Immunoglobulin G (IgG) receptors (FcγRs) on myeloid cells are responsible for the internalization of immune complexes. Activation of the oxidase burst is an important component of the integrated cellular response mediated by Fc receptors. Previous work has demonstrated that, in interferon-γ–primed U937 cells, the high-affinity receptor for IgG, FcγRI, is coupled to a novel intracellular signaling pathway that involves the sequential activation of phospholipase D (PLD), sphingosine kinase, and calcium transients. Here, it is shown that both known PLD isozymes, PLD1 and PLD2, were present in these cells. With the use of antisense oligonucleotides to specifically reduce the expression of either isozyme, PLD1, but not PLD2, was found to be coupled to FcγRI activation and be required to mediate receptor activation of sphingosine kinase and calcium transients. In addition, coupling of FcγRI to activation of the nicotinamide adenine dinucleotide phosphate (reduced form) (NADPH) oxidase burst was inhibited by pretreating cells with 0.3% butan-1-ol, indicating an absolute requirement for PLD. Furthermore, use of antisense oligonucleotides to reduce expression of PLD1 or PLD2 demonstrated that PLD1 is required to couple FcγRI to the activation of NADPH oxidase and trafficking of internalized immune complexes for degradation. These studies demonstrate the critical role of PLD1 in the intracellular signaling cascades initiated by FcγRI and its functional role in coordinating the response to antigen-antibody complexes.

Receptors for the constant region (Fc) of immunoglobulins play a pivotal role linking the humoral and cellular arms of the immune system. On leukocytes, aggregation of receptors (FcγRs) for immunoglobulin G (IgG) leads to a number of cellular responses, including the internalization of immune complexes, release of proteases, activation of the respiratory burst, and release of cytokines. Receptor aggregation can ultimately lead to targeted cell killing through antibody-directed cellular cytotoxicity.1,2 These Fc receptors, therefore, play critical roles in host defense mechanisms against invading pathogens, in autoimmune diseases,3 and in cancer surveillance.4 We have recently reported that, in cytokine-primed U937 cells, aggregation of the high-affinity receptor for IgG (FcγRI)5 activates, through nonreceptor tyrosine kinases, a novel signaling pathway that involves the sequential activation of phospholipase D (PLD) and sphingosine kinase.6 This pathway is necessary for efficient intracellular trafficking of FcγRI-internalized immune complexes to lysosomes for degradation and release of calcium from intracellular stores.6 7 

Phosphatidylcholine-specific PLD (PC-PLD) catalyzes the hydrolysis of the terminal diester bond of phosphatidylcholine to liberate phosphatidic acid and choline.8 PC-PLD was first identified in plants but has subsequently been shown to be highly conserved across all species and present in large amounts in bacteria, yeast, and mammalian cells.9,10 In mammalian cells, activation of PC-PLD has been proposed to control signal transduction pathways regulating a wide range of physiological processes, including membrane trafficking and cytoskeletal reorganization,11-17 mitogenesis,18,19neuronal and cardiac stimulation,20,21phagocytosis,22 the respiratory burst in neutrophils,23,24 inflammation, and diabetes.25 

The immediate products of PLD hydrolysis of phosphatidylcholine are phosphatidic acid and choline.8 A role for phosphatidic acid as a key intracellular signaling molecule has been proposed as it has been shown to directly activate protein kinases,18,19,26,27 protein tyrosine phosphatase,28-30 phospholipase C,31phosphoinositol-4-kinase,32 sphingosine kinase,33 and small molecular weight guanosine triphosphatase–activating proteins.34 Phosphatidic acid has also been shown to promote the release of calcium from intracellular compartments35,36 and, in neutrophils, to activate the oxidative burst through nicotinamide adenine dinucleotide phosphate (reduced form) (NADPH) oxidase.24,27Phosphatidic acid itself can also act as a precursor for other intracellular signaling molecules. Thus, phosphatidic acid can be converted into diacyl glycerol (DAG) by phosphatidic acid–phosphohydrolase10,23 or to the mitogen lyso–phosphatidic acid (LPA) by phospholipase A2.10,23DAG is an established activator of conventional and novel protein kinase C (PKC) isoforms37,38 and LPA, which, following release from cells, acts on G-protein–coupled receptors to further stimulate cells or adjacent cells.39 Phosphatidic acid can also be subject to acid hydrolases followed by lipo-oxygenase, leading to the formation of oxygen radicals and lipid peroxides that cause tissue damage.40 

In mammalian cells, 2 isoforms of PLD (PLD1 and PLD2) have been cloned, sequenced, and characterized.17,41,42 Furthermore, PLD1 is expressed as 2 splice variants, namely, PLD1a and PLD1b.43 Both PLD1 and PLD2 use phosphatidylcholine as substrate. In previous studies, we have shown that coupling of FcγRI to PLD activation results in activation of sphingosine kinase6 7 and calcium transients. However, in these previous studies, the nature of the PLD isozyme activated by FcγRI was not defined, and the relationship of the activation of PLD to the various signaling enzyme cascades following FcγRI aggregation was unknown.

Here, we demonstrate that coupling of FcγRI to NADPH oxidase has an absolute requirement on the activation of PLD. Although both isozymes of PLD (PLD1 and PLD2) are present in U937 cells, only PLD1, but not PLD2, functionally couples FcγRI to intracellular effectors, such as the activation of sphingosine kinase and cytosolic calcium transients. PLD1, but not PLD2, is also required for FcγRI-mediated activation of the oxidative burst and trafficking of immune complexes.

Cell culture

U937 cells were cultured in RPMI 1640 (Gibco, Rockville, MD) supplemented with 10% fetal calf serum (FCS), 2 mM glutamine, 10 U/mL penicillin, and 10 μg/mL streptomycin at 37°C in 6.8% carbon dioxide in a water-saturated atmosphere. The cells were treated with interferon (IFN)–γ (200 ng/mL) (Bender Wien, Vienna, Austria) for 16 hours. Antisense oligonucleotides were purchased from Oswell DNA Service (Southampton, United Kingdom); 24-mers were synthesized and capped at either end by the phosphothiorate linkages (first 2 and last 2 linkages); these 24-mers corresponded to the reverse complement of the first 8 amino acids for either PLD1 or PLD2. The sequences of the oligonucleotides were as follows: 5′CCGTGGCTCGTTTTTCAGTGACAT3′ for PLD1 and 5′GAGGCTCTCAGGGGTCGCCGTCAT3′ for PLD2. Cells were incubated in 10 μM oligonucleotide for a total of 36 hours (20 hours prior to, and then for the duration of culture with IFN-γ).

Reverse-transcriptase–polymerase chain reaction

Cells were either primed with IFN-γ or differentiated to a macrophage phenotype with dibutyryl cyclic adenosine monophosphate (dbcAMP)6 and messenger RNA (mRNA)–isolated (Quiagen midi kit for mRNA extraction). Specific forward and reverse primers were designed for either PLD1 or PLD2: PLD1 forward, GTGGGCTCACCATGAGAAGC; PLD1 reverse, GCAATGTCATGCCAGGGCATC; PLD2 forward, CTGCACTTTACTTACAGGACCCTG; and PLD2 reverse, CTGCTCATAGATATTGGCGTTGC.

