Abstract

Disturbances in inflammatory cytokine production and immune regulation coupled with human herpesvirus-8 (HHV-8) infection underlie the current understanding of the pathogenesis of Kaposi's sarcoma (KS), the most common HIV-associated malignancy. The low affinity Fc gamma receptors (FcγR) for IgG link humoral and cellular immunity by mediating interaction between antibodies and effector cells, such as phagocytes and natural killer cells. We examined the frequency of polymorphic forms of the low affinityFcγRs, FcγRIIA,FcγRIIIA, and FcγRIIIB in 2 cohorts of HIV-infected men with KS and found that theFcγRIIIA genotype exerts a significant influence on susceptibility to or protection from KS. The FF genotype was underrepresented in patients with KS, whereas the VF genotype was associated with development of KS. A similar association was observed between FcγRIIIA genotypes and HHV-8 seropositivity. These observations suggest a possible role forFcγRIIIA in the development of KS during HIV infection.

Kaposi's sarcoma (KS) is the most common malignant condition associated with human immunodeficiency virus-1 (HIV) infection.1,2 Before the onset of the HIV epidemic, KS was a rare disease confined to specific risk groups: elderly men of Mediterranean or Ashkenazi Jewish background, Sub-Saharan Africans, and immuno-suppressed patients.2-6 Since the initial description of KS, there has been strong evidence to suggest that an infectious agent contributes to the pathogenesis of this disease. Recently, a KS-associated herpesvirus (KSHV), later designated as human herpesvirus-8 (HHV-8), has been determined to be the likely causative microbial agent critical in the pathogenesis of KS.7-10However, this virus appears to be necessary but not sufficient for development of KS.

Current insights into the pathogenesis of KS in HIV-infected individuals indicate that in its early stage, KS is an angio-proliferative inflammatory condition induced by infection with HHV-8.11,12 In the late stages of KS, lesions may develop a malignant phenotype and there is some evidence that they can resemble a true sarcoma as defined by monoclonality.13 The immunopathogenesis of KS includes the activation of lymphocytes, resulting in increased inflammatory cytokine production, activation of endothelial cells, and production of virally encoded angiogenic factors by HHV-8-infected cells.7-10,14-18 It is postulated that an increase in pro-inflammatory cytokine production, notably IFN-γ, TNF-α, IL-1, and IL-6 as well as HIV-1 tat protein, promotes activation and growth of endothelial cells, expression of adhesion molecules and integrins, and release of angiogenic molecules.14-19 Hence, a significant disruption of the extra- and intracellular signaling pathways by cytokines and other molecules of innate immunity appears to be a hallmark of KS in HIV-infected individuals.

The low-affinity Fc gamma receptors (FcγR) for IgG couple humoral and cellular immunity by mediating interaction between antibodies and effector cells, such as professional phagocytes (ie, neutrophils, monocytes, and macrophages) and natural killer (NK) cells.20 Surface FcγR on effector cells can direct phagocytosis, antibody-dependent cell-mediated cytotoxicity (ADCC), and activation of cytokine pathways.21,22 The structural heterogeneity of the genes that encode the FcγRs reflects the functional diversity of these receptors. The genes that encode the low-affinity FcγR map to a region of chromosome 1q22 are characterized by a high degree of sequence homology.23,24 

Polymorphic forms of the low affinity receptors,FcγRIIA, FcγRIIIA, andFcγRIIIB, have been described and are currently the focus of efforts to identify heritable risk factors for a range of diseases.25-31 Variant alleles have been described that have a high frequency (greater than 25%) in the general population. These alleles exhibit differing functional characteristics both in vitro and in clinical association studies. For example, a polymorphism in FcγRIIA at amino acid 131 results in altered binding affinity to IgG2.27 The FcγRIIIa-158 V isoform, which lies in the extracellular domain and affects ligand binding, has a higher affinity for IgG1, IgG3, and IgG4 than FcγRIIIa -158 F.28,29 Interestingly, FcγRIIIa is highly expressed on NK cells and monocytes. Neutrophils from NA2 homozygotes ofFcγRIIIB bind human IgG3 less avidly than those from NA1 homozygotes and exhibit a lower level of phagocytosis of erythrocytes sensitized with IgG1 and IgG3 anti-Rhesus D monoclonal antibody.21 Recently, it was shown that variant genotypes of these 3 FcγRs were randomly distributed in the populations studied, suggesting that each of the 3 FcγRs, namely,FcγRIIA, FcγRIIIA, andFcγRIIIB, provides a distinct set of functions in host immune responses, despite the high degree of homology among their sequences.32 

