG dinucleotides in the genomic DNA derived from red cells of several dozen chicken embryos.

We determined the temporal methylation pattern on both DNA strands of 3 different regions of the ρ-globin gene (ie, promoter, proximal transcribed region or exon 1, and distal transcribed region or exon 3) during development in primary erythroid cells. The promoter and proximal transcribed regions are CpG dense and constitute a CpG island, whereas the distal transcribed region has normal CpG density (Figure2).

Fig. 2.

CpG dinucleotides in the chicken ρ-globin gene.

The arrow indicates the transcription start site. The methylation pattern on both DNA strands was determined in regions indicated by letters a (promoter), b (proximal transcribed region or exon 1) and c (distal transcribed region or exon 3).

Fig. 2.

CpG dinucleotides in the chicken ρ-globin gene.

The arrow indicates the transcription start site. The methylation pattern on both DNA strands was determined in regions indicated by letters a (promoter), b (proximal transcribed region or exon 1) and c (distal transcribed region or exon 3).

Close modal

The CpG dinucleotides in the distal transcribed region are completely unmethylated on both DNA strands until day 5 (Figure3 and Figure 6C). Methylation progresses on both strands in a similar fashion and is complete in DNA from adult erythroid cells. We next examined the methylation pattern of the proximal transcribed region (exon 1). Interestingly, methylation starts in this region as early as day 5, but methylation of the template strand lags behind that of the coding strand by almost 48 hours (Figure4 and Figure 6B). As a control, fully unmethylated DNA from 4-day-old chicken embryonic erythroid cells was mixed with fully methylated DNA from adult erythroid cells in varying proportions, and methylation analysis of the proximal transcribed region was carried out. Methylation percentages were similar on 2 DNA strands in these samples (data not shown). Next, we examined the methylation pattern of the ρ-globin gene promoter region. The template and coding strands become methylated in a similar fashion (Figure 6A). However, methylation of the promoter lags as compared with the pattern observed in the proximal transcribed and distal transcribed regions (Figure 6D). To exclude PCR bias, theρ-globin promoter and exon 1 regions were amplified with a single set of primers using bisulfite-treated DNA from day 8 erythroid cells as a template. As shown in Figure5, the proximal transcribed region is methylated to a greater degree than the promoter region and these results are consistent with the methylation pattern observed for individually amplified regions (Figure6).

Fig. 3.

Illustration of bisulfite genomic sequencing of the coding strand (exon 3) of the ρ-globin gene.

Arrows indicate cytosine residues at CpG dinucleotides. These cytosines have been completely converted to thymidines (indicating unmethylated cytosines) in DNA from day 4 embryonic erythroid cells. Progressive failure of conversion to thymidines (indicative of methylation) is seen during development, and DNA derived from adult erythroid cells show completely methylated cytosines. Cytosine residues not associated with CpG dinucleotides (indicated by an asterisk) have been completely converted to thymidines in all samples.

Fig. 3.

Illustration of bisulfite genomic sequencing of the coding strand (exon 3) of the ρ-globin gene.

Arrows indicate cytosine residues at CpG dinucleotides. These cytosines have been completely converted to thymidines (indicating unmethylated cytosines) in DNA from day 4 embryonic erythroid cells. Progressive failure of conversion to thymidines (indicative of methylation) is seen during development, and DNA derived from adult erythroid cells show completely methylated cytosines. Cytosine residues not associated with CpG dinucleotides (indicated by an asterisk) have been completely converted to thymidines in all samples.

Close modal
Fig. 4.

Strand specificity of de novo methylation.

Methylation analysis of the proximal transcribed region of theρ-globin gene in day 5, day 6, and day 8 embryonic erythroid cells on both DNA strands. Methylation is seen on the coding (top) strand only in day 5 and day 6 erythroid cells. Arrows indicate cytosine residues at CpG dinucleotides. Positions indicated are relative to the transcription start site.

Fig. 4.

Strand specificity of de novo methylation.

Methylation analysis of the proximal transcribed region of theρ-globin gene in day 5, day 6, and day 8 embryonic erythroid cells on both DNA strands. Methylation is seen on the coding (top) strand only in day 5 and day 6 erythroid cells. Arrows indicate cytosine residues at CpG dinucleotides. Positions indicated are relative to the transcription start site.

Close modal
Fig. 5.

Methylation spreading.

The ρ-globin gene promoter and exon 1 (proximal transcribed) regions were amplified with a single set of primers with bisulfite-treated DNA from day 8 erythroid cells as a template. Positions indicated are relative to the transcription start site. Percentage methylation is indicated at CpG dinucleotides. Exon 1 is methylated to a greater degree as compared with the promoter region.

