Abstract

Colony-stimulating factor 1 (CSF-1) regulates the survival, proliferation, and differentiation of mononuclear phagocytes. It is expressed as a secreted glycoprotein or proteoglycan found in the circulation or as a biologically active cell-surface glycoprotein. To investigate tissue CSF-1 regulation, CSF-1–nullCsf1op/Csf1opmice expressing transgenes encoding the full-length membrane-spanning CSF-1 precursor driven by 3.13 kilobases of the mouse CSF-1 promoter and first intron were characterized. Transgene expression corrected the gross osteopetrotic, neurologic, weight, tooth, and reproductive defects ofCsf1op/Csf1opmice. Detailed analysis of one transgenic line revealed that circulating CSF-1, tissue macrophage numbers, hematopoietic tissue cellularity, and hematopoietic parameters were normalized. Tissue CSF-1 levels were normal except for elevations in 4 secretory tissues. Skin fibroblasts from the transgenic mice secreted normal amounts of CSF-1 but also expressed some cell-surface CSF-1. Also, lacZ driven by the same promoter/first intron revealed β-galactosidase expression in hematopoietic, reproductive, and other tissue locations proximal to CSF-1 cellular targets, consistent with local regulation by CSF-1 at these sites. These studies indicate that the 3.13-kilobase promoter/first intron confers essentially normal CSF-1 expression. They also pinpoint new cellular sites of CSF-1 expression, including ovarian granulosa cells, mammary ductal epithelium, testicular Leydig cells, serous acinar cells of salivary gland, Paneth cells of the small intestine, as well as local sites in several other tissues.

Introduction

Colony-stimulating factor 1 (CSF-1), the primary regulator of mononuclear phagocyte production, also regulates cells of the female reproductive tract.1,2 The effects of CSF-1 are mediated by a high-affinity receptor tyrosine kinase (CSF-1R)3-5 encoded by the c-fmsprotooncogene.6 Complementary DNA (cDNA) clones encoding several different isoforms of both mouse and human CSF-1 have been obtained.7-12 Full-length CSF-1 cDNAs direct the expression of both secreted glycoprotein13,14 and proteoglycan15,16 forms, whereas the membrane-bound cell-surface form is derived from a truncated messenger RNA (mRNA) precursor in which the glycosaminoglycan addition site and the proteolytic cleavage sites yielding the secreted forms have been spliced out.17 The N-terminal 152 amino acids of CSF-1 are required for in vitro biological activity.1,12 

Although CSF-1 is synthesized by many different cell types in vitro, the primary source of the circulating proteoglycan and glycoprotein forms is thought to be the endothelial cells that line the small blood vessels.18 However, CSF-1 is synthesized locally, eg, by osteoblasts19,20 and, during pregnancy, by uterine epithelial cells.21 It has been suggested that regulation at particular tissue sites is mediated by local synthesis of the membrane-spanning, cell-surface CSF-1 and/or selective sequestration of the secreted proteoglycan CSF-1.15,16,22 

CSF-1–null Csf1op/Csf1opmice harbor an inactivating mutation in the coding region of the CSF-1 gene23-26 and are osteopetrotic because of their paucity of osteoclasts.27 They are toothless, have low body weight, low growth rate, skeletal abnormalities, and are deficient in tissue macrophages.23,27-30 In addition, they have defects in both male and female fertility, neural development, the dermis, and synovial membranes.2 Because CSF-1R expression outside the female reproductive tract is apparently restricted to mononuclear phagocytes,1,2 the pleiotropic phenotype of the Csf1op/Csf1op mouse is apparently due to a reduction in trophic and/or scavenger functions of the tissue macrophages regulated by CSF-1, secondary to the reduction of their concentration in tissues.30 

Reconstitution of circulating levels of CSF-1 inCsf1op/Csf1op mice, by daily subcutaneous injection of human recombinant CSF-1 from 3 days of age, partially or completely restored many tissue macrophage populations, whereas others failed to respond and were presumed to have an embryonic requirement for CSF-1, to be present at sites inaccessible to circulating CSF-1, or to be dependent on the local production of CSF-1.30 In the present study, we have used a transgene encoding the full-length CSF-1 precursor to reconstitute circulating and tissue levels of secreted CSF-1 and some cell-surface CSF-1 expression. We have established that the forms of CSF-1 encoded by this precursor, when expressed in an essentially normal tissue-specific and developmental pattern, correct the defects reported inCsf1op/Csf1op mice, confirming that all the phenotypes found in these mice are due to the absence of CSF-1 and not due to a linked secondary mutation. We have identified regulatory regions of the CSF-1 gene that confer normal tissue-specific expression of CSF-1 and used these to drive expression of the lacZ gene, pinpointing sites of local CSF-1 production in tissues.

Materials and methods

Animals

OsteopetroticCsf1op/Csf1op mice, CSF-1 transgenic Csf1op/Csf1opand littermate controls (+/+ or +/Csf1op), as well as the lacZ transgenic mice were bred and maintained on a segregating (C57BL/6J × C3Heb/FeJ-a/a) background behind a barrier. Csf1op/Csf1opmice were identified by the absence of incisor eruption at 10 days of age and were fed a powdered mixture of mouse food ad libitum and infant formula (Enfamil) daily. Transgenic mice and control mice received mouse chow.

Transgene constructs and production of transgenic animals

For the TgN(FLCsf1)Ers transgene construct, a λ-phage insert containing 6.4 kilobases (kb) of the mouse CSF-1 promoter (3.13 kb),31 exon 1, and the first intron (3.28 kb) was fully sequenced and subcloned, in stages, into a pGEM 3Z-based plasmid containing exons 2 to 9 of mouse CSF-1 cDNA from pGEM2MCSF5310 together with human growth hormone (hGH) poly(A) addition sequences obtained from plasmid pOGH32(Figure 1). The hGH poly(A) sequences were included to ensure proper processing of the transgene mRNA. High concentrations of CSF-1 were detected in the culture medium fromCsf1op/Csf1op fibroblasts transfected with the construct. The CSF-1 transgene was excised from the vector by digestion with BglII and EcoRI enzymes and the purified, linearized DNA injected into fertilized oocytes of C57BL/6 ×FVB F1 mice. Of 3 founder mice, 2,TgN(FLCsf1)2Ers/+ and TgN(FLCsf1)4Ers/+, transmitted the transgene to progeny, which were mated to+/Csf1op mice to generateCsf1op/Csf1op; TgN(FLCsf1)Ers/+ and littermate control (+/+,+/Csf1op, andCsf1op/Csf1op) mice. For the TgN(Csf1-Z)Ers transgene construct, the ATG start codon in the CSF-1 promoter/intron 1 fragment was mutated by polymerase chain reaction (PCR)-based in vitro mutagenesis and the mutated fragment cloned upstream of a lacZ gene cassette33 containing the ATG start codon, a nuclear localization sequence, lacZcoding region, and SV40 poly(A) addition sequence (Figure 1). One founder mouse, TgN(Csf1-Z)1Ers/+, obtained as described above, transmitted the transgene to progeny.

Fig. 1.

Transgene constructs.

(A) Genomic organization of the human CSF-1 gene, in which the mouse CSF-1 intron–exon boundaries are conserved, showing exons (1-10), reported alternative splicing events (I-V), oligonucleotide primers forCsf1op mutation genotyping (P1, P2), and the exon 10 RPA probe used to detect exon 10–containing mRNA expression. (B) TgN(FLCsf1)Ers, or TgC, encoding full-length mouse CSF-1 and comprising exons 2 to 9, derived from alternative splicings I and IV and the hGH poly(A) addition site (hatched), under the control of the CSF-1 promoter and first intron, showing relevant restriction enzyme sites, the oligonucleotide primers used for genotyping (P3, P4), the transmembrane domain (TM), and the RPA probe used to detect the transgene and exon 9–containing mRNAs. (C) TgN(Csf1-Z)Ers, or TgZ, encoding lacZ under the control of the CSF-1 promoter and first intron. Positions of the mutated ATG (*ATG), translation start codon (ATG), SV40 nuclear localization sequence (NLS) (checkered),lacZ coding sequence, SV40 polyadenylation signal (heavy crosshatch), and oligonucleotide primers (P5, P6) used to detect the transgene by PCR are indicated.

Fig. 1.

Transgene constructs.

(A) Genomic organization of the human CSF-1 gene, in which the mouse CSF-1 intron–exon boundaries are conserved, showing exons (1-10), reported alternative splicing events (I-V), oligonucleotide primers forCsf1op mutation genotyping (P1, P2), and the exon 10 RPA probe used to detect exon 10–containing mRNA expression. (B) TgN(FLCsf1)Ers, or TgC, encoding full-length mouse CSF-1 and comprising exons 2 to 9, derived from alternative splicings I and IV and the hGH poly(A) addition site (hatched), under the control of the CSF-1 promoter and first intron, showing relevant restriction enzyme sites, the oligonucleotide primers used for genotyping (P3, P4), the transmembrane domain (TM), and the RPA probe used to detect the transgene and exon 9–containing mRNAs. (C) TgN(Csf1-Z)Ers, or TgZ, encoding lacZ under the control of the CSF-1 promoter and first intron. Positions of the mutated ATG (*ATG), translation start codon (ATG), SV40 nuclear localization sequence (NLS) (checkered),lacZ coding sequence, SV40 polyadenylation signal (heavy crosshatch), and oligonucleotide primers (P5, P6) used to detect the transgene by PCR are indicated.

Genotypic analysis

Genotype analysis of the chromosomalCsf1op allele in transgenic animals and their nontransgenic littermates was carried out by PCR using primers P1 (CGCATGGTCTCATCTATTATGTCTTG) and P2 (GAATACAGGAACCAGGAGGTTAGCACCTGG). These oligonucleotides respectively match sequences upstream and downstream of the Csf1op mutation site in exon 4 (Figure 1A). The resulting 130–base pair (bp) Csf1 and 131-bp Csf1op PCR products were separated in acrylamide sequencing gels. PCR products were detected either by the incorporation of 35S dATP in the PCR reaction followed by autoradiography or, alternatively, by labeling one of the amplimers with a fluorescent dye (6-Fam, Applied Biosystems, Foster City, CA) for automated detection using a long-range automated sequencer (Perkin Elmer-Applied Biosystems, Foster City, CA).