The PLD1 primers were designed against an overlapping region in the sequence of both PLD1 isoforms to yield a fragment of approximate 640 base pairs (bp) for PLD1a and another fragment of approximate 520 bp for PLD1b.43 Specific primers designed for PLD2 would yield a 450-bp fragment. The reaction was carried out as described previously.43 

Receptor aggregation

Cells were harvested by centrifugation and then incubated at 4°C for 45 minutes with 1 μM human monomeric IgG (Serotec, Oxford, United Kingdom) to occupy surface FcγRI in the presence or absence of inhibitors or alcohols. Excess unbound ligand was removed by dilution and centrifugation of the cells. Cells were resuspended in ice-cold RPMI 1640/10 mM Hepes/0.1% bovine serum albumin (BSA) (RHB medium), and surface immune complexes were formed by incubating with cross-linking antibody (sheep antihuman IgG; 1:50) in the continued presence of inhibitors or alcohols. Cells were then warmed to 37°C for the times specified in each assay as described previously.44 45 

Immunoprecipitation of PLDs

PLD1 and PLD2 were immunoprecipitated from cell lysates prior to Western blot analysis of the desired proteins. Rabbit polyclonal antibody (2 μg), either anti-PLD1 or anti-PLD2 (QCB, Hopkinton, MA), were incubated with 50 μL 50% protein A-agarose and 450 μL buffer for 2 hours on a rocking platform at 4°C in order to form precipitating complexes. Then, the antibody–protein A–agarose mix was washed to remove unbound antibody. Following this, 500 μL cell lysate containing 200 μg protein was mixed with the precipitating (antibody–protein A–agarose) complex and placed in a tumbler at 4°C for 4 hours. Following incubation, the precipitating complex was centrifuged and washed prior to addition of Laemlli buffer for loading onto sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE).

Gel electrophoresis and Western blots

Proteins were resolved on 8% polyacrylamide gels (SDS-PAGE) under denaturing conditions and then transferred to 0.45-μm nitrocellulose membranes. After blocking overnight at 4°C with 5% nonfat milk in Tris-buffered saline and 0.1% Tween 20 and washing, the membranes were incubated with the relevant antibodies for 4 hours at room temperature. The membranes were washed extensively in the washing buffer and bands visualized by means of the appropriate horseradish peroxidase–conjugated secondary antibody and ECL Western Blotting Detection System (Amersham, Buckinghamshire, United Kingdom).

Measurement of phospholipase D activity

PLD activity was measured as previously described in Melendez et al,7 by means of the transphosphatidylation assay. Briefly, U937 cells were labeled (106 cells/mL) with [3H] palmitic acid (5 μCi/mL [185 kBq/mL]) (Amersham) in the cell culture medium for 16 hours. Following washing, the cells were incubated at 37°C for 15 minutes in RHB medium containing butan-1-ol (0.3% final). Following FcγRI aggregation, cells were incubated for a further 30 minutes and then extracted by Bligh-Dyer phase separation. The accumulated phosphatidylbutanol was assayed as described previously.7 

Measurement of rate of trafficking of immune complexes

Trafficking of immune complexes was measured with a protocol similar to that used in previous studies.44,45 FcγRI was aggregated as described above, but surface immune complexes were formed by using radiolabeled cross-linking antibody ([125I]-rabbit antihuman IgG; 1:50) (R&D Systems, Abington, United Kingdom). Supernatant trichloroacetic acid (TCA)–soluble counts were measured to provide the rate of intracellular trafficking.45 46 The results were expressed as a percentage of the total cell surface counts at time zero.

Oxidase assays

Whole cell superoxide production following FcγRI aggregation or N-formyl-1-methionyl-1-leucyl-1-phenylalamine (f-MLP) stimulation was measured in IFN-γ–primed U937 cells, pretreated or not with butan-1-ol, butan-2-ol, or antisense oligonucleotides for PLD1 or PLD2.

Cells were assayed in RPMI–1% FCS without phenol red placed in a 96-well plate. For each well, 200 000 cells suspended in 80 μL were mixed with 20 μL luminol-based substrate (Diogenes, National Diagnostics, Atlanta, GA) at the same time as the cross-linking antibody, or f-MLP (1 μM). Luminescence was measured with a luminometer (Wallac 1420 Multilabel counter, Cambridge, United Kingdom).

Cytosolic calcium assays

Cytosolic calcium was measured as described previously except the cuvette buffer was calcium supplemented (final concentration, 1.5 mM Ca++).7 Briefly, cells were loaded with 1 μg/mL Fura-2–AM (Molecular Probes, Leiden, The Netherlands) and 1 μM human monomeric IgG (Serotec) in phosphate-buffered saline (PBS), 1.5 mM Ca++, and 1% BSA. After removal of excess reagents by dilution and centrifugation, the cells were resuspended in 1.5 mM calcium-supplemented PBS and warmed to 37°C in the cuvette. Cell surface–bound IgG was aggregated by the addition of goat anti–human IgG (1:50 dilution) (Sigma, Poole, United Kingdom). Fluorescence was measured at 340 and 380 nm, and the background-corrected 340:380 ratio was calibrated as previously described.6 

Sphingosine kinase assays

Activation of sphingosine kinase was measured as described previously.7 33 Briefly, cells were resuspended in ice-cold 0.1 M phosphate buffer (pH 7.4) containing 20% glycerol, 1 mM mercaptoethanol, 1 mM EDTA, phosphatase inhibitors (20 mM ZnCL2, 1 mM sodium orthovanadate, and 15 mM sodium fluoride), protease inhibitors (10 μg/mL leupeptin, 10 μg/mL aprotinin, and 1 mM phenylmethyl sulfonyl fluoride), and 0.5 mM 4-deoxypyridoxine, disrupted by freeze-thawing and centrifuged at 105 000g for 90 minutes at 4°C. Supernatants were assayed for sphingosine kinase activity by incubating with sphingosine (Sigma) and [γ32P]–adenosine triphosphate (2 μCi, 5 mM [74 kBq]) for 30 minutes at 37°C, and products were separated by thin-layer chromatography on silica gel G60 (Whatman, Maidstone, United Kingdom) by means of chloroform/methanol/acetic acid/water (90:90:15:6) and visualized by autoradiography. The radioactive spots corresponding to sphingosine phosphate were scraped and counted in a scintillation counter. The activity of sphingosine kinase following in vitro activation by phosphatidic acid was measured in cell lysates by addition of L-α-phosphatidic acid (1,2-diacyl-sn-glycero-3-phosphate) (Sigma Aldrich, Paris, France) at 10 mol 1% Triton X-100.

Both PLD1 and PLD2 are expressed in U937 cells, but only PLD1 is coupled to FcγRI activation

PLD expression profiles in the human monocytic cell line U937.

The isozymes of PLD expressed in U937 cells were determined by means of reverse-transcriptase–polymerase chain reaction (RT-PCR), Northern analysis, and Western analysis. Relative levels of expression were compared in untreated cells, cytokine (IFN-γ)–primed cells, and cells differentiated to a macrophage phenotype by means of dbcAMP.47 

RT-PCR analysis of mRNAs extracted from untreated, IFN-γ–primed or dbcAMP-differentiated cells revealed that both known PLD isozymes, PLD1 and PLD2, were present. In addition, both splice variants of PLD1 (PLD1a and PLD1b) were present.43 The profile of the RT-PCR products was not altered by treating cells with IFN-γ or following differentiation (Figure 1A). At the protein level, Western blot analysis of immunoprecipitated PLDs revealed immunoreactive bands corresponding to the predicted molecular weights for PLD1a, PLD1b, and PLD2. The PLD expression profile did not alter following priming of cells with IFN-γ or cell differentiation by dbcAMP (Figure 1B).