Clinical association studies analyzing these variant genotypes have shown a correlation between FcγR genotype and disease susceptibility or outcome, particularly in cohorts with underlying defects in immune function. Specifically, FcγRIIA andFcγRIIIB genotypes have been associated with granulomatous and rheumatologic complications of chronic granulomatous disease, renal complications of both systemic lupus erythematosus and Wegener's granulomatosis, as well as infection with encapsulated bacteria in HIV-infected and other immunocompromised populations.33-36 Although variant alleles of the FcγRs have not been associated with the occurrence or progression of HIV infection, clinical association studies investigating other genes, in particular variant alleles of the chemokine receptor family, have demonstrated a strong influence on infection and progression of HIV disease.37-44 

The above mentioned observations led us to consider the possibility that variant genotypes of low affinity FcγRs might influence susceptibility to KS. To investigate this possibility, we chose to genotype the 3 candidate FcγRs loci,FcγRIIA, FcγRIIIA, andFcγRIIIB, in a cohort of HIV patients with or without KS.33 

Methods

Human subjects

The first cohort tested, population I, consisted of 119 deceased white males enrolled on NCI protocols, who had acquired HIV through sex with other men. None of the patients received highly active antiretroviral therapy (HAART) and each died before 1996. The second cohort, population II, consisted of 131 HIV-infected patients (61 patients with KS, 70 patients without KS). The demographic and clinical profile of the patients in the confirmatory cohort, population II, was comparable to the first cohort in that it consisted of men with or without KS who had acquired HIV through sex with other men and were enrolled in NIAID protocols that did not include HAART. The 2 groups did not differ in age or CD4 count at time of death. All but 4 samples were collected from deceased patients. The activity of this protocol was determined to be exempt from the need for Institutional Review Board approval by the Office of Human Subject Research, National Institutes of Health, Bethesda, MD. Four patients still alive with confirmed KS provided informed consent for enrollment in a prospective study approved by the NIAID Institutional Review Board and were included. All but 4 patients were white North Americans; 2 controls and 2 with KS were African Americans.

Genomic DNA was extracted from banked cryopreserved lymphocyte pellets using the Puregene DNA Extraction Kit (Gentra Systems, Minneapolis, MN).

Polymorphism analysis

FcγRIIA polymorphisms were tested by allele-specific restriction digest according to a previously described method.45 

The 158V/F-FcγRIIIA polymorphism was detected by an allele-specific oligohybridization after a nested polymerize chain reaction (PCR) amplification of genomic DNA.28,29 A gene-specific 1.2-kilobase (kb) DNA fragment was amplified by PCR using the following primers, ATATTTACAGAATGGCACAGG and GACTTGGTACCCAGGTTGAA, and conditions, 5 minutes at 95°C, 35 cycles of 1 minute at 95°C, 1 minute at 56°C, and 1 minute at 72°C with a final extension of 8 minutes at 72°C.28,32 One microliter was used as a template for a nested PCR reaction with the primer pair, TCATCATAATTCTGACTTCT and CTTGAGTGATGGTGATGTTC, and conditions of 30 cycles of 1 minute each at 95°C, 62°C, and 72°C. [γ-32P]-ATP–labeled oligonucleotide probes corresponding to the F or V allele, GCAGGGGGCTTTTTGGGAGTAAA or GCAGGGGGCTTGTTGGGAGTAAA, were hybridized and washed in 6 × SSPE/1% SDS at room temperature, 42°C, and at 70.5°C for T allele and at 72.5°C for G allele. Autoradiography was then performed. Selected samples were confirmed by direct sequence analysis in duplicate; the 3′ oligonucleotide was used as the sequence primer with the Thermo Sequenase–radiolabeled terminator cycle sequencing kit (Amersham Life Sciences, Cleveland, OH) at 35 cycles and an annealing temperature of 55°C. Sequence analysis confirmed the presence of a C at nucleotide 531, present inFcγRIIIA but not inFcγRIIIB (which has a T). Two groups have characterized the polymorphism at base pair 559, a nonconservative T to G substitution, resulting in a change of phenylalanine (F) to valine (V) but designated the amino acid position differently, ie, 15829 or 176.28 Interestingly, a tri-allelic polymorphism of FcγRIIIA at nucleotide 230, 48L/H/R, which is strongly linked to 158V/F, does not appear to confer a significant biologic difference.28 