Founder mice expressing the CSF-1 transgene were first detected by Southern hybridization of mouse tail DNA samples digested withDraIII and probed with a 32P-labeled CSF-1 cDNA insert from plasmid pGEM2MCSF53.10 Subsequent TgN(FLCsf1)Ers transgene genotype analysis was carried out by multiplex PCR using primers P3 (GCAGCTGTTAAAACTAATGTGATCTTAATC) and P4 (ATGAGGACAGACAGGTGGAACTGCCAGTAATGAAG) to detect transgene (Figure 1B).

Expression of TgN(Csf1-Z)1Ers was detected using primers P5 (CCCAACTTAATCGCCTTGCAGCACATCCCC) and P6 (CTGCCAGTTTGAGGGGACGACGACAGTATC) (Figure 1C).

Measurement of CSF-1

CSF-1 was measured by radioimmunoassay.34,35 Tissue extracts were prepared from exsanguinated mice as described elsewhere.36 Cell-surface CSF-1 was measured by flow cytometry (below) and by trypsin release of intact CSF-1 followed by radioimmunoassay.

Analyses of mRNAs

Ribonuclease protection assays (RPAs) were carried out using an RPA II kit (Ambion, Austin, TX) by probing 10 μg of DNase1-treated total tissue RNA with 32P-labeled RNA probes synthesized using a MAXIscript Sp6/T7 kit (Ambion) from linearized PCR-vector (Invitrogen, Carlsbad, CA)–based intermediate plasmid DNA, in which PCR products for the exon 9/hGH RPA probe (from the BamHI site of exon 6 to the SmaI site of the hGH untranslated region [UTR], including the hGH poly(A) addition site, Figure 1B) and exon 10 probe (Figure 1A) were amplified from TgN(FLCsf1)Ers DNA and pGEM2MCSF10 DNA,10 respectively.

X-ray analysis of mouse skeletal structure

Radiographs were produced by exposing euthanized or anesthetized mice in a Faxitron pathology specimen x-ray cabinet (Faxitron X-Ray, Buffalo Grove, IL). The animals were posed immediately above a fine-grained Polaroid 665 instant-negative film package. Exposure was set at 50 kV for 1.5 minutes. The negatives were developed and printed according to the manufacturer's instructions (Polaroid, Cambridge, MA).

Immunohistochemistry, histochemistry, and flow cytometry

For immunostaining with rat monoclonal antibody F4/8037 and histochemical localization of tartrate-resistant acid phosphatase (TRAP), siblings of the different genotypes were perfused and tissues fixed, decalcified (knee joint only), embedded, sectioned, and immunostained as described.30 F4/80+ cells in tissue sections of at least 2 mice of a particular genotype at each age were quantitated as described.30 For localization of β-galactosidase, 5-mm tissue cubes were fixed and stained by incubation with 4-chloro-5-bromo-3-indolyl-b-d-galactopyranoside as described.38 Alternate 5- and 20-mm sections were used for hematoxylin and eosin (H&E) staining and for observation of β-galactosidase localization, respectively. For all of the tissues shown, there was minimal β-galactosidase staining in nontransgenic tissues. For flow cytometry analysis of cell-surface CSF-1, single-cell suspensions of primary skin fibroblasts were made from +/+,+/Csf1op, Csf1op/Csf1op,and Csf1op/Csf1op; TgN(FLCsf1)2Ers/+mice and incubated sequentially with rat antimouse CSF-1 YYG106 monoclonal (2 μg/106 cells)35 and phycoerythrin–goat antirat and phycoerythrin-conjugated rabbit antigoat antibodies. Fluorescence-activated cell sorter (FACS) analyses were done with a Becton Dickinson FACSCalibur (San Jose, CA) in the FACS facility of Albert Einstein College of Medicine.

Hematopoietic parameters

Red cell lysis, antibody staining (FITC-CD45.2 and PerCp-B220, Pharmingen, San Diego, CA), and FACS and data analysis of heparinized blood samples were standard procedures carried out as described.39 Spleen and bone marrow cell suspensions were assayed for colony-forming cells of high proliferative potential (HPP-CFC) and low proliferative potential (CFU-C) as previously described.40 BFU-E (burst-forming unit–erythroid) and CFU-GEMM (colony-forming unit–granulocyte, erythroid, macrophage, megakaryocyte) assays were performed using reagents supplied by Stem Cell Technology, as described by the manufacturers (Stem Cell Technologies, Vancouver, BC, Canada).

Results

Circulating levels of CSF-1 and fibroblast CSF-1 expression inCsf1op/Csf1opmice expressing the full-length CSF-1 transgene, TgN(FLCsf1)Ers

The CSF-1 transgene, TgN(FLCsf1)Ers, included the first intron to increase the likelihood of efficient expression of the transgene and an additional 700-bp hGH poly(A) addition site sequence downstream of the CSF-1 cDNA (Figure 1B), because the 2 kb (exon 9 5′ UTR) CSF-1 cDNA does not contain a canonical mRNA poly(A) addition site sequence. Southern analysis of the tail DNA of 2 transgenic founder mice revealed that each contained multiple copies (TgN(FLCsf1)2Ers/+, about 10, and TgN(FLCsf1)4Ers/+, about 40) of the complete CSF-1 transgene (data not shown). In contrast toCsf1op/Csf1op mice, which expressed no detectable circulating CSF-1, eitherCsf1op/Csf1op; TgN(FLCsf1)2Ers/+mice or +/Csf1op TgN(FLCsf1)2Ers/+mice possessed serum CSF-1 concentrations indistinguishable from those of +/+ or +/Csf1op mice (Table1). However, the serum CSF-1 concentrations of Csf1op/Csf1op; TgN(FLCsf1)4Ers/+ mice, containing about 4 times higher levels of the transgene, were 3 times those of +/Csf1opmice (Table 1). Despite the higher than normal levels of circulating CSF-1 in the Csf1op/Csf1op; TgN(FLCsf1)4Ers/+ mice, careful examination of 15Csf1op/Csf1op; TgN(FLCsf1)4Ers/+mice revealed that they possessed the same gross phenotype (see below) as Csf1op/Csf1op; TgN(FLCsf1)2Ers/+, +/+, or +/Csf1op mice and were similarly fertile. Further detailed studies ofCsf1op/Csf1op mice expressing TgN(FLCsf1)Ers reported here used theCsf1op/Csf1op; TgN(FLCsf1)2Ers/+mice (TgN(FLCsf1)2Ers is henceforth abbreviated TgC). Skin fibroblasts from Csf1op/Csf1op; TgC/+ mice secreted CSF-1 in amounts equivalent to +/Csf1opfibroblasts but less than +/+ fibroblasts and expressed approximately a third of the amount of cell-surface CSF-1 expressed by+/Csf1op fibroblasts, as assessed by FACS analysis of cells stained with anti–CSF-1, or by trypsin release of intact CSF-1 from the cell surface (Figure2).

Table 1.

Csf1op/Csf1op; TgC/+mice possess normal levels of circulating colony-stimulating factor 1

Genotype CSF-1 concentration (ng/mL) 
+/+ 9.9 ± 0.7  
+/Csf1op 10.4 ± 2.1 
Csf1op/Csf1op 
+/Csf1op; TgC/+ 9.0 ± 0.7  
Csf1op/Csf1op; TgC/+ 9.1 ± 0.8  
Csf1op/Csf1op; TgN(FLCsf1)4Ers/+ 30.2 ± 9.5 
Genotype CSF-1 concentration (ng/mL) 
+/+ 9.9 ± 0.7  
+/Csf1op 10.4 ± 2.1 
Csf1op/Csf1op 
+/Csf1op; TgC/+ 9.0 ± 0.7  
Csf1op/Csf1op; TgC/+ 9.1 ± 0.8  
Csf1op/Csf1op; TgN(FLCsf1)4Ers/+ 30.2 ± 9.5 

CSF-1 indicates colony-stimulating factor 1.

Mean ± SEM.

Fig. 2.

Csf1op/Csf1op; TgC/+ fibroblasts secrete normal levels of CSF-1 and express significant levels of cell-surface CSF-1.

(A) CSF-1 concentrations in culture supernatants of skin fibroblasts from +/+ (a), +/Csf1op (b),Csf1op/Csf1op (c), andCsf1op/Csf1op TgC/+ (d) mice, determined by a CSF-1 radioimmunoassay that detects biologically active CSF-1. Means ± SEM for triplicate cultures. (B) Expression of cell-surface CSF-1 by the same fibroblasts, detected by anti–CSF-1 antibody staining and FACS analysis. The expression of cell-surface CSF-1 by Csf1op/Csf1op; TgC/+fibroblasts was confirmed by its trypsin-mediated release and measurement by CSF-1 radioimmunoassay. By this technique, it was expressed at one third the level of cell-surface CSF-1 on+/Csf1op fibroblasts (data not shown).

Fig. 2.

Csf1op/Csf1op; TgC/+ fibroblasts secrete normal levels of CSF-1 and express significant levels of cell-surface CSF-1.

(A) CSF-1 concentrations in culture supernatants of skin fibroblasts from +/+ (a), +/Csf1op (b),Csf1op/Csf1op (c), andCsf1op/Csf1op TgC/+ (d) mice, determined by a CSF-1 radioimmunoassay that detects biologically active CSF-1. Means ± SEM for triplicate cultures. (B) Expression of cell-surface CSF-1 by the same fibroblasts, detected by anti–CSF-1 antibody staining and FACS analysis. The expression of cell-surface CSF-1 by Csf1op/Csf1op; TgC/+fibroblasts was confirmed by its trypsin-mediated release and measurement by CSF-1 radioimmunoassay. By this technique, it was expressed at one third the level of cell-surface CSF-1 on+/Csf1op fibroblasts (data not shown).