Fig. 1.

PLD expression profiles in U937 cells.

(A) RT-PCR was performed with mRNA extracted from untreated, IFN-γ–primed and dbcAMP-differentiated U937 cells. Specific primers for PLD1 (which yield 2 fragments corresponding to PLD1a, 640bp, and PLD1b, 520bp) and primers specific for PLD2 amplifying a 450-bp fragment, were used. The results shown are typical from 3 separate experiments. (B) Western blot analysis of immunoprecipitates of PLD1 or PLD2, from cell lysates from untreated, IFN-γ–primed and dbcAMP-differentiated U937 cells, were resolved by SDS/PAGE 8% polyacrylamide gels. Proteins were transferred to nitrocellulose and probed with anti-PLD1 or anti-PLD2 antibodies. The results shown are typical from 3 separate experiments. Mw indicates molecular weight.

Fig. 1.

PLD expression profiles in U937 cells.

(A) RT-PCR was performed with mRNA extracted from untreated, IFN-γ–primed and dbcAMP-differentiated U937 cells. Specific primers for PLD1 (which yield 2 fragments corresponding to PLD1a, 640bp, and PLD1b, 520bp) and primers specific for PLD2 amplifying a 450-bp fragment, were used. The results shown are typical from 3 separate experiments. (B) Western blot analysis of immunoprecipitates of PLD1 or PLD2, from cell lysates from untreated, IFN-γ–primed and dbcAMP-differentiated U937 cells, were resolved by SDS/PAGE 8% polyacrylamide gels. Proteins were transferred to nitrocellulose and probed with anti-PLD1 or anti-PLD2 antibodies. The results shown are typical from 3 separate experiments. Mw indicates molecular weight.

Close modal

FcγRI aggregation stimulates PLD1.

As both isozymes for PLD are expressed in U937 cells, experiments were performed to examine their respective roles, in particular, their activities following FcγRI aggregation. For this purpose, specific antisense oligonucleotides were designed against each of the PLD isozymes to specifically knock down the expression of each enzyme (ie, antisense to PLD1 and antisense to PLD2). We have previously shown that U937 cells are sensitive to antisense manipulation.6 48IFN-γ–primed cells were treated with 1 of the 2 antisense oligonucleotides, and PLD activity was assayed in unstimulated cells to measure basal levels of activity or after stimulation with either FcγRI activation by immune complexes or with phorbolmyristate acetate (PMA) treatment (PMA was used as control). The specificity of the antisense oligonucleotides on relative PLD isozyme expression was checked by Western analysis (Figure2A). Thus, in cells treated with antisense to PLD1, there was a reduction in PLD1 immunoreactivity whereas PLD2 immunoreactivity was unaffected. Conversely, in cells treated with antisense to PLD2, there was a reduction in PLD2 immunoreactivity whereas PLD1 immunoreactivity remained unchanged. Each antisense oligonucleotide, therefore, acted as an internal control for the other.

Fig. 2.

Use of antisense oligonucleotides to reduce specific expression of either PLD1 or PLD2 demonstrates that only PLD1 is coupled to FcγRI aggregation.

(A) Western blot analysis of immunoprecipitates of either PLD1 or PLD2 to assess expression of either isozyme in IFN-γ–primed U937 cells following treatment for 36 hours with antisense oligonucleotides (10 μM) specific for either PLD1 (a.s.PLD1) or PLD2 (a.s.PLD2), and control cells (control). The results shown are typical from 3 separate experiments. (B) PLD activity following FcγRI aggregation in IFN-γ–primed U937 cells pretreated with 10 μM antisense oligonucleotides for either PLD1 (a.s.PLD1) or PLD2 (a.s.PLD2). 1. Basal level (basal control); 2. FcγRI aggregation (XL control); 3. basal level in cells pretreated with antisense PLD1 (basal a.s.PLD1); 4. FcγRI aggregation in cells pretreated with antisense PLD1 (XL a.s.PLD1); 5. basal level in cells pretreated with antisense PLD2 (basal a.s.PLD2); 6. FcγRI aggregation in cells pretreated with antisense PLD2 (XL a.s.PLD2). Results are the mean ± SD for triplicate measurements and are representative of the results from 3 separate experiments. PtdBut indicates phosphatidylbutanol. (C) PLD activity following PMA stimulation (1 μM) in IFN-γ–primed U937 cells pretreated with antisense oligonucleotides (10 μM) for either PLD1 (a.s.PLD1) or PLD2 (a.s.PLD2). 1. Basal level (basal control); 2. PMA stimulation (PMA control); 3. basal level in cells pretreated with antisense PLD1 (basal a.s.PLD1); 4. PMA stimulation in cells pretreated with antisense PLD1 (PMA a.s.PLD1); 5. basal level in cells pretreated with antisense PLD2 (basal a.s.PLD2); 6. PMA stimulation in cells pretreated with antisense PLD2 (PMA a.s.PLD2). Results are the mean ± SD for triplicate measurements and are representative of the results from at least 3 separate experiments. Tot. indicates total.

Fig. 2.

Use of antisense oligonucleotides to reduce specific expression of either PLD1 or PLD2 demonstrates that only PLD1 is coupled to FcγRI aggregation.

(A) Western blot analysis of immunoprecipitates of either PLD1 or PLD2 to assess expression of either isozyme in IFN-γ–primed U937 cells following treatment for 36 hours with antisense oligonucleotides (10 μM) specific for either PLD1 (a.s.PLD1) or PLD2 (a.s.PLD2), and control cells (control). The results shown are typical from 3 separate experiments. (B) PLD activity following FcγRI aggregation in IFN-γ–primed U937 cells pretreated with 10 μM antisense oligonucleotides for either PLD1 (a.s.PLD1) or PLD2 (a.s.PLD2). 1. Basal level (basal control); 2. FcγRI aggregation (XL control); 3. basal level in cells pretreated with antisense PLD1 (basal a.s.PLD1); 4. FcγRI aggregation in cells pretreated with antisense PLD1 (XL a.s.PLD1); 5. basal level in cells pretreated with antisense PLD2 (basal a.s.PLD2); 6. FcγRI aggregation in cells pretreated with antisense PLD2 (XL a.s.PLD2). Results are the mean ± SD for triplicate measurements and are representative of the results from 3 separate experiments. PtdBut indicates phosphatidylbutanol. (C) PLD activity following PMA stimulation (1 μM) in IFN-γ–primed U937 cells pretreated with antisense oligonucleotides (10 μM) for either PLD1 (a.s.PLD1) or PLD2 (a.s.PLD2). 1. Basal level (basal control); 2. PMA stimulation (PMA control); 3. basal level in cells pretreated with antisense PLD1 (basal a.s.PLD1); 4. PMA stimulation in cells pretreated with antisense PLD1 (PMA a.s.PLD1); 5. basal level in cells pretreated with antisense PLD2 (basal a.s.PLD2); 6. PMA stimulation in cells pretreated with antisense PLD2 (PMA a.s.PLD2). Results are the mean ± SD for triplicate measurements and are representative of the results from at least 3 separate experiments. Tot. indicates total.