Fig. 5.

Methylation spreading.

The ρ-globin gene promoter and exon 1 (proximal transcribed) regions were amplified with a single set of primers with bisulfite-treated DNA from day 8 erythroid cells as a template. Positions indicated are relative to the transcription start site. Percentage methylation is indicated at CpG dinucleotides. Exon 1 is methylated to a greater degree as compared with the promoter region.

Close modal
Fig. 6.

Strand-specific methylation analysis of theρ-globin gene during development in chicken erythroid cells.

(A) Promoter, (B) exon 1 or proximal transcribed region, and (C) exon 3 or distal transcribed region. At least 4 CpG dinucleotides were quantitated for methylation. Error bars indicate the standard error of the mean. (D) Progressive methylation of the promoter (P), exon 1, and exon 3 regions on the coding (top) strand during development.

Fig. 6.

Strand-specific methylation analysis of theρ-globin gene during development in chicken erythroid cells.

(A) Promoter, (B) exon 1 or proximal transcribed region, and (C) exon 3 or distal transcribed region. At least 4 CpG dinucleotides were quantitated for methylation. Error bars indicate the standard error of the mean. (D) Progressive methylation of the promoter (P), exon 1, and exon 3 regions on the coding (top) strand during development.

Close modal

To determine if the changes seen in the methylation pattern originate in primitive erythroid cells or definitive erythroid cells, we cultured primary erythroid cells isolated from 4-day-old chicken embryos. Both RNA and DNA were isolated after 48 hours and 120 hours in culture. These cells continued to express ρ-globin and no expression of βA-globin was detected. Methylation analysis of the ρ-globin promoter region demonstrated no change (data not shown). These results suggest that the methylation changes observed in the ρ-globin gene originate in definitive erythroid cells.

This is the first study to report the strand-specific methylation pattern of a tissue-specific gene during development in primary erythroid cells. We report several interesting observations. The methylation pattern of the CpG-dense 5′ region and the CpG-poor 3′ region of the ρ-globin gene correlate inversely with stage-specific expression in primary avian erythroid cells. De novo methylation targets the CpG-dense proximal transcribed region on the coding (top) strand initially, followed by spread into the 3′ transcribed region and into the promoter region. Methylation of the template (bottom) strand lags behind that of the coding strand, and complete methylation of both strands occurs after the gene has been silenced. Our results indicate that establishment of the de novo methylation pattern involves strand-specificity and methylation spreading.

The distribution of methylated and unmethylated CpG dinucleotides in vertebrates conforms to a generalized pattern. About 70% to 80% of CpG sites contain methylated cytosines.3 Promoter region CpG islands are usually unmethylated in all normal tissues, regardless of the transcriptional activity of the gene.1,5 The main exceptions include nontranscribed genes on the inactive X-chromosome and silenced alleles of imprinted genes.1,5 Recently, methylation has been proposed as the primary control mechanism for certain germ-line–specific genes with CpG-rich promoters.22 Here we show that, in the case of the developmentally regulated ρ-globin gene, methylation of both the CpG-dense (promoter and proximal transcribed region) and CpG-poor (distal transcribed region) regions correlate inversely with the stage-specific expression in avian erythroid cells.

Hemi-methylation in the DNA of eukaryotic cells has been reported for the human LINE-1 (L1) retrotransposon family,23 integrated adenovirus in a mammalian cell line,24 and in plant DNA.25 In erythroid cells from day 5 and day 6 chicken embryos, methylation of the promoter and proximal transcribed regions was detected only on the coding strand. This strand-specific methylation pattern is of interest and has not been previously described during development. This pattern is in contrast to the pattern observed for maintenance methylation, where a tight coordination of DNA methylation and replication has been shown.26 Synthesis of embryonic globin chains in definitive erythroid cells has been shown to decrease with ontogeny.27 It is possible that in early definitive erythroid cell progenitors transcription through theρ-globin gene prevents methylation of the template strand. With maturation, changes in the balance of positive and negativetrans-acting factors results in silencing ofρ-globin gene transcription. This would then allow the methyltransferases to gain access to the template strand. With successive cell divisions, CpG dinucleotides in theρ-globin gene may then become completely methylated. In the case of an integrated adenovirus in a mammalian cell line, a few 5′-CG-3′ sequences can remain hemi-methylated for several cell generations before methylation involves both strands.24Our results suggest that a similar phenomenon may exist for de novo methylation of a tissue-specific gene during normal embryonic development.