Gross phenotype of Csf1op/Csf1op; TgC/+ mice

The CSF-1–nullCsf1op/Csf1op mice exhibit impaired bone resorption associated with a reduction in the number of osteoclasts.27 Their inability to remodel bone results in skeletal deformities, particularly in the long bones, which are dense, short, and thick (Figure 3G); in the flat bony plates, which produce their characteristically domed skull (Figure 3C); and in the mandible, resulting in a failure of tooth eruption (Figure 3C). These gross skeletal defects were completely restored by expression of either transgene (compare Figure 3F,D with Figure 3E,B). Upper and lower incisor tooth eruption, absent inCsf1op/Csf1op mice (Figure 3C), occurred on postnatal days 9 and 10 after birth in both+/Csf1op and transgenicCsf1op/Csf1op mice (Figure 3B,D). In contrast to the sometimes abnormally curved or misaligned (Figure 3A) incisor teeth ofCsf1op/Csf1op mice injected daily with CSF-1 from the third postnatal day,30incisor teeth of the transgenicCsf1op/Csf1op mice always appeared to be normal and properly aligned (Figure 3D). The decreased head size and shortening of the facial bones (Figure 3C), the stubby appearance of the tarsals and metatarsals, and the appearance of the femur and humerus (Figure 3G) in theCsf1op/Csf1op mice were also restored to normal by transgene expression (Figure 3D,F). Remodeling of the marrow space can be clearly seen in the tarsals and tibia and noticeably in tail vertebrae of both normal +/Csf1op as well as transgenicCsf1op/Csf1op mice (Figure 3E,F,H,I) but is very much reduced in theCsf1op/Csf1op mutant mice (Figure 3G,J). Despite their powdered chow and milk formula diet,Csf1op/Csf1op mice still exhibited decreased adult body weight and a retarded growth rate (Figure 4). In contrast, the growth rate of Csf1op/Csf1op; TgC/+ mice was not significantly different from the growth rate of age-matched normal +/Csf1op littermates (Figure 4). The gross neurologic defects ofCsf1op/Csf1op mice, blindness and deafness,41 were also absent inCsf1op/Csf1op; TgC/+ mice (data not shown).

Fig. 3.

Normal skeletal development in

Csf1op/Csf1op; TgC/+mice. X-rays of 6-week-oldCsf1op/Csf1op mice injected with 12 μg recombinant human CSF-1 daily from day 3 of life (A) and 6-week-old littermate mice of genotypes +/Csf1op(B,E,H), Csf1op/Csf1op(C,G,J), and Csf1op/Csf1op; TgC/+(D, F, I).

Fig. 3.

Normal skeletal development in

Csf1op/Csf1op; TgC/+mice. X-rays of 6-week-oldCsf1op/Csf1op mice injected with 12 μg recombinant human CSF-1 daily from day 3 of life (A) and 6-week-old littermate mice of genotypes +/Csf1op(B,E,H), Csf1op/Csf1op(C,G,J), and Csf1op/Csf1op; TgC/+(D, F, I).

Fig. 4.

Normal growth rate of

Csf1op/Csf1op;TgC/+ mice. Groups of 6 male mice of each genotype (⋄, +/+; ■,Csf1op/Csf1op; TgC/+;▵, Csf1op/Csf1op) were weighed at approximately weekly intervals. Means ± SEM.

Fig. 4.

Normal growth rate of

Csf1op/Csf1op;TgC/+ mice. Groups of 6 male mice of each genotype (⋄, +/+; ■,Csf1op/Csf1op; TgC/+;▵, Csf1op/Csf1op) were weighed at approximately weekly intervals. Means ± SEM.

Restoration of tissue CSF-1 expression inCsf1op/Csf1op; TgC/+ mice

The ability of the transgene to reconstitute the expression of CSF-1 in tissues was examined by comparing tissue CSF-1 concentrations of Csf1op/Csf1op; TgC/+ and normal +/Csf1op mice. Biologically active CSF-1 protein was detected in every transgenicCsf1op/Csf1op tissue, and most possessed levels that were not significantly different from those of +/Csf1op mice (Table2). Importantly, the dramatic elevation in uterine CSF-1 expression reported for normal mice during pregnancy36 was also detected in theCsf1op/Csf1op; TgC/+ mice, indicating that the transgene confers normal tissue-specific regulation of CSF-1 during pregnancy. However, CSF-1 concentrations in several secretory organs—salivary glands, prostate, bladder, and testes/epididymis—were significantly higher than those of the corresponding +/Csf1op tissues. The widespread detection of at least normal levels of CSF-1 in tissue extracts from transgenic Csf1op/Csf1opmice suggests that regulation of the transgene construct for the most part reflects the regulation of endogenous CSF-1 gene expression.

Table 2.

Tissue colony-stimulating factor 1 concentrations in wild-type and Csf1op/Csf1op; TgC/+mice

Tissue CSF-1 concentration (pg/mg tissue) 
+/Csf1op Csf1op/Csf1op; TgC/+ 
Lymph nodes 14.3 ± 3.7 11.8 ± 4.9 
Thymus 16.0 ± 3.3 13.5 ± 5.9 
Heart 6.5 ± 2.6 7.0 ± 1.4 
Lungs 16.6 ± 8.1 15.7 ± 6.5 
Liver 2.8 ± 1.9 2.4 ± 1.4 
Stomach 7.0 ± 2.8 6.5 ± 2.7 
Pancreas 10.5 ± 4.9 6.3 ± 2.6 
Spleen 14.0 ± 6.2 11.1 ± 4.9  
Small intestine 12.0 ± 8.9 9.4 ± 6.2 
Kidneys 7.8 ± 2.6 5.9 ± 3.5  
Large intestine 8.4 ± 1.4 6.2 ± 2.7  
Testes and epididymis 2.6 ± 1.1 64.8 ± 56.4* 
Bladder 7.1 ± 3.0 278.6 ± 176.2* 
Prostate 8.0 ± 3.4 315.1 ± 178.4* 
Salivary glands 109.8 ± 10.2 429.9 ± 153.7* 
Skeletal muscle 5.4 ± 1.8 6.4 ± 3.6  
Nonpregnant uterus 7.2 ± 3.8 14.6 ± 1.6  
Pregnant uterus 120.4 ± 3.2 116.3 ± 7.7 
Tissue CSF-1 concentration (pg/mg tissue) 
+/Csf1op Csf1op/Csf1op; TgC/+ 
Lymph nodes 14.3 ± 3.7 11.8 ± 4.9 
Thymus 16.0 ± 3.3 13.5 ± 5.9 
Heart 6.5 ± 2.6 7.0 ± 1.4 
Lungs 16.6 ± 8.1 15.7 ± 6.5 
Liver 2.8 ± 1.9 2.4 ± 1.4 
Stomach 7.0 ± 2.8 6.5 ± 2.7 
Pancreas 10.5 ± 4.9 6.3 ± 2.6 
Spleen 14.0 ± 6.2 11.1 ± 4.9  
Small intestine 12.0 ± 8.9 9.4 ± 6.2 
Kidneys 7.8 ± 2.6 5.9 ± 3.5  
Large intestine 8.4 ± 1.4 6.2 ± 2.7  
Testes and epididymis 2.6 ± 1.1 64.8 ± 56.4* 
Bladder 7.1 ± 3.0 278.6 ± 176.2* 
Prostate 8.0 ± 3.4 315.1 ± 178.4* 
Salivary glands 109.8 ± 10.2 429.9 ± 153.7* 
Skeletal muscle 5.4 ± 1.8 6.4 ± 3.6  
Nonpregnant uterus 7.2 ± 3.8 14.6 ± 1.6  
Pregnant uterus 120.4 ± 3.2 116.3 ± 7.7 

CSF-1 indicates colony-stimulating factor 1.

Mean ± SEM, at least 3 mice per tissue.

*

All values exceeded means for +/Csf1op tissues. Except where indicated (

), differences between +/Csf1op andCsf1op/Csf1op; TgC/+ are not significant (P ≥ .05) by 2-tailed t test for 2 samples of unequal variance.

TgC rescue ofCsf1op/Csf1opmouse reproductive defects

The important role of CSF-1 in ovulation, preimplantation, placental function, regulation of the estrus cycle, and lactation has been previously described.2,42,43 Estrus cycling times are disturbed in matureCsf1op/Csf1op mice, with estrus occurring irregularly and more infrequently (average duration 14.5 days) than the estrus times of normal mice (about 5 days). The estrus cycling time of femaleCsf1op/Csf1op; TgC/+ mice, determined by the appearance in the vagina of exfoliated anuclear cornified cells and the absence of macrophages,43 was 4.5 ± 0.6 days (n = 5). This was indistinguishable from the cycling time for their phenotypically normal +/Csf1op siblings (4.8 ± 0.2 days). The litter size (about 7 pups) of theCsf1op/Csf1op; TgC/+ CSF-1 mice was similarly normal. Furthermore, even though only 10% ofCsf1op/Csf1op mothers feed pups,44 observation of more than 20 litters resulting from Csf1op/Csf1op; TgC/+ × Csf1op/Csf1op+/+ crosses indicate thatCsf1op/Csf1op; TgC/+ mothers were able to raise normal-size litters.

Csf1op/Csf1op male mice have low testosterone levels, a low libido, and reduced viable sperm numbers compared with normal males and mate infrequently, displaying a long latency between mating when presented serially with female mice in estrus.45 Restoration of normal male libido was apparent in Csf1op/Csf1op; TgC/+ mice, which mated frequently with cycling females and produced plugged females on successive days following daily exposure to different superovulated females (data not shown).