Close modal

Treatment of cells with the antisense oligonucleotide to PLD1 resulted in no change in basal activity. However, following aggregation of FcγRI, the increase in PLD activity was significantly reduced compared with the control cells (P < .01) (Figure 2B). The reduction in the increase after FcγRI activation was 77% ± 8% in cells treated with antisense PLD1 compared with control cells and was proportional to the observed reduction in protein expression by Western analysis. In contrast, treatment of cells with the antisense oligonucleotide to PLD2 significantly reduced basal PLD activity (P < .01). FcγRI-mediated activation of PLD was marginally reduced in cells treated with the antisense to PLD2, but this reduction was entirely accounted for by the reduction in basal levels; the increment over the basal level was identical in control (untreated) cells and those pretreated with PLD2 antisense oligonucleotide (Figure 2B). In contrast to PLD activation by FcγRI, PLD activity stimulated by PMA was significantly reduced in cells pretreated with either of the 2 antisense oligonucleotides, indicating that PMA is able to stimulate both forms of PLD (Figure 2C). Thus, PMA-stimulated PLD activity was reduced by 50% ± 5% in cells pretreated with PLD1 antisense and by 33% ± 5% in cells pretreated with PLD2 antisense. A combination of treatment with both antisense oligonucleotides (PLD1 and PLD2) proved toxic to the cells.

These data demonstrate that PLD2 contributes to the basal, unstimulated PLD activity in these cells, whereas PLD1, but not PLD2, is coupled to FcγRI activation.

PLD1 but not PLD2 is required to couple FcγRI to intracellular signaling cascades

As the coupling of FcγRI to sphingosine kinase6 and cytosolic calcium transients6 7requires PLD activation, the nature of the isozyme involved in this coupling was investigated by means of antisense oligonucleotides to specifically downregulate either PLD1 or PLD2.

Previously, we have shown that aggregation of FcγRI in cytokine-primed cells results in PLD-dependent release of calcium from intracellular stores and subsequent cytosolic calcium transients.7 Here, the specific dependence for this response on PLD1 and not PLD2 is shown. Reduction in expression of PLD1 by pretreatment of cells with antisense PLD1 oligonucleotide resulted in an attenuation of peak cytosolic calcium spike observed after aggregation of FcγRI (Figure 3A). Reducing expression of PLD2 had no effect on the calcium transients compared with controls.

Fig. 3.

Coupling of FcγRI to downstream intracellular signaling pathways requires PLD1 and not PLD2.

(A) Intracellular cytosolic calcium changes following aggregation of FcγRI. Responses were compared in control cells and cells pretreated with antisense oligonucleotides (10 μM) to either PLD1 or PLD2. Traces shown are as follows: left, XL FcγRI control cells = FcγRI aggregation in IFN-γ–primed control cells; upper right panel, FcγRI aggregation in IFN-γ–primed cells pretreated with antisense to PLD1 (XL FcγRI a.s.PLD1); lower right panel, FcγRI aggregation in IFN-γ–primed cells pretreated with antisense to PLD2 (XL FcγRI a.s.PLD2). The arrow marks the addition of the goat antihuman IgG antibody to create cell surface immune complexes. Traces are typical from fura-2–loaded cells from 3 separate experiments. (B) FcγRI coupling to sphingosine kinase. Following aggregation of FcγRI in IFN-γ–primed U937 cells, cells were harvested at given time points to measure sphingosine kinase activity. Sphingosine kinase activity was assayed from basal control cells (basal control); following FcγRI aggregation in control cells (XL control) and in cells pretreated with antisense oligonucleotides (10 μM) for either PLD1 (XL a.s.PLD1) or PLD2 (XL a.s.PLD2). Lysates from these cells were treated with phosphatidic acid (L-α-phosphatidic acid (1,2-diacyl-sn-glycero-3-phosphate) in vitro to ensure sphingosine kinase activity (P.A.a.s.PLD1 and P.A.a.s.PLD2).33 Results are the mean ± SD for triplicate measurements and are representative of the results from at least 3 separate experiments.

Fig. 3.

Coupling of FcγRI to downstream intracellular signaling pathways requires PLD1 and not PLD2.

(A) Intracellular cytosolic calcium changes following aggregation of FcγRI. Responses were compared in control cells and cells pretreated with antisense oligonucleotides (10 μM) to either PLD1 or PLD2. Traces shown are as follows: left, XL FcγRI control cells = FcγRI aggregation in IFN-γ–primed control cells; upper right panel, FcγRI aggregation in IFN-γ–primed cells pretreated with antisense to PLD1 (XL FcγRI a.s.PLD1); lower right panel, FcγRI aggregation in IFN-γ–primed cells pretreated with antisense to PLD2 (XL FcγRI a.s.PLD2). The arrow marks the addition of the goat antihuman IgG antibody to create cell surface immune complexes. Traces are typical from fura-2–loaded cells from 3 separate experiments. (B) FcγRI coupling to sphingosine kinase. Following aggregation of FcγRI in IFN-γ–primed U937 cells, cells were harvested at given time points to measure sphingosine kinase activity. Sphingosine kinase activity was assayed from basal control cells (basal control); following FcγRI aggregation in control cells (XL control) and in cells pretreated with antisense oligonucleotides (10 μM) for either PLD1 (XL a.s.PLD1) or PLD2 (XL a.s.PLD2). Lysates from these cells were treated with phosphatidic acid (L-α-phosphatidic acid (1,2-diacyl-sn-glycero-3-phosphate) in vitro to ensure sphingosine kinase activity (P.A.a.s.PLD1 and P.A.a.s.PLD2).33 Results are the mean ± SD for triplicate measurements and are representative of the results from at least 3 separate experiments.

Close modal

Previous studies have shown that sphingosine kinase is activated by FcγRI aggregation in cytokine-primed U937 cells and that PLD activation is necessary for coupling the receptor to this kinase.7 Pretreating cells with the antisense oligonucleotide to PLD1 to knock down isozyme expression significantly reduced the peak activation of sphingosine kinase following aggregation of FcγRI in IFN-γ–primed cells by 70% ± 6% (P < .01). The reduction in the peak activation was proportional to the loss of PLD enzyme expressed in these cells as assessed by Western analysis. Reduction in expression of PLD2 had no effect on the ability of FcγRI to couple to sphingosine kinase activation.

To ensure that the loss of sphingosine kinase activity after FcγRI activation in cells treated with the antisense oligonucleotide to PLD1 was a feature of the loss of coupling of the receptor and not some direct effect of the PLD1 antisense oligonucleotide on sphingosine kinase, enzyme activity was measured in lysates following activation of sphingosine kinase with exogenous phosphatidic acid (L-α-phosphatidic acid (1,2-diacyl-sn-glycero-3-phosphate). Addition of phosphatidic acid to the cell lysates from control cells or cells treated with either antisense PLD1 or antisense PLD2 resulted in an identical increase in sphingosine kinase activity (Figure 3B). These data indicate that the reduction in sphingosine kinase activity following FcγRI activation resulting from PLD1 antisense reflects blockage of this pathway and uncoupling of FcγRI to sphingosine kinase activation (Figure 3B).

Thus, in keeping with the observed coupling of FcγRI to PLD1 but not PLD2, receptor-mediated activation of sphingosine kinase and cytosolic calcium transients were found to be attenuated in cells following the specific downregulation of PLD1.

PLD1 but not PLD2 functionally couples FcγRI to intracellular effectors

FcγRI is functionally coupled to NADPH oxidase through PLD activation.