The FcγRIIIB-NA1/NA2 polymorphism was determined by an allele-specific PCR, using a modification of a protocol by Hessner et al.46 

HHV-8 serologic testing

A commercially available immunofluorescence assay kit for measuring antibodies against lytically expressed HHV-8 antigens (Advanced Biotechnologies, Columbia, MD) was used for detection of HHV-8 antibodies according to the manufacturer's instructions.47,48 Sera were tested at a 1:40 dilution and coded slides were scored by 3 independent investigators.

Statistical analysis

An initial analysis was performed on population I to explore a possible association between 1 or more loci and development of KS using χ2 analysis (3 × 2 tables with 2 degrees of freedom). The data are presented without formal correction on the premise that candidate genes were chosen on the basis of previous in vitro data or association studies suggesting the functional significance of the polymorphisms.33 Because the second cohort, population II, was tested to confirm the findings for population I, a χ2 analysis (3 × 2 tables with 2 degrees of freedom) of the second population is presented without correction. The effect of each FcγRs genotype on KS associated with HIV was analyzed by χ2 analysis (2 × 2 with 1 degree of freedom). The association between KS and theFcγRIIIA locus in the combined population was tested using the Cochran-Mantel-Haenszel method of stratified analysis.49,50 

Results

An exploratory analysis of the candidateFcγRs loci, FcγRIIA,FcγRIIIA, and FcγRIIIB, was performed on stored samples from population I (Table1). In this cohort, 58 patients had KS by time of death and 61 did not. Serologic evidence of HHV-8 infection by immunofluorescence assay on the last available serum sample conformed to published data: 39 of 46 KS patients (84.7%) were seropositive, compared with 21 of 55 patients (38.1%) without KS.51,52In an exploratory analysis in this cohort, population I (Table 1), there was a significant difference observed between individuals with and without KS with respect to 1 locus, FcγRIIIA(P =  .0035). Further analysis indicated (Table1) that the FcγRIIIA FF genotype was underrepresented in individuals with KS; only 21.8% of patients with KS had this genotype, compared with 48.3% of patients without KS (P = .003). In contrast, the heterozygous VF genotype was associated with KS; 65.5% of patients with KS had this genotype, compared with 35% of patients without KS (P = .0011). An association was not observed between KS and either the FcγRIIA orFcγRIIIB variant genotypes.

Table 1.

Association between variant FcγRgenotypes and Kaposi's sarcoma (KS) in 2 populations of HIV-infected men