Expression of TgC transgene mRNA

A labeled RNA probe covering exon 9 and hGH sequences that allowed the simultaneous comparison of endogenous and transgenic CSF-1 mRNA by RPA (Figure 1B) revealed that the CSF-1 transgene mRNA was detected in each of the tissues examined (Figure5A). However, the amount of transgene-specific mRNA containing the hGH sequences was low compared with that of the endogenous exon 9–containing CSF-1 mRNA. Because the ratio of the 2.0-kb exon 9–containing CSF-1 mRNA to the 4.0-kb exon 10–containing CSF-1 mRNA is lower in tissues ofCsf1op/Csf1op mice than in +/+ mice,23,26 the high levels of exon 9–containing mRNA detected in Csf1op/Csf1op; TgC/+ tissues (Figure 5A) prompted us to use an exon 10 probe (Figure 1A) with the exon 9/hGH probe to examine the relative contributions of the alternatively spliced exon 9– and exon 10–containing versions of CSF-1 mRNA inCsf1op/Csf1op; TgC/+, wild-type, andCsf1op/Csf1op mice (Figure 5B). This comparison demonstrated a much higher ratio of exon 9– to exon 10–containing mRNA in the tissues ofCsf1op/Csf1op; TgC/+ mice than in the tissues of theirCsf1op/Csf1op littermates (Figure 5B, right panel), indicating that the high expression of exon 9 mRNA relative to the transgene in Figure 5A is due to use of the endogenous CSF-1 poly(A) addition site upstream of the hGH poly(A) addition sequences in the transgene. Thus, the CSF-1 transgene mRNA is expressed at sufficiently high levels to explain the normalization of CSF-1 in most tissues of Csf1op/Csf1op; TgC/+ mice.

Fig. 5.

Tissue expression of TgC mRNA.

TgC and endogenous CSF-1 mRNAs in 10 μg aliquots of total RNA were quantitated by RPA using the exon 9/hGH and exon 10 cDNA probes illustrated in Figure 1A,B. (A) Messenger RNA products protected by the exon 9/hGH probe, which correspond to the exon 9 UTR-containing CSF-1 mRNA (exon 9) and the hGH poly(A) UTR-containing TgC mRNA (Transgene), are indicated. TgC mRNA was detected in each of the tissues examined, apparently at low levels compared with the levels of endogenous CSF-1 mRNA. All samples were electrophoresed in the same gel and the data captured by phosphoimager; intensity of bands in the lower portion of the figure has been reduced to improve resolution. (B) RPA of RNA samples from selected tissues of mice of the indicated genotype, using the exon 9/hGH and exon 10 cDNA probes. Bands representing the exon 9– and exon 10–containing transcripts are indicated. The exon 9 probe generally detects 2 CSF-1–specific bands. Comparison of the 3 panels indicates that exon 9–containing CSF-1 mRNA is decreased inCsf1op/Csf1op tissues relative to +/+ tissues and restored to normal inCsf1op/Csf1optissues by expression of TgC.

Fig. 5.

Tissue expression of TgC mRNA.

TgC and endogenous CSF-1 mRNAs in 10 μg aliquots of total RNA were quantitated by RPA using the exon 9/hGH and exon 10 cDNA probes illustrated in Figure 1A,B. (A) Messenger RNA products protected by the exon 9/hGH probe, which correspond to the exon 9 UTR-containing CSF-1 mRNA (exon 9) and the hGH poly(A) UTR-containing TgC mRNA (Transgene), are indicated. TgC mRNA was detected in each of the tissues examined, apparently at low levels compared with the levels of endogenous CSF-1 mRNA. All samples were electrophoresed in the same gel and the data captured by phosphoimager; intensity of bands in the lower portion of the figure has been reduced to improve resolution. (B) RPA of RNA samples from selected tissues of mice of the indicated genotype, using the exon 9/hGH and exon 10 cDNA probes. Bands representing the exon 9– and exon 10–containing transcripts are indicated. The exon 9 probe generally detects 2 CSF-1–specific bands. Comparison of the 3 panels indicates that exon 9–containing CSF-1 mRNA is decreased inCsf1op/Csf1op tissues relative to +/+ tissues and restored to normal inCsf1op/Csf1optissues by expression of TgC.

Development of F4/80+ tissue macrophages inCsf1op/Csf1op; TgC/+ mice

Examination of the development of cells expressing the macrophage-specific cell-surface protein F4/80 in tissues ofCsf1op/Csf1op mice indicated that most F4/80 macrophage populations are partially or completely dependent on CSF-1 for their development and maintenance.30 To assess whether expression of TgC inCsf1op/Csf1op mice reconstituted F4/80+ macrophage expression in these tissues, F4/80+ macrophages inCsf1op/Csf1op; TgC/+,Csf1op/Csf1op, and normal (+/Csf1op) mice were quantified in tissues prepared from mice at the ages where the F4/80+ macrophage density had previously been shown30 to be maximum for the particular wild-type tissue (Table 3). Previous studies showed that injected CSF-1 is unable to restore F4/80+ macrophages, which colonize the adrenal gland and dense connective tissues including tendon, striated muscle, deep dermis, synovium, and periosteum.30 F4/80+macrophages in these tissues are completely recovered in the tissues of Csf1op/Csf1op; TgC/+ mice, being present at slightly elevated numbers compared with their density in normal tissues (Figure6, Table 3). Tissues containing CSF-1–dependent F4/80+ macrophages that are only partially restored by injection of CSF-1 include bladder, sublingual salivary gland, stomach, and villus cores of the small intestine and large intestine.30 With the exception of bladder, which showed a partial response to expression of TgC, F4/80+ macrophages in these tissues were also restored to at least normal levels (Figure6, Table 3). Tissues in which F4/80+ macrophages attained at least normal levels with restoration of circulating CSF-1 by injection included tissues such as kidney, liver, and spleen. F4/80+ macrophages were restored to normal levels in these tissues in Csf1op/Csf1op; TgC/+ mice (Table 3). In lymph node and thymus and among epidermal Langerhans cells and bone marrow monocytes, examined at ages in which the F4/80+ macrophage density was relatively normal inCsf1op/Csf1opmice,30 the F4/80+ cell densities forCsf1op/Csf1op; TgC/+ mice approximated those of bothCsf1op/Csf1op and +/Csf1op mice, except in the case of thymus where the F4/80+ macrophage density was somewhat lower forCsf1op/Csf1op mice than previously reported. Macrophages interdigitating with Leydig cells in the intertubular spaces of the testes have been shown to be almost completely absent inCsf1op/Csf1opmice.46 Compared with +/Csf1opmice, their numbers in Csf1op/Csf1op; TgC/+ mice (Figure 6) were slightly higher (Table 3). These data indicate that TgC confers approximately normal regulation of the development of all CSF-1–dependent F4/80+ tissue macrophage populations examined.

Table 3.

Densities of F4/80+ macrophages inCsf1op/Csf1op, +/Csf1op, andCsf1op/Csf1op; TgC/+ mice

Tissue and age Tissue F4/80+ cell density 
Csf1op/Csf1op +/Csf1op Csf1op/Csf1op; TgC/+ 
2 days    
 Muscle 24 188 339 
 Tendon 463 2174 8015  
 Deep dermis 1179 6217 5248  
 Liver 658 1581 1035  
2 weeks    
 Stomach 726 971 1006  
 Small intestine 35 455 322  
 Large intestine 80 1943 2029  
 Lymph node 980 1101 1241 
 Thymus 294 1423 1571 
 Periosteum3-150 16 21  
 Kidney cortex 24 262 661  
 Kidney medulla 89 1393 1785 
 Epidermal Langerhans cells3-150 93 66 104 
 Testis3-151 3.4 5.7  
3 months    
 Bladder3-150 59 19 
 Spleen 786 1231 1719  
 Adrenal 65 262 690 
 Sublingual salivary gland 52 251 254  
 Synovial type “A” cells3-150 181 252  
 Bone marrow monocytes 1556 2206 2620 
Tissue and age Tissue F4/80+ cell density 
Csf1op/Csf1op +/Csf1op Csf1op/Csf1op; TgC/+ 
2 days    
 Muscle 24 188 339 
 Tendon 463 2174 8015  
 Deep dermis 1179 6217 5248  
 Liver 658 1581 1035  
2 weeks    
 Stomach 726 971 1006  
 Small intestine 35 455 322  
 Large intestine 80 1943 2029  
 Lymph node 980 1101 1241 
 Thymus 294 1423 1571 
 Periosteum3-150 16 21  
 Kidney cortex 24 262 661  
 Kidney medulla 89 1393 1785 
 Epidermal Langerhans cells3-150 93 66 104 
 Testis3-151 3.4 5.7  
3 months    
 Bladder3-150 59 19 
 Spleen 786 1231 1719  
 Adrenal 65 262 690 
 Sublingual salivary gland 52 251 254  
 Synovial type “A” cells3-150 181 252  
 Bone marrow monocytes 1556 2206 2620 

Data are from at least 12 low-power fields of tissues from 2 mice of each genotype. SDs for multiple counts (n > 5) were less than 10% of means. Densities expressed in cells/mm2 except where indicated.

F3-150

Densities in cells/mm.

F3-151

Densities in cells per interstitial cell group.

Fig. 6.

Restoration of CSF-1–dependent F4/80+ macrophage populations in

Csf1op/Csf1opmice expressing TgC. Tissues were subjected to immunostaining with the macrophage-specific monoclonal antibody F4/80. Sagittal sections of 3-month-old knee joints, showing bone marrow (BM) and periosteum (PO) (A-C) and synovial membrane (SM) (D-F). Longitudinal section of 2-week-old tibia, showing tendon (TD) (G-I), transverse sections of 2-week-old testes (J-L), and transverse sections of 3-month-old mouse sublingual salivary gland (M-O; panel M counterstained). Arrows point to regions of F4/80+staining. Bar: 50 μm.

Fig. 6.

Restoration of CSF-1–dependent F4/80+ macrophage populations in

Csf1op/Csf1opmice expressing TgC. Tissues were subjected to immunostaining with the macrophage-specific monoclonal antibody F4/80. Sagittal sections of 3-month-old knee joints, showing bone marrow (BM) and periosteum (PO) (A-C) and synovial membrane (SM) (D-F). Longitudinal section of 2-week-old tibia, showing tendon (TD) (G-I), transverse sections of 2-week-old testes (J-L), and transverse sections of 3-month-old mouse sublingual salivary gland (M-O; panel M counterstained). Arrows point to regions of F4/80+staining. Bar: 50 μm.