Fc receptors are coupled to the oxidative burst, and activation of NADPH oxidase is an important functional consequence of aggregation of these receptors by opsonized particles or immune complexes to assist in destruction of pathogens.49,50 Here, we show an absolute requirement for PLD in the coupling of FcγRI aggregation to the activation of NADPH oxidase in IFN-γ–primed U937 cells. Thus, formation of surface immune complexes and warming to 37°C result in a transient activation of NADPH oxidase as measured by the oxidative burst (Figure 4A). Pretreatment of cells with 0.3% butan-1-ol completely abolished this response whereas pretreatment with 0.3% butan-2-ol had no effect and cells demonstrated a normal response (Figure 4A). Butan-1-ol but not butan-2-ol can act as an acceptor for the phosphatidyl moiety, thereby generating phosphatidylbutanol instead of phosphatidic acid.7 As butan-2-ol cannot act as an acceptor, it serves as a control for nonspecific effects of the alcohol. This absolute dependence on PLD activation was not observed for other receptors known to be coupled to NADPH oxidase in these cells. Thus, f-MLP also initiates an oxidase burst in these cells. However, in contrast to FcγRI, pretreatment of cells with 0.3% butan-1-ol decreased the oxidase burst activated by f-MLP by only about 50% (Figure 4B). Again, 0.3% butan-2-ol was without effect on this response.

Fig. 4.

NADPH oxidase activity stimulated by FcγRI aggregation.

NADPH oxidase activity stimulated by FcγRI aggregation has an absolute dependence on PLD. (A) FcγRI-mediated activation of the oxidase burst in control cells (XL control) or cells pretreated for 20 minutes with either 0.3% butan-1-ol (XL but-1-ol) or 0.3% butan-2-ol (XL but-2-ol). The results shown are typical from 3 separate experiments. RLU = relative luminescence units. (B) Activation of oxidase by 1 μM f-MLP stimulation (fMLP control) in control cells and in cells pretreated for 20 minutes with either 0.3% butan-1-ol (fMLP but-1-ol) or 0.3% butan-2-ol (fMLP but-2-ol). The results shown are typical of 3 separate experiments. RLU = relative luminescence units.

Fig. 4.

NADPH oxidase activity stimulated by FcγRI aggregation.

NADPH oxidase activity stimulated by FcγRI aggregation has an absolute dependence on PLD. (A) FcγRI-mediated activation of the oxidase burst in control cells (XL control) or cells pretreated for 20 minutes with either 0.3% butan-1-ol (XL but-1-ol) or 0.3% butan-2-ol (XL but-2-ol). The results shown are typical from 3 separate experiments. RLU = relative luminescence units. (B) Activation of oxidase by 1 μM f-MLP stimulation (fMLP control) in control cells and in cells pretreated for 20 minutes with either 0.3% butan-1-ol (fMLP but-1-ol) or 0.3% butan-2-ol (fMLP but-2-ol). The results shown are typical of 3 separate experiments. RLU = relative luminescence units.

Close modal

PLD1 and not PLD2 couples FcγRI to the activation of NADPH oxidase.

A role for PLD1 but not PLD2 in mediating the activation of NADPH oxidase by FcγRI was demonstrated. Treatment of IFN-γ–primed U937 cells with the antisense oligonucleotide to PLD1 to specifically knock down expression of this isozyme resulted in an attenuation of the activation of NADPH oxidase by FcγRI aggregation (peak activity, approximately 30% of control) (Figure5A). Similar treatment of cells with the antisense oligonucleotide to PLD2 did not alter FcγRI activation of NADPH oxidase compared with control cells despite decreasing PLD2 expression (Figure 5A). Treatment of cells with either antisense oligonucleotide (PLD1 or PLD2) did not alter the response of NADPH oxidase to activation by the low-affinity IgG receptor FcγRIIa, which has previously been shown to be coupled to phospholipase C and is independent of PLD activation (Figure 5B).6 

Fig. 5.

FcγRI-mediated activation of NADPH oxidase.

FcγRI-mediated activation of NADPH oxidase is dependent on PLD1 and not PLD2. (A) Superoxide production in response to FcγRI in control cells (XL control) compared with cells pretreated with antisense oligonucleotide (10 μM) to either PLD1 (XL a.s.PLD1) or PLD2 (a.s.PLD2). The trace results shown are typical from 3 separate experiments. (B) Superoxide production in response to FcγRIIa in control cells (XL FcγRIIa control) compared with cells pretreated with antisense (10 μM) to PLD1 (FcγRIIa a.s.PLD1) or PLD2 (FcγRIIa a.s.PL2). FcγRIIa was specifically aggregated by means of an anti-FcγRII–specific monoclonal antibody.7 The trace results shown are typical from 3 separate experiments.

Fig. 5.

FcγRI-mediated activation of NADPH oxidase.

FcγRI-mediated activation of NADPH oxidase is dependent on PLD1 and not PLD2. (A) Superoxide production in response to FcγRI in control cells (XL control) compared with cells pretreated with antisense oligonucleotide (10 μM) to either PLD1 (XL a.s.PLD1) or PLD2 (a.s.PLD2). The trace results shown are typical from 3 separate experiments. (B) Superoxide production in response to FcγRIIa in control cells (XL FcγRIIa control) compared with cells pretreated with antisense (10 μM) to PLD1 (FcγRIIa a.s.PLD1) or PLD2 (FcγRIIa a.s.PL2). FcγRIIa was specifically aggregated by means of an anti-FcγRII–specific monoclonal antibody.7 The trace results shown are typical from 3 separate experiments.

Close modal

PLD1 is necessary for trafficking of immune complexes for degradation.

Formation of surface immune complexes on myeloid cells results in their rapid internalization44 and trafficking to lysosomes for degradation.45 We have previously shown that endocytosis (the initial internalization of immune complexes to early endosomes) mediated by FcγRI is independent of PLD activation but that subsequent intracellular trafficking of immune complexes is significantly delayed in cells treated with 0.3% butan-1-ol.7 Here, using antisense oligonucleotides to downregulate either PLD1 or PLD2, we demonstrate that FcγRI is functionally coupled to PLD1 and not PLD2 to mediate the intracellular trafficking of immune complexes.

Trafficking of immune complexes to lysosomes for degradation can be readily monitored by means of radiolabeled immune complexes and the appearance of TCA-soluble counts in the cells over time.46Following FcγRI aggregation in cytokine-primed U937 cells, almost 50% of the initial radiolabel internalized as immune complexes appears as TCA-soluble counts in the supernatant of these cells after 120 minutes' incubation at 37°C.7 47 

Consistent with previous findings that PLD activation is not necessary for the initial endocytosis of immune complexes mediated by FcγRI,44 downregulation of either PLD1 or PLD2 by pretreating cells with either antisense oligonucleotide did not alter the rate of initial endocytosis of radiolabeled immune complexes (data not shown). However, pretreatment of cells with the antisense PLD1 oligonucleotide significantly changed the rate of appearance of TCA-soluble counts in the supernatant of the cells whereas pretreatment with antisense PLD2 did not. In control and antisense PLD2-treated cells, 50% ± 2% and 49 ± 2% of the initial internalized counts appeared in the supernatant in the TCA-soluble fraction after 120 minutes' incubation whereas for cells treated with antisense PLD1, only 24% ± 1% of counts appeared in this fraction (Figure6). These data demonstrate that PLD1 but not PLD2 activation is required to mediate the trafficking of FcγRI-internalized immune complexes in U937 cells.