Recent studies have suggested that strand-specific methylation could be important in the understanding of molecular mechanisms targeting DNA methylation. A zinc finger protein, CCCTC-binding factor (CTCF) mediates methylation-sensitive enhancer-blocking activity at the H19/Igf2 locus.28,29 Interestingly, methylation of the top but not the bottom strand of radiolabeled oligonucleotide probes derived from mouse and human imprint control regions inhibited CTCF binding, indicating that CTCF makes important contacts with some of the cytosine residues on the top DNA strand.29 Four (MeCP2, MBD1, MBD2, and MBD3) of the 5 known proteins with methyl-CpG–binding domain are implicated in transcriptional repression.8 MBD2 and MBD3 form homo- and hetero-dimers (or multimers) in vitro and in vivo. Significantly, the MBD2-MBD3 complex showed an affinity to hemi-methylated DNA.30 

The endogenous targets for de novo methylation in the vertebrate genome remain to be determined. A previous study with transgenic mice has shown that the bacterial lacI gene acts as a target for de novo methylation. When the GC content of this transgene was decreased to more closely resemble the GC content in mammalian cells, without altering the encoded amino acid sequence, methylation of the transgene was significantly reduced.31 It has been proposed that clustering of CpG sites may act as a target for de novo methylation.31,32 Our results are consistent with this hypothesis since methylation initiates in the CpG-dense proximal transcribed region of the ρ-globin gene. However, other sequence targets for de novo methylation also exist. The tandem B1 repetitive elements located in a methylation center upstream of the mouse adenine phosphoribosyltransferase (Aprt) gene were shown to be targets for de novo methylation.33 Further, the human Alu repetitive elements are methylated at high levels in somatic cells.34,35 

The spreading of methylation from the foci of methylated CpG sites has been demonstrated in vitro in cultured cells and in transgenic mice.24,32,36-38 Methylation spreading has also been observed to occur as a function of aging and neoplasia.39,40 In the colon, methylation of theMYOD1 CpG island increases progressively with age.MYOD1 methylation is very common in tumors and can be easily detected in adjacent, normal-appearing mucosa. The most CpG-dense area of MYOD1 corresponds to exon 1 of the gene. Interestingly, age-related methylation is more prominent there than in the promoter region, suggesting that methylation initiates in the exon 1 region and progressively spreads upstream to involve the promoter.41Bender et al examined the kinetics of remethylation of thep16 promoter and second-exon CpG islands in T24 cells after 5-aza-2′-deoxycytidine (5-Aza-CdR) treatment.42 Thep16 exon 2 CpG island became remethylated more rapidly than the p16 promoter CpG island after drug treatment. Consistent with these studies, we found that methylation of theρ-globin gene during development initiates in the proximal transcribed region, followed by spreading into the distal transcribed region and finally into the promoter. Our results suggest that establishment of a de novo methylation pattern of a tissue-specific gene during normal embryonic development also involves methylation spreading. It is possible that in early definitive erythroid cell progenitors, protein-DNA interactions within the ρ-globingene promoter interfered with methylation of this region. With maturation, loss of trans-acting factors makes this region accessible to the methyltransferases. This hypothesis is consistent with earlier studies. Mutagenesis of Sp1 sites in the CpG islands of mouse and hamster Aprt promoters resulted in the de novo methylation of these sequences, implicating Sp1 elements in the prevention of methylation spreading.43,44 Macleod et al proposed that the presence of a functional promoter at the 5′ end of a CpG island maintains its methylation-free status.43Alternatively, it was proposed that protein-occupied Sp1 sites in the hamster Aprt promoter prevents methylation spreading by protecting CpGs from methylation.44 

Although complete methylation of the ρ-globin gene occurs after gene inactivation, other evidence suggests that it contributes to gene silencing in adult erythroid cells. Treatment of anemic chickens with 5-aza-CR and sodium-butyrate induces coexpression of the embryonicρ-globin gene in erythroid cells that express the adultβ-globin gene.45,46 Likewise, methylation of the ρ-globin gene promoter at the same sites that are methylated in vivo in adult erythroid cells blocks transcription in transfected primary erythroid cells.15 Methylation may therefore be one of several factors that contribute to globin gene switching, acting as a “lock-off” mechanism, but is not necessary for gene silencing.

In summary, we have shown that de novo methylation of an embryonic globin gene during stage-specific expression in primary erythroid cells involves strand specificity and methylation spreading from the proximal transcribed region. Whether this mechanism also applies to other developmentally regulated genes remains to be determined.