Normalization of hematopoietic parameters inCsf1op/Csf1op; TgC/+ mice

To examine the hematopoietic status of theCsf1op/Csf1op; TgC/+ mice, bone marrow, spleen, and hematopoietic progenitor cell numbers were determined at 6 weeks of age (Table 4). The reduced bone marrow cellularity ofCsf1op/Csf1op mice was restored to normal by expression of TgC. Consistent with their reduced space for marrow hematopoiesis and in agreement with their reported compensatory splenic hematopoiesis,40 the splenic cellularities of 6-week-oldCsf1op/Csf1op mice were significantly elevated compared with those of +/Csf1op mice. As expected from their normal bone marrow cellularity, these parameters inCsf1op/Csf1op; TgC/+ mice were indistinguishable from those of +/Csf1op mice. In agreement with previous reports,28,47 blood monocyte and lymphocyte percentages were reduced inCsf1op/Csf1op mice and, consistent with one other report,48 blood granulocyte percentages were increased. All these changes were normalized in the blood of the Csf1op/Csf1op; TgC/+mice (Figure 7, Table 4). Previous studies have shown that the Csf1op mutation does not alter the relative frequency of BFU-E, CFU-GEMM, HPP-CFC, or CFU-C progenitor cells in the bone marrow.40 There was no significant difference in the frequency of these various progenitors in the bone marrows of Csf1op/Csf1op; TgC/+,Csf1op/Csf1op, and +/Csf1op mice (Table 4).

Table 4.

Hematopoietic tissue parameters

Parameter Csf1op/Csf1op +/Csf1op Csf1op/Csf1op; TgC/+ 
Bone marrow cellularity, × 10−6cells per femur4-150 6.3 ± 0.9 19.8 ± 1.5 16.2 ± 0.6 
Splenic weight, g 0.083 ± 0.05 0.097 ± 0.01 0.109 ± 0.03  
Splenic cellularity, × 10−9/g4-150 2.9 ± 0.6 1.5 ± 0.17 1.5 ± 0.1 
Blood cellularity    
 Total leukocytes, × 10−6/mL 5.9 ± 1.1 5.0 ± 0.3 4.7 ± 0.6 
 Monocytes, %4-150 0.9 ± 0.2 7.3 ± 0.8 8.1 ± 0.8 
 Granulocytes, %4-150 30.9 ± 4.6 6.9 ± 0.3 11.5 ± 1.8 
 Lymphocytes, %4-150 53.0 ± 4.3 76.1 ± 1.3 68.3 ± 0.8 
 B220+ lymphocytes, %4-150 18.3 ± 1.1 38.0 ± 1.3 42.2 ± 1.9 
Bone marrow4-151    
 BFU-E 19.2 ± 2.0 21.5 ± 2.9 19.2 ± 3.2 
 CFU-GEMM 11.5 ± 1.8 9.3 ± 1.3 10.2 ± 1.6 
 HPP-CFC 3.3 ± 0.4 3.0 ± 0.5 3.0 ± 0.4 
 CFU-C 25.0 ± 3.7 32.5 ± 2.9 21.8 ± 1.3 
Parameter Csf1op/Csf1op +/Csf1op Csf1op/Csf1op; TgC/+ 
Bone marrow cellularity, × 10−6cells per femur4-150 6.3 ± 0.9 19.8 ± 1.5 16.2 ± 0.6 
Splenic weight, g 0.083 ± 0.05 0.097 ± 0.01 0.109 ± 0.03  
Splenic cellularity, × 10−9/g4-150 2.9 ± 0.6 1.5 ± 0.17 1.5 ± 0.1 
Blood cellularity    
 Total leukocytes, × 10−6/mL 5.9 ± 1.1 5.0 ± 0.3 4.7 ± 0.6 
 Monocytes, %4-150 0.9 ± 0.2 7.3 ± 0.8 8.1 ± 0.8 
 Granulocytes, %4-150 30.9 ± 4.6 6.9 ± 0.3 11.5 ± 1.8 
 Lymphocytes, %4-150 53.0 ± 4.3 76.1 ± 1.3 68.3 ± 0.8 
 B220+ lymphocytes, %4-150 18.3 ± 1.1 38.0 ± 1.3 42.2 ± 1.9 
Bone marrow4-151    
 BFU-E 19.2 ± 2.0 21.5 ± 2.9 19.2 ± 3.2 
 CFU-GEMM 11.5 ± 1.8 9.3 ± 1.3 10.2 ± 1.6 
 HPP-CFC 3.3 ± 0.4 3.0 ± 0.5 3.0 ± 0.4 
 CFU-C 25.0 ± 3.7 32.5 ± 2.9 21.8 ± 1.3 

At least three 6- to 8-week-old mice per experimental group. Data are expressed as means ± SEM. BFU-E and CFU-GEMM: 1.5 × 104 cells per plate (n = 6); HPP-CFC: 2.5 × 103 cells per plate (n = 6); and CFU-C: 1 × 104 cells per plate (n = 9).

BFU-E indicates burst-forming unit–erythroid; CFU-GEMM, colony-forming unit–granulocyte, erythroid, macrophage, megakaryocyte; HPP-CFC, colony-forming cells of high proliferative potential; CFU-C, colony-forming cells of low proliferative potential.

F4-150

From FACS analyses (Figure 7). Differences betweenCsf1op/Csf1op; TgC/+ andCsf1op/Csf1op mice significant (P < .01) and differences betweenCsf1op/Csf1op; TgC/+ and+/Csf1op not significant (P > .05) by Student t test.

F4-151

Differences not significant within assays (P ≥ .05) by Student t test.

Fig. 7.

FACS analysis of blood monocytes, granulocytes, and lymphocytes by forward and side light scatter.

Separate regions encompassing the monocyte (M), granulocyte (G), and lymphocyte (L) subpopulations are indicated. Quantitative results for mice of each genotype are summarized in Table 5.

Fig. 7.

FACS analysis of blood monocytes, granulocytes, and lymphocytes by forward and side light scatter.

Separate regions encompassing the monocyte (M), granulocyte (G), and lymphocyte (L) subpopulations are indicated. Quantitative results for mice of each genotype are summarized in Table 5.

Localization of in vivo sites of CSF-1 synthesis

TgC drives relatively normal tissue-specific and developmental expression of CSF-1 and corrects all the major aspects of theCsf1op/Csf1op phenotype. To rapidly identify CSF-1–synthesizing cells within tissues, we constructed a transgene with the same regulatory regions but encoding β-galactosidase instead of CSF-1 (TgN(Csf1-Z)Ers [TgZ], Figure 1C). Two transgenic founder mice were obtained, only one of which transmitted the transgene. TgZ/+ mice showed no abnormal phenotype and were used exclusively for this study.

Analysis of the expression of β-galactosidase was carried out in hematopoietic (Figure 8), reproductive (Figure 9), and other (Figure10) tissues from normal 7-week-old wild-type mice expressing TgZ. In hematopoietic tissues (Figure 8), cells expressing β-galactosidase were found in splenic red pulp and marginal zone (Figure 8A,B) and in outer cortical regions of the lymph node, where macrophages are concentrated and were excluded from the white pulp and germinal centers that are relatively devoid of macrophages (Figure 8C,D).30 In thymus, positive cells were scattered within the cortex, an area rich in macrophages (Figure8E,F). In the bone marrow (Figure 8G-I), the location and shape of the β-galactosidase–expressing cells were characteristic of bone marrow stromal fibroblasts and osteoblasts previously shown to synthesize CSF-1.49,50 

Fig. 8.

CSF-1 promoter/first intron–driven β-galactosidase (TgZ) expression in hematopoietic tissues.

Stained with H&E (A, C, E, G), X-gal (A-I; some positive cells indicated by black arrows), and TRAP (I; some TRAP-positive cells indicated by red arrows). (A, B) Spleen, indicating staining of cells in the marginal zone (MZ), less intensely in the red pulp (RP), and their exclusion from the white pulp (WP). (C, D) Lymph node, showing staining of the outer cortex (OC) and the region (*) between 2 germinal centers (GC). (E, F) Thymus, revealing the presence of scattered cells in the cortex. (G-I) Bone marrow, showing β-galactosidase–expressing cells and TRAP-positive cells lining the surfaces of the bony trabeculae (T) in regions in which bone marrow fibroblasts, osteoblasts, and osteoclasts reside. TRAP-positive cells are also shown in the primary center of ossification (CO). Nuclear staining of β-galactosidase is often accompanied by some cytoplasmic staining, due to incomplete transfer of the enzyme to the nucleus. Bars: 50 mm.

Fig. 8.

CSF-1 promoter/first intron–driven β-galactosidase (TgZ) expression in hematopoietic tissues.

Stained with H&E (A, C, E, G), X-gal (A-I; some positive cells indicated by black arrows), and TRAP (I; some TRAP-positive cells indicated by red arrows). (A, B) Spleen, indicating staining of cells in the marginal zone (MZ), less intensely in the red pulp (RP), and their exclusion from the white pulp (WP). (C, D) Lymph node, showing staining of the outer cortex (OC) and the region (*) between 2 germinal centers (GC). (E, F) Thymus, revealing the presence of scattered cells in the cortex. (G-I) Bone marrow, showing β-galactosidase–expressing cells and TRAP-positive cells lining the surfaces of the bony trabeculae (T) in regions in which bone marrow fibroblasts, osteoblasts, and osteoclasts reside. TRAP-positive cells are also shown in the primary center of ossification (CO). Nuclear staining of β-galactosidase is often accompanied by some cytoplasmic staining, due to incomplete transfer of the enzyme to the nucleus. Bars: 50 mm.

Fig. 9.

TgZ expression in female reproductive tissues.

Stained with H&E (E,I) and X-gal (A-J). Whole-mount staining of the fourth inguinal mammary gland: (A) nontransgenic, (B) transgenic, (C) high-power image of the boxed region in (B) (TEB, terminal end buds), and (D) high-power image of portion of mammary gland from a 6-day pregnant transgenic mouse, showing positive staining of the ducts in the transgenic tissues. Note increased intensity of staining of blood vessels (BV) and lymph node (LN) in transgenic (B-D) compared with nontransgenic (A) tissue. (E-H) Uteri of nonpregnant (E, F) and 6-day pregnant (G, H) mice and the presence of positive cells in the myometrium (G), some of which are localized to regions previously shown to contain macrophages.59 (I, J) Ovary of transgenic mice, showing β-galactosidase expression in granulosa cells surrounding the secondary follicles (SF). Bars: (A-D) 5 mm; (E-J) 50 mm.