Fig. 6.

Effect of PLD1 on coupling of FcγRI to trafficking of immune complexes.

PLD1 functionally couples FcγRI to trafficking of immune complexes. Trafficking of radiolabeled immune complexes is monitored by the appearance of TCA-soluble counts in cell supernatants. Following aggregation of FcγRI, radiolabeled surface–bound counts are rapidly internalized. During 120 minutes incubation, appearance of radiolabel in the supernatant as TCA-soluble counts (XL control) is compared between control cells and cells pretreated with antisense oligonucleotides (10 μM) to either PLD1 (XL a.s.PLD1) or PLD2 (XL a.s.PLD2). Results shown for each time point are the counts in the incubation supernatant soluble in TCA expressed as a percentage of the total counts bound at time zero. Results are the mean ± SD for triplicate measurements and are representative of the results from at least 3 separate experiments.

Fig. 6.

Effect of PLD1 on coupling of FcγRI to trafficking of immune complexes.

PLD1 functionally couples FcγRI to trafficking of immune complexes. Trafficking of radiolabeled immune complexes is monitored by the appearance of TCA-soluble counts in cell supernatants. Following aggregation of FcγRI, radiolabeled surface–bound counts are rapidly internalized. During 120 minutes incubation, appearance of radiolabel in the supernatant as TCA-soluble counts (XL control) is compared between control cells and cells pretreated with antisense oligonucleotides (10 μM) to either PLD1 (XL a.s.PLD1) or PLD2 (XL a.s.PLD2). Results shown for each time point are the counts in the incubation supernatant soluble in TCA expressed as a percentage of the total counts bound at time zero. Results are the mean ± SD for triplicate measurements and are representative of the results from at least 3 separate experiments.

Close modal

In this study, we have shown that FcγRI is functionally coupled to PLD1 but not PLD2 in IFN-γ–primed U937 cells even though both enzymes are expressed in these cells. Further, we show that PLD1 but not PLD2 is required for FcγRI-mediated activation of the NADPH oxidase burst and intracellular trafficking of immune complexes for degradation.

Two forms of PLD have been characterized in mammalian cells, and PLD1 exists as a number of splice variants although the significance of these is not known. Here we show that both isozymes are expressed in U937 cells and that priming with IFN-γ or differentiation with dbcAMP did not significantly alter the expression levels of the 2 enzymes. Specific roles for the 2 enzymes, PLD1 and PLD2, are unclear. Cell lines appear to differ in their expression of the different isozymes.51 Thus, a number of cell lines have been reported to express both isozymes although some cells appear to express one isozyme or the other exclusively. Thus, Jurkat cells only express PLD2 whereas 2 human monoblastic cell types, THP1 and HL60, express predominantly PLD1 in resting state; this contrasts with our report here for U937, cells which are also monoblastic in nature. The expression of PLD1 and PLD2 in U937 cells appeared to be relatively stable. Neither mRNA nor protein levels were altered by priming with IFN-γ or differentiation with dbcAMP. This contrasts with observations made for HL60 cells, where differentiation to a neutrophil phenotype with dbcAMP over 3 days resulted in the upregulation of PLD1 and a 20-fold induction of PLD2.52 In these cells, despite the large increase in PLD2 expression, the coupling of f-MLP to the oxidase burst correlated with PLD1 not PLD2 in these differentiated cells.53 

In vitro studies have shown that the activity of these 2 enzymes is regulated differently. Both PLD1 and PLD2 have an absolute requirement for phosphatidylinositol(4,5)P2 (PIP2) for activation.41,42 Activity of PLD1 has been shown to be stimulated in vitro by 3 additional factors; adenosine diphosphate–ribosylation factor (ARF), Rho, and PKC54through protein-protein interactions. In contrast, PLD2 is insensitive to these 3 factors and, in the absence of other factors apart from PIP2, PLD2 is very active.17 Consistent with these in vitro observations, our data here indicate that, within the intact U937 cell, PLD2 contributes to the basal activity of PLD whereas PLD1 is coupled to cell activation through FcγRI aggregation by immune complexes. Recent data studying PLD1 activation in intact cells suggest that mechanisms similar to those observed in vitro may occur within cells55,56 although there is a growing body of evidence that ARF6, not ARF1, is responsible for coupling receptors to PLD activation.20,57-59 Our recent studies have demonstrated a role for ARF6 and PKCα in coupling FcγRI to the activation of PLD1 through protein-protein interactions.59Although FcγRI is coupled to signaling cascades through the activation of tyrosine kinases, tyrosine phosphorylation of PLD1 is not thought to play a role in regulating the enzyme.9 10 

Consistent with the finding that FcγRI specifically activates PLD1 and not PLD2, antisense knock-down experiments demonstrated a specific role for PLD1 and not PLD2 in coupling this receptor to sphingosine kinase activation and calcium transients. The immediate product of PLD is phosphatidic acid, and this has been shown in vitro to directly activate sphingosine kinase.33 Furthermore, here we demonstrate that PLD1 but not PLD2 is required for the functional coupling of FcγRI to cellular effectors, such as NADPH oxidase activation and intracellular vesicular trafficking of immune complexes from endosomes to lysosomes for degradation. High local production of phosphatidic acid has been proposed to alter membrane properties and facilitate membrane fusion and budding events,13,60 which are important in vesicular trafficking within the cell. Recent work has demonstrated that phagocytosis, which similarly depends on membrane fusion events and vesicular trafficking, is dependent on PLD activation.24 

The regulation of assembly of the subunits of NADPH oxidase to form active enzyme and the subsequent oxidase burst is complex. Here, we demonstrate a surprising absolute requirement on PLD activity for the coupling of FcγRI to NADPH oxidase activation. Thus, treatment of cells with butan-1-ol completely abolished the oxidase burst in response to FcγRI aggregation by immune complexes. By contrast, the oxidase burst in response to f-MLP was reduced by only about 50%. Receptor-coupled activation of oxidase assembly is regulated through the phosphorylation of the p47phox component, and PKCs are widely recognized as playing a major role in this phosphorylation event.61 Previous work has shown that, in these IFN-γ–primed U937 cells, the PKC isozymes δ, ε, and ζ are activated by FcγRI62 and, surprisingly, all PKC activity lies downstream of PLD activation.59 Thus, PLD may couple FcγRI to NADPH oxidase through the activation of these PKC isozymes. However, there is also growing evidence that phosphatidic acid can itself activate NADPH oxidase through both kinase-dependent and kinase-independent mechanisms. Thus, data have implied that a phosphatidic acid–dependent kinase is able to phosphorylate p47phox and p22phox to regulate NADPH oxidase assembly.63,64 In addition, recent data using a cell-free system revealed that phosphatidic acid and diacyl glycerol were able to activate NADPH oxidase in a kinase-independent manner.65 

Our findings that PLD1-mediated generation of phosphatidic acid drives these monocyte biological responses demonstrates the pivotal role of PLD1 in the intracellular signaling cascades initiated by FcγRI and in the functional coupling of this receptor to provide a coordinated response that can ultimately lead to targeted cell killing through antibody-directed cellular cytotoxicity, an important host defense mechanism to combat invading pathogens and important in cancer surveillance.