FcγR genotypes  Population I Population II  Combined populations 
KS (n = 58) Number of patients (%) No KS (n = 61)  Evidence for association P values for  KS (n = 61) No KS (n = 70)  Evidence for association P values for  KS (n = 119) No KS (n = 131)  Evidence for association P values for  
Locus  Genotype  Locus Genotype  Locus  Genotype  
FcγRIIA 
 HH  21 (36.8)  12 (19.7)    16 (26.7) 20 (28.6)    37 (31.6)  32 (24.4)  
 HR 25 (43.9)  37 (60.6)  .096   29 (48.3) 33 (47.1)  .97   54 (46.2)  70 (53.4)  .40 
 RR  11 (19.3)  12 (19.7)    15 (25) 17 (24.3)    26 (22.2)  29 (22.2) 
FcγRIIIA 
 VV  7 (12.7) 10 (16.7)   .55  9 (15.8)  5 (7.4)   .14 16 (14.3)  15 (11.7)   .55  
 VF  36 (65.5) 21 (35)  .0035 .0011  36 (63.1)  33 (48.4)  .018 .10  72 (64.3)  54 (42.2)  .00028  .00063  
 FF 12 (21.8)  29 (48.3)   .0030  12 (21.1) 30 (44.1)   .0065  24 (21.4)  59 (46.1)  .000061  
FcγRIIIB 
 1/1 11 (19.3)  8 (13.8)    7 (11.9)  10 (14.7)   18 (15.5)  18 (14.3)  
 1/2  21 (36.9) 23 (39.7)  .73   34 (57.6)  35 (51.5)  .77  55 (47.4)  58 (46.0)  .89  
 2/2  25 (43.8) 27 (46.5)    18 (30.5)  23 (33.8)   43 (37.1)  50 (39.7) 
FcγR genotypes  Population I Population II  Combined populations 
KS (n = 58) Number of patients (%) No KS (n = 61)  Evidence for association P values for  KS (n = 61) No KS (n = 70)  Evidence for association P values for  KS (n = 119) No KS (n = 131)  Evidence for association P values for  
Locus  Genotype  Locus Genotype  Locus  Genotype  
FcγRIIA 
 HH  21 (36.8)  12 (19.7)    16 (26.7) 20 (28.6)    37 (31.6)  32 (24.4)  
 HR 25 (43.9)  37 (60.6)  .096   29 (48.3) 33 (47.1)  .97   54 (46.2)  70 (53.4)  .40 
 RR  11 (19.3)  12 (19.7)    15 (25) 17 (24.3)    26 (22.2)  29 (22.2) 
FcγRIIIA 
 VV  7 (12.7) 10 (16.7)   .55  9 (15.8)  5 (7.4)   .14 16 (14.3)  15 (11.7)   .55  
 VF  36 (65.5) 21 (35)  .0035 .0011  36 (63.1)  33 (48.4)  .018 .10  72 (64.3)  54 (42.2)  .00028  .00063  
 FF 12 (21.8)  29 (48.3)   .0030  12 (21.1) 30 (44.1)   .0065  24 (21.4)  59 (46.1)  .000061  
FcγRIIIB 
 1/1 11 (19.3)  8 (13.8)    7 (11.9)  10 (14.7)   18 (15.5)  18 (14.3)  
 1/2  21 (36.9) 23 (39.7)  .73   34 (57.6)  35 (51.5)  .77  55 (47.4)  58 (46.0)  .89  
 2/2  25 (43.8) 27 (46.5)    18 (30.5)  23 (33.8)   43 (37.1)  50 (39.7) 

Genotype of variants of FcγRs, namely,FcγRIIA-131 H/R, FcγRIIIA158 V/F, and FcγRIIIB NA1/NA2, was determined for 2 cohorts of men who acquired HIV infection through sex with other men. In Population I (n = 119, KS = 58, and no KS = 61), an exploratory analysis was performed to test the hypothesis at each of 3 loci by χ2 analysis (3 × 2 tables with 2 degrees of freedom); no adjustments for multiple corrections are presented. Because the second cohort, Population II (n = 131, KS = 61, and no KS = 70), was tested to confirm the findings for Population I, a χ2 analysis (3 × 2 tables with 2 degrees of freedom) of the second population is presented without correction. The effect of each genotype for FcγRIIIA, namely, VV, VF, and FF on KS associated with HIV, is shown in a χ2 analysis (2 × 2 with one degree of freedom). The evidence for association in the combined population was investigated using the stratified analysis of Cochran-Mantel-Haenszel.49,50 There was no significant difference in χ2 analysis (3 × 2 tables with 2 degrees of freedom) of the 2 populations for distribution of genotype VV, VF, or FF overall, as well as for KS or no KS. There was no significant difference between no KS cohorts (ie, Population I, Population II, and the combined population) and normal healthy controls.32 Similarly, the distribution of genotypes ofFcγRIIA and FcγRIIIB was not significantly different overall from published, healthy control populations32 or when analyzed for the presence or absence of KS in the 2 populations.