Fig. 9.

TgZ expression in female reproductive tissues.

Stained with H&E (E,I) and X-gal (A-J). Whole-mount staining of the fourth inguinal mammary gland: (A) nontransgenic, (B) transgenic, (C) high-power image of the boxed region in (B) (TEB, terminal end buds), and (D) high-power image of portion of mammary gland from a 6-day pregnant transgenic mouse, showing positive staining of the ducts in the transgenic tissues. Note increased intensity of staining of blood vessels (BV) and lymph node (LN) in transgenic (B-D) compared with nontransgenic (A) tissue. (E-H) Uteri of nonpregnant (E, F) and 6-day pregnant (G, H) mice and the presence of positive cells in the myometrium (G), some of which are localized to regions previously shown to contain macrophages.59 (I, J) Ovary of transgenic mice, showing β-galactosidase expression in granulosa cells surrounding the secondary follicles (SF). Bars: (A-D) 5 mm; (E-J) 50 mm.

Fig. 10.

TgZ expression in other tissues.

Stained with H&E (A, C, E, G, I, K) and X-gal (A-L). (A, B) Small intestine, showing β-galactosidase staining in Paneth cells at the base of the crypts. (C, D) Stomach, revealing staining of cells at the base of the crypts of the pyloric glands. (E, F) Salivary gland, demonstrating strong positive staining of serous acinar cells. (G, H) Adrenal gland, showing positive cells in the zona reticularis. (I, J) Skin, indicating positive staining of cells in the neck of the sebaceous gland. (K, L) Testis, showing β-galactosidase–positive interstitial cells. Bars: 50 mm.

Fig. 10.

TgZ expression in other tissues.

Stained with H&E (A, C, E, G, I, K) and X-gal (A-L). (A, B) Small intestine, showing β-galactosidase staining in Paneth cells at the base of the crypts. (C, D) Stomach, revealing staining of cells at the base of the crypts of the pyloric glands. (E, F) Salivary gland, demonstrating strong positive staining of serous acinar cells. (G, H) Adrenal gland, showing positive cells in the zona reticularis. (I, J) Skin, indicating positive staining of cells in the neck of the sebaceous gland. (K, L) Testis, showing β-galactosidase–positive interstitial cells. Bars: 50 mm.

Expression of β-galactosidase recapitulated previously documented sites of synthesis in the uterus and ovary and revealed new sites of expression in the mammary gland (Figure 9). In mammary gland, there was extensive staining of the entire ductal network (Figure 9C) with strong staining in the terminal end buds (Figure 9B) but with minimal expression in the fat pad. Expression was also seen in the blood vessels and lymph node (Figure 9B-D). Ductal expression was maintained during arborization early in pregnancy (Figure 9D). In the uterus, the β-galactosidase expression was restricted to epithelial cells of uteri of both nonpregnant (Figure 9E,F) and day 6 pregnant mice (Figure9G,H), increasing with pregnancy, as previously reported for CSF-1 synthesis by this epithelium21 (Table 2). Focal staining of individual cells was also observed in the myometrium of the pregnant uteri, particularly close to the mesometrial attachment (Figure 9G). Expression of β-galactosidase in the ovary was restricted to the granulosa cells of the developing follicles, with no expression observed in the oocyte (Figure 9I,J).

New sites of CSF-1 synthesis are also indicated for other tissues (Figure 10). The β-galactosidase stained Paneth cells at the base of the crypts of the small intestine (Figure 10A,B) close to regions of CSF-1–dependent macrophage localization in the muscularis externa51 and, similarly, in the base of the crypts of the pyloric glands of the stomach (Figure 10C,D). There was strong positive staining of serous acinar cells of the salivary gland (Figure 10E,F) adjacent to and on the basal side of which F4/80+macrophages reside (Figure 6N,O) and consistent with the high CSF-1 content of this gland.36 The zona reticularis of the adrenal gland (Figure 10G,H) and the neck of the sebaceous gland also contained β-galactosidase–expressing cells (Figure 10I,J). In testis, there was staining of interstitial cells (Figure 10K,L), regions of Leydig cell, and CSF-1–dependent macrophage colocalization.46,52 Also, β-galactosidase staining of the epithelial cells of the proximal convoluted tubules of the kidney and of the blood vessels and cortex of the brain was observed (data not shown).

Discussion

We have shown that expression of a transgene encoding full-length CSF-1 under the control of 3.13 kb of the CSF-1 promoter and first intron completely corrected the gross defects of the CSF-1–nullCsf1op/Csf1op mouse, including the osteopetrotic, neurologic, weight, skeletal, tooth eruption, hematopoietic, and reproductive defects. Save for overexpression in 4 tissues, it normalized CSF-1 expression in the circulation and in tissues, including uterus during pregnancy, where CSF-1 expression is dramatically increased. In addition, expression of the transgene restored tissue F4/80+ macrophage densities in a temporally correct fashion. These results suggest that this transgene provides all the forms of CSF-1 necessary for normal regulation of both locally and humorally regulated target cells. This point is emphasized in Table5, which summarizes the relative incompleteness of the reconstitution of F4/80+ macrophage densities in Csf1op/Csf1op mice injected with CSF-1, compared with those expressing the transgene.

Table 5.

Relative restoration of F4/80+ tissue macrophage development by colony-stimulating factor 1 injection and by TgC expression

F4/80+ tissue  macrophages   CSF-1 requirement Response ofCsf1op/Csf1op
mouse to postnatal injection of CSF-1 
Response ofCsf1op/Csf1op mouse to Tgc 
Muscle Complete None Complete 
Tendon Complete None Complete 
Periosteum Complete None Complete 
Synovium Complete None Complete 
Dermis Complete Partial/none Complete 
Kidney Complete Complete Complete 
Testes Complete Complete Complete  
Adrenal gland Partial None Complete 
Bladder Partial Partial Partial 
Stomach Partial Partial Complete  
Small intestine Partial Partial Complete  
Sublingual salivary gland Partial Partial Complete 
Liver Partial Complete Complete 
Spleen Partial Complete Complete 
Thymus Partial None Complete 
Epidermis None None None  
Lymph node None None None  
Bone marrow monocyte None None None 
F4/80+ tissue  macrophages   CSF-1 requirement Response ofCsf1op/Csf1op
mouse to postnatal injection of CSF-1 
Response ofCsf1op/Csf1op mouse to Tgc 
Muscle Complete None Complete 
Tendon Complete None Complete 
Periosteum Complete None Complete 
Synovium Complete None Complete 
Dermis Complete Partial/none Complete 
Kidney Complete Complete Complete 
Testes Complete Complete Complete  
Adrenal gland Partial None Complete 
Bladder Partial Partial Partial 
Stomach Partial Partial Complete  
Small intestine Partial Partial Complete  
Sublingual salivary gland Partial Partial Complete 
Liver Partial Complete Complete 
Spleen Partial Complete Complete 
Thymus Partial None Complete 
Epidermis None None None  
Lymph node None None None  
Bone marrow monocyte None None None 

CSF-1 indicates colony-stimulating factor 1.

The exon 9 poly(A) addition signal was used quite efficiently in the transgene, although transcripts derived from use of the hGH poly(A) addition signal were present in each tissue examined. The exon 10 3′ UTR contains AU-rich repeats, absent in exon 9, that in the right context confer a short half-life on mRNAs.10,53 Thus, the high levels of expression of CSF-1 in the secretory organs, bladder, testes/epididymis, prostate, and salivary glands may result from the use of the exon 9 3′ UTR in the transgene, because the levels of mRNA for 2 of the 4 tissues examined, testis and salivary gland, are significantly elevated over their expression in +/Csf1op mice.

Although the detailed data presented here are analyses of a single CSF-1 transgenic line, an identical gross phenotype was observed with a second independent line that expressed 3-fold higher levels of circulating CSF-1. In addition, we have recently used the same CSF-1 promoter/intron 1 region to drive expression of another form of CSF-1 encoded by a truncated CSF-1 cDNA and have shown that it has a similar pattern of tissue expression (data not shown). For the above reasons, we believe that the pattern of tissue CSF-1 expression driven by the promoter/first intron is position- and copy number–independent. Furthermore, as we have also shown here, this regulatory region drives expression of a lacZ reporter gene specifically in all previously documented sites of local CSF-1 synthesis within tissues. Thus, the 3.13-kb CSF-1 promoter/first intron are apparently sufficient to regulate normal CSF-1 gene expression. Previous studies of the regulation of CSF-1 gene expression have utilized CSF-1 reporter constructs containing 774 bp of the mouse CSF-1 promoter transfected into fibroblasts, monocytes, osteoblast-like, and COS-7 cell lines.54,55 Several putative trans-acting factors forcis-acting elements in this region of the promoter have been identified,54 and it has been shown that expression in different cell types is mediated by common and by cell type–specific transcription factors.54,56 However, the minimal promoter length required for normal tissue-specific and developmental expression has not been established, and modulation of CSF-1 gene expression by parathyroid hormone (PTH), tumor necrosis factor-α, Il-1α, and 1,25 (OH)2D3 observed in vivo is not reproduced with the 774-bp promoter construct.55 The present studies establish regulatory regions required for normal CSF-1 gene expression that can be further investigated by deletion/mutation.

Although previous experiments involving transfection of the full-length exon 10–containing CSF-1 cDNA into NIH3T3 cells failed to demonstrate cell-surface expression of the more truncated glycoprotein, the expression of the larger more prominent proteoglycan was not studied.13 Consistent with our observation of cell-surface expression in Csf1op/Csf1op; TgC/+fibroblasts, others have demonstrated cell-surface expression in COS-7 cells expressing full-length CSF-1 cDNA.11 Whether the surface expression is due to a membrane-spanning or membrane-associated CSF-1 remains to be established.