We thank Drs Andrew Morris and Michael Frohman, Department of Pharmacology, State University of New York, for helpful advice in discussions of material in this manuscript.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

1
Graziano
RF
Fanger
MW
FcγRI and FcγRII on monocytes and granulocytes are cytotoxic trigger molecules for tumor cells.
J Immunol.
139
1987
3536
3541
2
Fanger
MW
Shen
L
Graziano
RF
Guyre
PM
Cytotoxicity mediated by human Fc receptors for IgG.
Immunol Today.
10
1989
92
99
3
Hulett
MD
Hogarth
PM
Molecular basis of Fc receptor function.
Adv Immunol.
57
1994
1
127
4
Ely
P
Wallace
PK
Givan
AL
Guyre
PM
Fanger
MW
Bispecific-armed, interferon gamma-primed macrophage-mediated phagocytosis of malignant non-Hodgkin's lymphoma.
Blood.
86
1996
3813
3821
5
Allen
JM
Seed
B
Isolation and expression of functional high-affinity Fc receptor complementary DNAs.
Science.
243
1989
378
381
6
Melendez
A
Floto
RA
Gillooly
DJ
Harnett
MM
Allen
JM
FcγRI coupling to phospholipase D initiates sphingosine kinase-mediated calcium mobilization and vesicular trafficking.
J Biol Chem.
273
1998
9393
9402
7
Melendez
A
Floto
RA
Cameron
AJ
Gillooly
DJ
Harnett
MM
Allen
JM
A molecular switch changes the signalling pathway used by the FcγRI antibody receptor to mobilise calcium.
Curr Biol.
8
1998
210
221
8
Exton
JH
Phosphatidylcholine breakdown and signal transduction.
Biochim Biophys Acta.
1212
1994
26
42
9
Morris
AJ
Engebrecht
J
Frohman
MA
Structure and regulation of phospholipase D.
Trends Pharm Sci.
17
1996
182
185
10
Exton
JH
Phospholipase D: enzymology, mechanisms of regulation, and function.
Physiol Rev.
77
1997
303
320
11
Ktistakis
NT
Brown
HA
Waters
MG
Sternweis
PC
Roth
MG
Evidence that phospholipase D mediates ADP ribosilation factor-dependent formation of Golgi coated vesicles.
J Cell Biol.
134
1996
295
306
12
Morgan
CP
Sengelov
H
Whatmore
J
Borregaard
N
Cockcroft
S
ADP-ribosylation-factor-regulated phospholipase D activity localizes to secretory vesicles and mobilizes to the plasma membrane following N-formylmethionyl-leucyl-phenylalanine stimulation of human neutrophils.
Biochem J.
325
1997
581
585
13
Siddhanta
A
Shields
D
Secretory vesicle budding from the trans-Golgi network is mediated by phosphatidic acid levels.
J Biol Chem.
273
1998
17995
17998
14
Brown
FD
Thomson
N
Saqib
KM
et al
Phospholipase D1 localises to secretory granules and lysosomes and is plasma-membrane translocated on cellular stimulation.
Curr Biol.
8
1998
835
838
15
Arneson
LS
Kunz
J
Anderson
RA
Traub
LM
Coupled inositide phosphorylation and phospholipase D activation initiates clathrin-coat assembly on lysosomes.
J Biol Chem.
274
1999
17794
17805
16
Cross
MJ
Roberts
S
Ridley
AJ
et al
Stimulation of actin stress fibre formation mediated by activation of phospholipase D.
Curr Biol.
6
1996
588
597
17
Colley
WT
Sung
TC
Roll
R
et al
Phospholipase D2, a PLD1-related isoform with novel regulatory properties and discrete subcellular localization that provokes cytoskeletal reorganization.
Curr Biol.
7
1997
191
201
18
Ghosh
S
Strum
JC
Sciorra
VA
Daniel
L
Bell
RM
Raf-1 kinase possesses distinct binding domains for phosphatidylserine and phosphatidic acid: phosphatidic acid regulates the translocation of Raf-1 in 12-O-tetradecanoylphorbol-13-acetate-stimulated Madin-Darby canine kidney cells.
J Biol Chem.
271
1996
8472
8480
19
Rizzo
MA
Shome
K
Vasudevan
C
et al
Phospholipase D and its product, phosphatidic acid, mediate agonist-dependent raf-1 translocation to the plasma membrane and the activation of the mitogen-activated protein kinase pathway.
J Biol Chem.
174
1999
1131
1139
20
Caumont
A-S
Galas
M-C
Vitale
N
Aunis
D
Bader
M-F
Regulated exocytosis in chromaffin cells: translocation of ARF6 stimulates a plasma membrane-associated phospholipase D.
J Biol Chem.
273
1998
1373
1379
21
Dhalla
NS
Xu
Y-J
Sheu
S-S
Tappia
PS
Panagia
V
Phosphatidic acid: a potential signal transducer for cardiac hypertrophy.
J Mol Cell Cardiol.
29
1997
2865
2871
22
Kusner
DJ
Hall
CF
Jackson
S
Fcγ receptor-mediated activation of phospholipase D regulates macrophage phagocytosis of IgG-opsonized particles.
J Immunol.
162
1999
2266
2274
23
English
D
Cui
Y
Sidiqui
RA
Messenger functions of phosphatidic acid.
Chem Phys Lipids.
80
1996
117
132
24
Olson
SC
Lambeth
JD
Biochemistry and cell biology of phospholipase D in human neutrophils.
Chem Phys Lipids.
80
1996
3
19
25
Ortmeyer
Y
Mohsenin
V
Inhibition of phospholipase D and superoxide generation by glucose in diabetic neutrophils.
Life Sci.
59
1996
255
262
26
Bocckine
SB
Wilson
PB
Exton
JH
Phosphatidate-dependent protein phosphorylation.
Proc Natl Acad Sci U S A.
88
1991
6210
6213
27
Waite
KA
Wallin
R
Qualliotine-Mann
D
McPhail
LC
Phosphatidic acid-mediated phosphorylation of the NADPH oxidase component p47-phox.
J Biol Chem.
272
1997
15569
15578
28
Zhao
Z
Shen
SH
Fischer
EH
Stimulation by phospholipids of a protein-tyrosine-phosphatase containing two src homology 2 domains.
Proc Natl Acad Sci U S A.
90
1993
4251
4255
29
Cui
Y
English
K
Phosphatidic acid-mediated regulation of neutrophil plasma membrane CD45-phosphotyrosine phosphatase.
Cell Signal.
9
1997
257
263
30
Kishikawa
K
Chalfant
CE
Perry
DK
Bielawska
A
Hannun
YA
Phosphatidic acid is a potent and selective inhibitor of protein phosphatase 1 and an inhibitor of ceramide-mediated responses.
J Biol Chem.
274
1999
21335
21341
31
Jackowski
S
Rock
CO
Stimulation of phosphatidylinositol-4,5-bisphosphate phospholipase C activity by phosphatidic acid.
Arch Biochem Biophys.
268
1989
516
524
32
Moritz
A
Graan
PND
Gispen
WH
Wirtz
KW
Phosphatidic acid is a specific activator of phosphatidylinositol-4-phosphate kinase.
J Biol Chem.
267
1992
7207
7210
33
Olivera
A
Rosenthal
J
Spiegel
S
Effect of acidic phospholipids on sphingosine kinase.
J Cell Biochem.
60
1996
529
537
34
Tsai
MH