Note: Not all samples could be amplified at each locus.

To confirm these results, a second population, population II, was subsequently genotyped (Table 1). The HHV-8 serologic status of the second population was determined on the last available banked serum. Of the patients tested, 47 of 55 KS patients (85.5%) were HHV-8 seropositive in contrast to 23 of 67 patients without KS (34.3%) who were seropositive, a distribution that did not differ statistically from the previous cohort or the published literature.51,52The analysis of population II (P = .018), as well as the analysis of the combined populations (ie, populations I and II; P = .00028) provided additional evidence (Table 1) that variant genotypes for FcγRIIIAwere strongly associated with KS. In population II, the FF genotype was associated with failure to develop KS (P = .0065); however, the association between the VF genotype and KS was only suggestive of a trend (P = .10).

Because the 2 study populations were comparable (ie, males with late stage HIV infection, CD4 counts below 200/μL, and identical rates for HHV-8 seropositivity), a stratified analysis combining both populations was performed using the Cochran-Mantel-Haenszel test.49,50This analysis indicated a strong association between theFcγRIIIA locus and KS (P = .00028) in the combined populations. Furthermore, analysis of the combined cohort of 240 genotyped patients (112 with KS and 128 without KS) demonstrated that the FF homozygous genotype was associated with a decreased likelihood of KS during HIV infection (P = .000061), whereas the VF heterozygous genotype was strongly associated with development of KS (P = .00063).

The distribution of genotypes did not differ significantly between the population without KS and a healthy control population of white North Americans from a recently published report at any of the 3 FcγR loci studied.32 Specifically, the distribution ofFcγRIIIA genotypes in the healthy control population was as follows: 91 (50%) FF, 71 (40%) VF, and 19 (10%) VV and did not differ from the combined group without KS (P = .77; χ2 = 0.53).

We also examined whether FcγRIIIA might be involved in host response against HHV-8. An exploratory analysis of the combined populations with respect to HHV-8 serologic status andFcγRIIIA genotype, not taking into account KS status, does suggest an association (P = .0071) (Table 2). It appears that the FF genotype is protective against infection with HHV-8 that induces serologic response (P = .0017), whereas the VF genotype could be a risk factor for this form of HHV-8 infection (P = .023). Because HHV-8 infection appears to be an essential factor for the development of KS, an analysis restricted to subjects with detectable HHV-8 antibodies was performed for the combined population (n = 130; 86 with KS and 44 without KS). The significance of the 158 V/F polymorphism ofFcγRIIIA and predisposition to KS in individuals was still evident in those who were seropositive for HHV-8 (P = .036). The FF genotype was protective; 17 of 86 patients with KS in contrast to 18 of 44 without KS had this genotype (P = .01). On the other hand, the VF genotype was marginal in its association with development of KS in individuals who were seropositive for HHV-8 (55 of 86 with KS in comparison to 21 of 44 without KS; P = .076).

Table 2.

Effect of variant genotypes ofFcγRIIIA at V/F 158 on HHV-8 seropositivity during HIV infection

FcγRIIIA genotype  Number of patients (%)  Evidence for association, P values at 
HHV-8 positive  HHV-8 negative  Locus  Genotype 
VV  19 (14.6)  9 (9.7)   .27    
VF 76 (58.5)  40 (43.0)  .0071  .023   
FF 35 (26.9)  44 (47.3)   .0017 
FcγRIIIA genotype  Number of patients (%)  Evidence for association, P values at 
HHV-8 positive  HHV-8 negative  Locus  Genotype 
VV  19 (14.6)  9 (9.7)   .27    
VF 76 (58.5)  40 (43.0)  .0071  .023   
FF 35 (26.9)  44 (47.3)   .0017 

Results of HHV-8 serologic status in combined population (including those with and without Kaposi's sarcoma) compared toFcγRIIIA 158 V/F genotype by 3 × 2 χ2 analysis with 2 degrees of freedom.