As indicated above (Table 5), restoration of circulating CSF-1 inCsf1op/Csf1op mice by daily injection of CSF-1 was only partially successful in correcting the Csf1op/Csf1opdefects, suggesting that either CSF-1 must be given embyronically, be synthesized locally, be expressed on the surface of cells, contain the correct glycosaminoglycan as the proteoglycan form, or various combinations of these possibilities for complete correction of theCsf1op/Csf1op defects to occur. The present successful correction by the full-length transgene is likely to have satisfied all of these putative requirements but is unable to resolve which requirement is necessary for correction of each particular defect. Using this promoter/intron combination to drive appropriate CSF-1 cDNAs, it should be possible to independently investigate the roles of the secreted glycoprotein, secreted proteoglycan, and cell-surface forms of the growth factor.

The pattern of the transgenic expression of β-galactosidase under the control of the same CSF-1 promoter/first intron driver also indicates that the TgC transgene correctly directs local tissue expression of CSF-1. First, β-galactosidase was expressed at several tissue locations shown to synthesize CSF-1 by in situ hybridization or immunohistochemical/cell culture approaches. Thus, CSF-1 is synthesized in the uterine glandular epithelium of pregnant mice,21bone marrow fibroblasts57 and osteoblasts,19,20 endothelial cells,18 and ovarian granulosa cells (K. Nishimura, P. Cohen, L. Zhu, and J.W.P., unpublished data, August 1997), all sites shown to express β-galactosidase in TgZ/+ mice. Second, β-galactosidase was expressed at several additional tissue locations in which CSF-1–responding cells are localized but which have not been previously reported to synthesize CSF-1, including the ductal epithelium of the mammary gland,58 the myometrium,59 testicular Leydig cells,46 the marginal zone60 and red pulp30 of the spleen, the cortex and medulla of the lymph node, the cortex of the thymus, the base of the crypts of the small intestine, stomach, and sublingual salivary gland,30,51 and the cortical tubules of the kidney.61 Local synthesis of CSF-1 is apparently responsible for macrophage regulation and/or presence at these sites.

Analysis of TgZ/+ mice suggests that synthesis of CSF-1 occurs at several novel sites besides those mentioned above, in which CSF-1–responding cells are localized. These sites include cells in the cortex and hypothalamus of the brain, cells in the zona reticularis of the adrenal gland, and cells in the neck of the sebaceous gland. Analysis of the role of CSF-1 synthesis at these sites and the sites mentioned above, in which CSF-1 synthesis juxtaposes CSF-1–responding cells, should greatly increase our understanding of local regulation by this growth factor.

Previous studies withCsf1op/Csf1op mice have indicated that CSF-1 target cells have important scavenger (eg, osteoclasts62), trophic (eg, testicular macrophages42,46,52), and immunologic (eg, trophoblasts63) roles in the development, maintenance, and function of the tissues in which they reside. Given the restricted distribution of the CSF-1 receptor to mononuclear phagocytes and cells of the female reproductive tract,1,2 such functions explain the pleiotropic nature of the Csf1opmutation.30 The present analysis of the TgZ mouse contributes significantly to our understanding of the local regulation of these cells. Consider, for example, reproduction. CSF-1 maintains ovulation rates and recruits macrophages to the growing follicle43 and to the uterine stroma during the estrus cycle.59 The uterine CSF-1 is locally synthesized from epithelial cells, which synthesize it in response to estrogen and, during pregnancy, progesterone.21,59 During pregnancy, its action on the trophoblast is necessary for effective immunologic responses to pathogens at the uteroplacental unit.63Expression of β-galactosidase recapitulated the previously demonstrated expression of CSF-1 in granulosa cells surrounding the developing follicle and in uterine luminal and glandular epithelial cells21,64 (L. Zhu and J.W.P., manuscript in preparation, August 1997). The relative failure of mammary epithelial development inCsf1op/Csf1opmice,44 characterized by a paucity of macrophages surrounding the terminal end buds, a low rate of ductal outgrowth, and fewer ductal branches, can be partially reversed by ductal epithelial expression of CSF-1 (A. V. Nguyen and J.W.P., manuscript in preparation, August 2000). The β-galactosidase expression in the mammary ductal tree and particularly the terminal end buds suggests that CSF-1 derived from these epithelial cells recruits macrophages to the developing structure where they enhance ductal outgrowth and development. In testis, each CSF-1-dependent macrophage (absent in Csf1op/Csf1op mice) contacts an average of 4 Leydig cells, apparently enhancing testosterone synthesis by the Leydig cells.45,46Expression of β-galactosidase by Leydig cells indicates that their expression of CSF-1 is responsible for macrophage recruitment to the interstitium. Similar CSF-1 regulatory roles can be envisaged for the cells we have shown to synthesize β-galactosidase in nonreproductive tissues.

We thank members of the Albert Einstein College of Medicine transgenic, histopathology, and analytical imaging facilities for assistance in different aspects of the work, Dr Sandy C. Marks Jr, for advice on TRAP staining, David Gebhard of the Albert Einstein College of Medicine FACS facility for assistance with the FACS analyses, and James Chaloupka, Alex Cho, Sara Kapp, Vonetta Sylvestre, Reza Zadeh, and Xiao-Hua Zong for technical assistance. We also acknowledge kind gifts of the CSF-1 promoter clone from Dr Michael Cole and monoclonal antibody F4/80 from Dr David Hume.

Supported by National Institutes of Health grants CA32551 (E.R.S.), HD30280 (J.W.P.), and HD35627 (J.W.P.), Albert Einstein College of Medicine Cancer Center grant 5P30-CA13330, and an American Society of Hematology fellowship (G.R.R.).

G.R.R. and X.-M.D. contributed equally to this work.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