We thank Dr Gordon Ginder for useful discussions, advice, and for critical reading of the manuscript. We thank Dr Jean Pierre Issa for useful suggestions, and Dr Sidney Grimes and Dr Jonathan Glass for critical reading of the manuscript.

Supported by a Merit Review grant from the Department of Veterans Affairs, and funding from the Feist-Weiller Cancer Center (R.S.).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

1
Singal
R
Ginder
GD
DNA methylation.
Blood.
93
1999
4059
4070
2
Bird
AP
CpG-rich islands and the function of DNA methylation.
Nature.
321
1986
209
213
3
Bird
AP
Gene number, noise reduction and biological complexity [see comments].
Trends Genet.
11
1995
94
100
4
Antequera
F
Bird
A
CpG islands.
EXS.
64
1993
169
185
5
Cross
SH
Bird
AP
CpG islands and genes.
Curr Opin Genet Dev.
5
1995
309
314
6
Monk
M
Boubelik
M
Lehnert
S
Temporal and regional changes in DNA methylation in the embryonic, extraembryonic and germ cell lineages during mouse embryo development.
Dev.
99
1987
371
382
7
Kafri
T
Ariel
M
Brandeis
M
et al
Developmental pattern of gene-specific DNA methylation in the mouse embryo and germ line.
Genes Dev.
6
1992
705
714
8
Bird
AP
Wolffe
AP
Methylation-induced repression—belts, braces, and chromatin.
Cell.
99
1999
451
454
9
Leonhardt
H
Page
AW
Weier
HU
Bestor
TH
A targeting sequence directs DNA methyltransferase to sites of DNA replication in mammalian nuclei.
Cell.
71
1992
865
873
10
Li
E
Bestor
TH
Jaenisch
R
Targeted mutation of the DNA methyltransferase gene results in embryonic lethality.
Cell.
69
1992
915
926
11
Lei
H
Oh
SP
Okano
M
et al
De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells.
Dev.
122
1996
3195
3205
12
Okano
M
Xie
S
Li
E
Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases.
Nat Genet.
19
1998
219
220
13
Okano
M
Bell
DW
Haber
DA
Li
E
DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development.
Cell.
99
1999
247
257
14
Warnecke
PM
Clark
SJ
DNA methylation profile of the mouse skeletal alpha-actin promoter during development and differentiation.
Mol Cell Biol.
19
1999
164
172
15
Singal
R
Ferris
R
Little
JA
Wang
SZ
Ginder
GD
Methylation of the minimal promoter of an embryonic globin gene silences transcription in primary erythroid cells.
Proc Natl Acad Sci U S A.
94
1997
13724
13729
16
McGhee
JD
Ginder
GD
Specific DNA methylation sites in the vicinity of the chicken beta-globin genes.
Nature.
280
1979
419
420
17
Mavilio
F
Giampaolo
A
Care
A
et al
Molecular mechanisms of human hemoglobin switching: selective undermethylation and expression of globin genes in embryonic, fetal, and adult erythroblasts.
Proc Natl Acad Sci U S A.
80
1983
6907
6911
18
Shen
CK
Maniatis
T
Tissue-specific DNA methylation in a cluster of rabbit beta-like globin genes.
Proc Natl Acad Sci U S A.
77
1980
6634
6638
19
Brown
JL
Ingram
VM
Structural studies on chick embryonic hemoglobins.
J Biol Chem.
249
1974
3960
3972
20
Groudine
M
Peretz
M
Weintraub
H
Transcriptional regulation of hemoglobin switching in chicken embryos.
Mol Cell Biol.
1
1981
281
288
21
Frommer
M
McDonald
LE
Millar
DS
et al
A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands.
Proc Natl Acad Sci U S A.
89
1992
1827
1831
22
De Smet
C
Lurquin
C
Lethe
B
Martelange
V
Boon
T
DNA methylation is the primary silencing mechanism for a set of germ line- and tumor-specific genes with a CpG-rich promoter.
Mol Cell Biol.
19
1999
7327
7335
23
Woodcock
DM
Lawler
CB
Linsenmeyer
ME
Doherty
JP
Warren
WD
Asymmetric methylation in the hypermethylated CpG promoter region of the human L1 retrotransposon.
J Biol Chem.
272
1997
7810
7816
24
Toth
M
Muller
U
Doerfler
W