Discussion

Our study of FcγR genotypes in 2 separate cohorts of HIV-infected men suggests that the homozygous FF genotype ofFcγRIIIA acts to partially protect HIV-infected individuals from developing KS. Conversely, the presence of at least 1 V allele is associated with KS. These findings suggest a possible role forFcγRIIIA in the pathogenesis of HIV-associated KS. Infection with HHV-8 could predispose individuals at risk to develop KS with the outcome determined in part by the genotype ofFcγRIIIA 158V/F. Certainly, other cofactors are critical, some of which could be influenced by low-affinity FcγR activity; these include HIV-associated disturbances in cytokine regulation, hormonal balance, angiogenic and transforming growth factors, and altered monocyte or NK activity.

Both in vitro and in vivo evidence are consistent with the hypothesis that cytokine balance plays a critical role in the pathogenesis of KS.11,12,15 Pro-inflammatory cytokines, IL-1β, IL-6, TNF-α, and oncostatin M are potent growth factors for KS spindle cells and are also found in excess within lesions, whereas the addition of the interleukin-1 receptor antagonist (IL-1RN) to KS spindle cells impairs growth in vitro.17,53-55 In vitro studies have shown that the VV genotype of FcγRIIIA results in an increase in NK cell activation, induction of apoptosis, and increased binding affinity for IgG1 and IgG3 compared with FF homozygotes.28,29 It will be of interest to study whether differential binding of IgG to FcγRIIIa results in alterations in downstream events, such as release of cytokines or chemokines which in turn could influence pathways critical for development of KS. We suggest that FF homozygotes might be protected from developing KS because of a less vigorous inflammatory response.

The small number of VV individuals precluded our ability to determine whether this genotype carries a moderately increased risk compared with VF heterozygotes. VF heterozygotes might be at a disadvantage because of the combination of the underlying defect in NK cells associated with HIV infection and the presence of a V allele that could more significantly modulate inflammatory pathways. The correlation of a deleterious outcome with heterozygosity for a variant form of a molecule of innate immunity has been reported previously56; tuberculosis in West Africa has been associated with heterozygous genotypes of several linked variants of the NRAMP-1 gene.

It is of interest that variant genotypes ofFcγRIIIA are associated with KS in HIV because FcγRIIIa is the predominant FcγR expressed on NK cells where it is closely associated with either the TCR-ξ or FcεRI chain.57 FcγRIIIa is a critical receptor on CD3-negative NK cells that act as effectors for ADCC and spontaneous lysis of sensitized viral-infected or malignant cells. In addition, on activation, NK cells secrete cytokines that influence pro- and anti-inflammatory pathways that are already deranged in HIV-associated KS, such as interferon-γ.58 Also, the absence of NK cells has been associated with increased severity of herpesvirus infections.59 Several case reports have suggested that the expression of variant FcγRIIIA on NK cells contributes to more severe illness during infection with herpesviruses but this limited study does not take into account the frequency of the variant alleles in the general population.60 

In the course of this study, it was determined that the FF genotype might be important in influencing not only the development of HIV-associated KS but also the outcome of infection with HHV-8. Further research will be required to determine whether genotypic differences in the binding of IgG, whether by NK cells or by other phagocytic cells, such as macrophages or monocytes, could alter response to HHV-8 infection, particularly in the presence of HIV infection. We infer from our analysis of FcγRIIIA genotypes and HHV-8 seropositivity that the reduced occurrence of seropositive HHV-8 infection associated with the FF genotype could be partially responsible for underrepresentation of the FF genotype in KS. These preliminary observations provide a possible link connecting KS andFcγRIIIA genotype, particularly because HHV-8 infection is an essential cofactor for KS. In this regard, the possible role of FcγRIIIa in modulating infection with HHV-8 is novel and bears further investigation, both for validation and elucidation of events critical for KS pathogenesis.