References

References
1
Stanley
ER
CSF-1.
Cytokine Database. London
Oppenheim
JJ
Feldmann
M
2000
913
934
Academic Press
United Kingdom
2
Pollard
JW
Stanley
ER
Pleiotropic roles for CSF-1 in development defined by the mouse mutation osteopetrotic (op).
Adv Dev Biochem.
4
1996
153
193
3
Guilbert
LJ
Stanley
ER
Specific interaction of murine colony-stimulating factor with mononuclear phagocytic cells.
J Cell Biol.
85
1980
153
159
4
Byrne
PV
Guilbert
LJ
Stanley
ER
Distribution of cells bearing receptors for a colony-stimulating factor (CSF) in murine tissues.
J Cell Biol.
91
1981
848
853
5
Yeung
Y-G
Jubinsky
PT
Sengupta
A
Yeung
DC-Y
Stanley
ER
Purification of the colony-stimulating factor 1 receptor and demonstration of its tyrosine kinase activity.
Proc Natl Acad Sci U S A.
84
1987
1268
1271
6
Sherr
CJ
Rettenmier
CW
Sacca
R
Roussel
MF
Look
AT
Stanley
ER
The c-fms proto-oncogene product is related to the receptor for the mononuclear phagocyte growth factor, CSF-1.
Cell.
41
1985
665
676
7
Kawasaki
ES
Ladner
MB
Wang
AM
et al. 
Molecular cloning of a complementary DNA encoding human macrophage-specific colony-stimulating factor (CSF-1).
Science.
230
1985
291
296
8
Ladner
MB
Martin
GA
Noble
JA
et al. 
Human CSF-1: gene structure and alternative splicing of mRNA precursors.
EMBO J.
6
1987
2693
2698
9
Wong
GG
Temple
PA
Leary
AC
et al. 
Human CSF-1: molecular cloning and expression of 4-kb cDNA encoding the human urinary protein.
Science.
235
1987
1504
1508
10
Ladner
MB
Martin
GA
Noble
JA
et al. 
cDNA cloning and expression of murine macrophage colony-stimulating factor from L929 cells.
Proc Natl Acad Sci U S A.
85
1988
6706
6710
11
Cerretti
DP
Wignall
J
Anderson
D
et al. 
Human macrophage-colony stimulating factor: alternative RNA and protein processing from a single gene.
Mol Immunol.
25
1988
761
770
12
Kawasaki
ES
Ladner
MB
Molecular biology of macrophage colony-stimulating factor.
Immunol Ser.
49
1990
155
176
13
Rettenmier
CW
Roussel
MF
Differential processing of colony-stimulating factor 1 precursors encoded by two human cDNAs.
Mol Cell Biol.
8
1988
5026
5034
14
Manos
MM
Expression and processing of a recombinant human macrophage colony-stimulating factor in mouse cells.
Mol Cell Biol.
8
1988
5035
5039
15
Price
LKH
Choi
HU
Rosenberg
L
Stanley
ER
The predominant form of secreted colony stimulating factor-1 is a proteoglycan.
J Biol Chem.
267
1992
2190
2199
16
Suzu
S
Ohtsuki
T
Yanai
N
et al. 
Identification of a high molecular weight macrophage colony-stimulating factor as a glycosaminoglycan-containing species.
J Biol Chem.
267
1992
4345
4348
17
Rettenmier
CW
Roussel
MF
Ashmun
RA
Ralph
P
Price
K
Sherr
CJ
Synthesis of membrane-bound colony-stimulating factor 1 (CSF-1) and downmodulation of CSF-1 receptors in NIH 3T3 cells transformed by cotransfection of the human CSF-1 and c-fms (CSF-1 receptor) genes.
Mol Cell Biol.
7
1987
2378
2387
18
Roth
P
Stanley
ER
The biology of CSF-1 and its receptor.
Curr Top Microbiol Immunol.
181
1992
141
167
19
Elford
PR
Felix
R
Cecchini
M
Trechsel
U
Fleisch
H
Murine osteoblastlike cells and the osteogenic cell MC3T3–E1 release a macrophage colony-stimulating activity in culture.
Calcif Tissue Int.
41
1987
151
156
20
Hofstetter
W
Wetterwald
A
Cecchini
M
Felix
R
Mueller
C
Fleisch
H
Expression of M-CSF and of its receptor c-fms, in bone, as detected by in situ hybridization [abstract].
J Bone Miner Res.
6(suppl 1)
1991
S199
21
Pollard
JW
Bartocci
A
Arceci
R
Orlofsky
A
Ladner
MB
Stanley
ER
Apparent role of the macrophage growth factor, CSF-1, in placental development.
Nature.
330
1987
484
486
22
Suzu
S
Ohtsuki
T
Makishima
M
et al. 
Biological activity of a proteoglycan form of macrophage colony-stimulating factor and its binding to type V collagen.
J Biol Chem.
267
1992
16812
16815
23
Wiktor-Jedrzejczak
W
Bartocci
A
Ferrante
AW
Jr
et al. 
Total absence of colony-stimulating factor 1 in the macrophage-deficient osteopetrotic (op/op) mouse.
Proc Natl Acad Sci U S A.
87
1990
4828
4832
24
Yoshida
H
Hayashi
S-I
Kunisada
T
et al. 
The murine mutation “osteopetrosis” (op) is a mutation in the coding region of the macrophage colony stimulating factor (Csfm) gene.
Nature.
345
1990
442
444
25
Felix
R
Cecchini
MG
Fleisch
H
Macrophage colony stimulating factor restores in vivo bone resorption in the op/op osteopetrotic mouse.
Endocrinology.
127
1990
2592
2594
26
Pollard
JW
Hunt
JS
Wiktor-Jedrzejczak
W
Stanley
ER
A pregnancy defect in the osteopetrotic (op/op) mouse demonstrates the requirement for CSF-1 in female fertility.
Dev Biol.
148
1991
273
283
27
Marks
SC
Jr
Lane
PW
Osteopetrosis, a new recessive skeletal mutation on chromosome 12 of the mouse.
J Hered.
67
1976
11
18
28
Wiktor-Jedrzejczak
W
Ahmed
A
Szczylik
C
Skelly
RR
Hematological characterization of congenital osteopetrosis in op/op mouse.
J Exp Med.
156
1982
1516
1527
29
Felix
R
Cecchini
MG
Hofstetter
W
Elford
PR
Stutzer
A
Fleisch
H
Impairment of macrophage colony-stimulating factor production and lack of resident bone marrow macrophages in the osteopetrotic op/op mouse.
J Bone Miner Res.
5
1990
781
789
30
Cecchini
MG
Dominguez
MG
Mocci
S
et al. 
Role of colony stimulating factor-1 in the establishment and regulation of tissue macrophages during postnatal development of the mouse.
Development.
120
1994
1357
1372
31
Baumbach
WR
Colston
EM
Cole
MD
Integration of the BALB/c ecotropic provirus into the colony-stimulating factor-1 growth factor locus in a myc retrovirus-induced murine monocyte tumor.
J Virol.
62
1988
3151
3155
32
DeNoto
FM
Moore
DD
Goodman
HM
Human growth hormone DNA sequence and mRNA structure: possible alternative splicing.
Nucleic Acids Res.
9
1981
3719
3730
33
Fire
A
Harrison
SW
Dixon
D
A modular set of lacZ fusion vectors for studying gene expression in Caenorhabditis elegans.
Gene.
93
1990
189
198
34
Stanley
ER
Colony-stimulating factor (CSF) radioimmunoassay: detection of a CSF subclass stimulating macrophage production.
Proc Natl Acad Sci U S A.
76
1979
2969
2973
35
Stanley
ER
The macrophage colony-stimulating factor, CSF-1.
Methods Enzymol.
116
1985
564
587
36
Bartocci
A
Pollard
JW
Stanley
ER
Regulation of colony-stimulating factor 1 during pregnancy.
J Exp Med.
164
1986
956
961
37
Austyn
JM
Gordon
S
F4/80, a monoclonal antibody directed specifically against the mouse macrophage.
Eur J Immunol.
11
1981
805
815
38
Hennighausen
L
Wall
RJ
Tillmann
U
Li
M
Furth
PA
Conditional gene expression in secretory tissues and skin of transgenic mice using the MMTV-LTR and the tetracycline responsive system.
J Cell Biochem.
59
1995
463
472
39
O'Gorman
M
Phenotypic analysis.
Current Protocols in Cytometry.
Robinson
J
Darzynkiewicz
Z
Dean
PN
et al. 
1997
6.0.1
6.7.10
John Wiley and Sons
New York, NY
40
Begg
SK
Radley
JM
Pollard
JW
et al. 
Delayed hematopoietic development in osteopetrotic (op/op) mice.
J Exp Med.
177
1993
237
242
41
Michaelson
MD
Bieri
PL
Mehler
MF
et al. 
CSF-1 deficiency in mice results in abnormal brain development.
Development.
122
1996
2661
2672
42
Cohen
PE
Nishimura
K
Zhu
L
Pollard
JW
Macrophages: important accessory cells for reproductive function.
J Leukoc Biol.
66
1999
765
772
43
Cohen
PE
Zhu
L
Pollard
JW
Absence of colony stimulating factor-1 in osteopetrotic (csfmop/csfmop) mice disrupts estrous cycles and ovulation.
Biol Reprod.
56
1997
110
118
44
Pollard
JW
Hennighausen
L
Colony stimulating factor 1 is required for mammary gland development during pregnancy.
Proc Natl Acad Sci U S A.
91
1994
9312
9316
45
Cohen
PE
Chisholm
O
Arceci
RJ
Stanley
ER
Pollard
JW
Absence of colony-stimulating factor-1 in osteopetrotic (csfmop/csfmop) mice results in male fertility defects.
Biol Reprod.
55
1996
310
317
46
Pollard
JW
Dominguez
MG
Mocci
S
Cohen
PE
Stanley
ER
Effect of the colony-stimulating factor-1 null mutation, osteopetrotic (csfmop), on the distribution of macrophages in the male mouse reproductive tract.
Biol Reprod.
56
1997
1290
1300
47
Lieschke
GJ
Stanley
E
Grail
D
et al. 
Mice lacking both macrophage- and granulocyte-macrophage colony-stimulating factor have macrophages and coexistent osteopetrosis and severe lung disease.
Blood.
84
1994
27
35
48
Nilsson
SK
Lieschke
GJ
Garcia-Wijnen
CC
et al. 
Granulocyte-macrophage colony-stimulating factor is not responsible for the correction of hematopoietic deficiencies in the maturing op/op mouse.
Blood.
86
1995
66
72
49
Tanaka
S
Takahashi
N
Udagawa
N
et al. 
Macrophage colony-stimulating factor is indispensable for both proliferation and differentiation of osteoclast progenitors.
J Clin Invest.
91
1993
257
263
50
Hofstetter
W
Wetterwald
A
Cecchini
MG
Mueller
C
Felix
R
Detection of transcripts and binding sites for colony-stimulating factor-1 during bone development.
Bone.
17
1995
145
151
51
Mikkelsen
HB
Thuneberg
L
Op/op mice defective in production of functional colony-stimulating factor-1 lack macrophages in muscularis externa of the small intestine.
Cell Tissue Res.
295
1999
485
493
52
Cohen
PE
Hardy
MP
Pollard
JW
Colony-stimulating factor-1 plays a major role in the development of reproductive function in male mice.
Mol Endocrinol.
11
1997
1636
1650
53
Shaw
G
Kamen
R
A conserved AU sequence from the 3′ untranslated region of GM-CSF mRNA mediates selective mRNA degradation.
Cell.
46
1986
659
667
54
Harrington
M
Konicek
BW
Xia
XL
Song
A
Transcriptional regulation of the mouse CSF-1 gene.
Mol Reprod Dev.
46
1997
39
44
55
Rubin
J
Fan
D
Wade
A
et al. 
Transcriptional regulation of the expression of macrophage colony stimulating factor.
Mol Cell Endocrinol.
160
2000
193
202
56
Konicek
BW
Xia
X
Rajavashisth
T
Harrington
MA
Regulation of mouse colony-stimulating factor-1 gene promoter activity by AP1 and cellular nucleic acid-binding protein.
DNA Cell Biol.
17
1998
799
809
57
Yan
Z-J
Wang
Q-R
McNiece
IK
Wolf
NS
Dissecting the hematopoietic microenvironment, VII; the production of an autostimulatory factor as well as a CSF by unstimulated murine marrow fibroblasts.
Exp Hematol.
18
1990
348
354
58
Gouon-Evans
V
Rothenberg
ME
Pollard
JW
Postnatal mammary gland development requires macrophages and eosinophils.
Development.
127
2000
2269
2282
59
Pollard
JW
Lin
EY
Zhu
L
Complexity in uterine macrophage responses to cytokines in mice.
Biol Reprod.
58
1998
1469
1475
60
Takahashi
K
Umeda
S
Shultz
LD
Hayashi
S
Nishikawa
S-I
Effects of macrophage colony-stimulating factor (M-CSF) on the development, differentiation, and maturation of marginal metallophilic macrophages and marginal zone macrophages in the spleen of osteopetrosis (op) mutant mice lacking functional M-CSF activity.
J Leukoc Biol.
55
1994
581
588
61
Hume
DA
Perry
VH
Gordon
S
Immunohistochemical localization of a macrophage-specific antigen in developing mouse retina: phagocytosis of dying neurons and differentiation of microglial cells to form a regular array in the plexiform layers.
J Cell Biol.
97
1983
253
257
62
Hofstetter
W
Wetterwald
A
Cecchini
MC
Felix
R
Fleisch
H
Mueller
C
Detection of transcripts for the receptor for macrophage colony-stimulating factor, c-fms, in murine osteoclasts.
Proc Natl Acad Sci U S A.
89
1992
9637
9641
63
Guleria
I
Pollard
JW
The trophoblast is a component of the innate immune system during pregnancy.
Nat Med.
6
2000
589
593
64
Arceci
RJ
Shanahan
F
Stanley
ER
Pollard
JW
Temporal expression and location of colony-stimulating factor 1 (CSF-1) and its receptor in the female reproductive tract are consistent with CSF-1-regulated placental development.
Proc Natl Acad Sci U S A.
86
1989
8818
8822

Author notes

E. Richard Stanley, Dept of Developmental and Molecular Biology, Albert Einstein College of Medicine, 1300 Morris Park Ave, Bronx, NY 10461; e-mail: rstanley@aecom.yu.edu.