Establishment of de novo DNA methylation patterns: transcription factor binding and deoxycytidine methylation at CpG and non-CpG sequences in an integrated adenovirus promoter.
J Mol Biol.
214
1990
673
683
25
Ingelbrecht
I
Van Houdt
H
Van Montagu
M
Depicker
A
Posttranscriptional silencing of reporter transgenes in tobacco correlates with DNA methylation.
Proc Natl Acad Sci U S A.
91
1994
10502
10506
26
Araujo
FD
Knox
JD
Szyf
M
Price
GB
Zannis-Hadjopoulos
M
Concurrent replication and methylation at mammalian origins of replication.
Mol Cell Biol.
18
1998
3475
3482
27
Luo
HY
Liang
XL
Frye
C
et al
Embryonic hemoglobins are expressed in definitive cells.
Blood.
94
1999
359
361
28
Bell
AC
Felsenfeld
G
Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene.
Nature.
405
2000
482
485
29
Hark
AT
Schoenherr
CJ
Katz
DJ
Ingram
RS
Levorse
JM
Tilghman
SM
CTCF mediates methylation-sensitive enhancer-blocking activity at the H19/Igf2 locus [see comments].
Nature.
405
2000
486
489
30
Tatematsu
KI
Yamazaki
T
Ishikawa
F
MBD2-MBD3 complex binds to hemi-methylated DNA and forms a complex containing DNMT1 at the replication foci in late S phase.
Genes Cells.
5
2000
677
688
31
Scrable
H
Stambrook
PJ
Activation of the lac repressor in the transgenic mouse.
Genetics.
147
1997
297
304
32
Turker
MS
The establishment and maintenance of DNA methylation patterns in mouse somatic cells.
Semin Cancer Biol.
9
1999
329
337
33
Yates
PA
Burman
RW
Mummaneni
P
Krussel
S
Turker
MS
Tandem B1 elements located in a mouse methylation center provide a target for de novo DNA methylation.
J Biol Chem.
274
1999
36357
36361
34
Kochanek
S
Renz
D
Doerfler
W
DNA methylation in the Alu sequences of diploid and haploid primary human cells.
Embo J.
12
1993
1141
1151
35
Hellmann-Blumberg
U
Hintz
MF
Gatewood
JM
Schmid
CW
Developmental differences in methylation of human Alu repeats.
Mol Cell Biol.
13
1993
4523
4530
36
Tollefsbol
TO
Hutchison
CA
III
Control of methylation spreading in synthetic DNA sequences by the murine DNA methyltransferase.
J Mol Biol.
269
1997
494
504
37
Carotti
D
Funiciello
S
Palitti
F
Strom
R
Influence of pre-existing methylation on the de novo activity of eukaryotic DNA methyltransferase.
Biochem.
37
1998
1101
1108
38
Lindsay
H
Adams
RL
Spreading of methylation along DNA.
Biochem J.
320
1996
473
478
39
Baylin
SB
Herman
JG
Graff
JR
Vertino
PM
Issa
JP
Alterations in DNA methylation: a fundamental aspect of neoplasia.
Adv Cancer Res.
72
1998
141
196
40
Issa
JP
Aging, DNA methylation and cancer.
Crit Rev Oncol Hematol.
32
1999
31
43
41
Ahuja
N
Li
Q
Mohan
AL
Baylin
SB
Issa
JP
Aging and DNA methylation in colorectal mucosa and cancer.
Cancer Res.
58
1998
5489
5494
42
Bender
CM
Gonzalgo
ML
Gonzales
FA
Nguyen
CT
Robertson
KD
Jones
PA
Roles of cell division and gene transcription in the methylation of CpG islands.
Mol Cell Biol.
19
1999
6690
6698
43
Macleod
D
Charlton
J
Mullins
J
Bird
AP
Sp1 sites in the mouse aprt gene promoter are required to prevent methylation of the CpG island.
Genes Dev.
8
1994
2282
2292
44
Brandeis
M
Frank
D
Keshet
I
et al
Sp1 elements protect a CpG island from de novo methylation.
Nature.
371
1994
435
438
45
Ginder
GD
Whitters
MJ
Pohlman
JK
Activation of a chicken embryonic globin gene in adult erythroid cells by 5-azacytidine and sodium butyrate.
Proc Natl Acad Sci U S A.
81
1984
3954
3958
46
Burns
LJ
Glauber
JG
Ginder
GD
Butyrate induces selective transcriptional activation of a hypomethylated embryonic globin gene in adult erythroid cells.
Blood.
72
1988
1536
1542

Author notes

Rakesh Singal, Section of Hematology/Oncology, Overton Brooks VA Medical Center and Louisiana State University Health Sciences Center, 510 East Stoner Ave, 111-H, Shreveport, LA 71101-4295; e-mail: [email protected].

Sign in via your Institution