Yu
CL
Wei
FS
Stacey
DW
The effect of GTPase activating protein upon ras is inhibited by mitogenically responsive lipids.
Science.
243
1989
522
526
35
Limas
CJ
Phosphatidate releases calcium from cardiac sarcoplasmic reticulum.
Biochem Biophys Res Commun.
95
1980
541
546
36
Xu
YJ
Panagia
V
Shao
Q
Wang
X
Dhalla
NS
Phosphatidic acid increases intracellular free calcium and cardiac contractile force.
Am J Physiol.
271
1996
H651
H659
37
Nishizuka
Y
The molecular heterogeneity of protein kinase C.
Science.
334
1988
661
663
38
Hug
H
Sarre
TF
Protein kinase C isoenzymes: divergence in signal transduction?
Biochem J.
291
1993
329
334
39
Guo
Z
Liliom
K
Fischer
DJ
et al
Molecular cloning of a high-affinity receptor for the growth factor-like lipid mediator lysophosphatidic acid from Xenopus oocytes.
Proc Natl Acad Sci U S A.
93
1996
14367
14372
40
Ryu
SB
Wang
X
Activation of phospholipase D and the possible mechanism of activation in wound-induced lipid hydrolysis in castor bean leaves.
Biochim Biophys Acta.
1303
1996
243
250
41
Hammond
SM
Altshuller
YM
Sung
T-C
et al
Human ADP-ribosylation factor-activated phosphatidylcholine-specific phospholipase D defines a new and highly conserved gene family.
J Biol Chem.
270
1995
29640
29643
42
Lopez
I
Arnold
RS
Lambeth
JD
Cloning and initial characterization of a human phospholipase D2 (hPLD2).
J Biol Chem.
273
1998
12846
12852
43
Hammond
SM
Jenco
JM
Nakashima
S
et al
Characterization of two alternatively spliced forms of phospholipase D1.
J Biol Chem.
272
1997
3860
3868
44
Harrison
PT
Davis
W
Norman
JC
Hockaday
A
Allen
JM
Binding of monomeric IgG triggers FcγRI-mediated endocytosis.
J Biol Chem.
269
1994
24396
24400
45
Norman
JC
Harrison
PT
Davis
W
Floto
RA
Allen
JM
Lysosomal routing of FcγRI from early endosomes requires recruitment of tyrosine kinases.
Immunology.
94
1998
48
55
46
Miettinen
HM
Rose
JK
Mellman
I
Fc receptor isoforms exhibit distinct abilities for coated pit localization as a result of cytoplasmic domain heterogeneity.
Cell.
58
1989
317
327
47
Sheth
B
Dransfield
I
Partridge
LJ
Barker
MD
Burton
DR
Dibutyryl cyclic AMP stimulation of a monocytic cell line, U937: a model for monocyte chemotaxis and Fc receptor-related functions.
Immunology.
63
1988
483
490
48
Melendez
AJ
Gillooly
DJ
Harnett
MM
Allen
JM
Aggregation of the human high affinity immunoglobulin G receptor (FcγRI) activates both tyrosine kinase and G protein-coupled phosphoinositide 3-kinase isoforms.
Proc Natl Acad Sci U S A.
95
1998
2169
2174
49
Pfefferkorn
LC
Fanger
MW
Transient activation of the NADPH oxidase through FcγRI: oxidase deactivation precedes internalization of cross-linked receptors.
J Immunol.
143
1989
2640
2649
50
Pound
JD
Lund
J
Jefferis
R
Human FcγRI triggering of the mononuclear phagocyte respiratory burst.
Mol Immunol.
30
1993
469
478
51
Gibbs
TC
Meier
KE
Expression and regulation of phospholipase D isoforms in mammalian cell lines.
J Cell Physiol.
182
2000
77
87
52
Nakashima
S
Ohguchi
K
Frohman
MA
Nozawa
Y
Increased mRNA expression of phospholipase D (PLD) isozymes during granulocytic differentiation of HL60 cells.
Biochim Biophys Acta.
1389
1998
173
177
53
Meier
KE
Gibbs
TC
Knoepp
SM
Ella
KM
Expression of phospholipase D isoforms in mammalian cells.
Biochim Biophys Acta.
1439
1999
199
213
54
Sung
T-C
Zhang
Y
Morris
AJ
Frohman
MA
Structural analysis of human phospholipase D1.
J Biol Chem.
274
1999
3659
3666
55
Zhang
Y
Altshuller
YM
Hammond
SM
Morris
AJ
Frohman
MA
Loss of receptor regulation by a phospholipase D1 mutant inresponsive to protein kinase C.
EMBO J.
18
1999
6339
6348
56
Meacci
E
Vasta
V
Moorman
JP
et al
Effect of Rho and ADP-ribosylation factor GTPases on phospholipase D activity in intact human adenocarcinoma A549 cells.
J Biol Chem.
274
1999
18605
18612
57
Le Stunff
H
Dokhac
L
Bourgoin
S
Bader
MF
Harbon
S
Phospholipase D in rat myometrium: occurrence of a membrane-bound ARF6 (ADP-ribosylation factor 6)-regulated activity controlled by betagamma subunits of heterotrimeric G-proteins.
Biochem J.
352
2000
491
499
58
Dana
RR
Eigesti
C
Holmes
KL
Leto
TL
A regulatory role for ADP-ribosylation factor 6 (ARF6) in activation of the phagocyte NADPH oxidase.
J Biol Chem.
275
2000
32566
32571
59
Melendez
AJ
Harnett
MM
Allen
JM
Crosstalk between ARF6 and protein kinase C alpha in FcγRI-mediated activation of phospholipase D1.
Curr Biol.
11
2001
869
874
60
Rudge
SA
Morris
AJ
Engebrecht
J
Relocalization of phospholipase D activity mediates membrane formation during meiosis.
J Cell Biol.
140
1998
81
90
61
El Benna
J
Faust
RP
Johnson
JL
Babior
BM
Phosphorylation of the respiratory burst oxidase subunit p47phos as determined by two-dimensional phosphopeptide mapping: phosphorylation by protein kinase C, protein kinase A, and a mitogen activated protein kinase.
J Biol Chem.
271
1996
6374
6378
62
Melendez
AJ
Harnett
MM
Allen
JM
Differentiation-dependent switch in protein kinase C isoenzyme activation by FcγRI, the human high-affinity receptor for immunoglobulin G.
Immunology.
96
1999
457
464
63
Waite
KA
Wallin
R
Qualliotine-Mann
D
McPhail
LC
Phosphatidic acid-mediated phosphorylation of the NADPH oxidase component p47-phox: evidence that phosphatidic acid may activate a novel protein kinase.
J Biol Chem.
272
1997
15569
15578
64
Regier
DS
Waite
KA
Wallin
R
McPhail
LC
A phosphatidic-acid protein kinase and conventional protein kinase C isoforms phosphorylate p22phox, an NADPH oxidase component.
J Biol Chem.
274
1999
36601
36608
65
Palicz
A
Foubert
TR
Jesaitis
AJ
Marodi
L
McPhail
LC
Phosphatidic acid and diacylglycerol directly activate NADPH oxidase by interacting with enzyme components.
J Biol Chem.
276
2001
3090
3097

Author notes

Janet M. Allen, Inpharmatica, 60 Charlotte Street, London WIT 2NU, England, United Kingdom; e-mail:[email protected].

Sign in via your Institution