In this context, our results raise several interesting possibilities for understanding the contribution of FcγRIIIa to the pathogenesis of KS. Each of these possibilities reflects an antibody-dependent, HHV-8–specific role for FcγRIIIa on NK cells and professional phagocytes. Differences in genotype have been shown to alter IgG binding that could influence cytokine levels, the state of effector cell activation, or viral load. Our genetic epidemiologic study provides preliminary evidence for further investigation of these issues, based on a strong association between theFcγRIIIA locus and development of KS in HIV-infected men. It is also possible that the observed association is due to a different gene in linkage dysequilibrium withFcγRIIIA, which instead might directly play a role in host response to viral infection. Because the complexity of disturbances in immune regulation during HIV infection is sufficiently complicated, it is likely that a number of genes are involved in determining host susceptibility and response to HHV-8 infection as well as the development of KS.61 Nonetheless, our study has identified an immunologically interesting region of chromosome 1q22 as potentially important in the development of KS with theFcγRIIIA gene as the leading candidate responsible for this association.

Acknowledgments

We would like to thank Renée Chen and John O'Mara for their technical assistance.

T.L. was supported by a Dr Mildred Scheel Stipendium, Deutsche Krebshilfe e.V.

T.L. and C.B.F. contributed equally to this work.

Reprints:Stephen J. Chanock, Immunocompromised Host Section, Pediatric Oncology Branch, National Cancer Institute, Advanced Technology Center, 8717 Grovemont Circle, Gaithersburg, MD 20877; e-mail: sc83a@nih.gov.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

References

References
1
Safai
B
Johnson
KG
Myskowski
PL
et al
The natural history of Kaposi's sarcoma in the acquired immunodeficiency syndrome.
Ann Intern Med.
103
1985
744
750
2
Haverkos
HW
Drotman
DP
Prevalence of Kaposi's sarcoma among patients with AIDS.
N Engl J Med.
312
1985
1518
3
Geddes
M
Franceschi
S
Balzi
D
Arniani
S
Gafa
L
Zanetti
R
Birthplace and classic Kaposi's sarcoma in Italy: Associazione Italiana Registri Tumori.
J Natl Cancer Inst.
87
1995
1015
1017
4
Penn
I
Kaposi's sarcoma in organ transplant recipients: report of 20 cases.
Transplantation.
27
1979
8
11
5
Slavin
G
Cameron
HM
Singh
H
Kaposi's sarcoma in mainland Tanzania: a report of 117 cases.
Br J Cancer.
23
1969
349
357
6
Taylor
JF
Smith
PG
Bull
D
Pike
MC
Kaposi's sarcoma in Uganda: geographic and ethnic distribution.
Br J Cancer.
26
1972
483
497
7
Chang
Y
Cesarman
E
Pessin
MS
et al
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma.
Science.
266
1994
1865
1869
8
Ambroziak
JA
Blackbourn
DJ
Herndier
BG
et al
Herpes-like sequences in HIV-infected and uninfected Kaposi's sarcoma patients.
Science.
268
1995
582
583
9
Boshoff
C
Schulz
TF
Kennedy
MM
et al
Kaposi's sarcoma-associated herpesvirus infects endothelial and spindle cells.
Nat Med.
1
1995
1274
1278
10
Schalling
M
Ekman
M
Kaaya
EE
Linde
A
Biberfeld
P
A role for a new herpesvirus (KSHV) in different forms of Kaposi's sarcoma.
Nat Med.
1
1995
707
708
11
Brooks
JJ
Kaposi's sarcoma: a reversible hyperplasia.
Lancet.
2
1986
1309
1311
12
Levy
JA
Ziegler
JL
Acquired immunodeficiency syndrome is an opportunistic infection and Kaposi's sarcoma results from secondary immune stimulation.
Lancet.
2
1983
78
81
13
Rabkin
CS
Janz
S
Lash
A
et al
Monoclonal origin of multicentric Kaposi's sarcoma lesions.
N Engl J Med.
336
1997
988
993
14
Caruso
A
Canaris
AD
Licenziati
S
et al
CD4+ and CD8+ lymphocytes of patients with AIDS synthesize increased amounts of interferon-gamma.
J Acquir Immune Defic Syndr Hum Retrovirol.
10
1995
462
470
15
Capobianchi
MR
Ameglio
F
Fei
PC
et al
Coordinate induction of interferon alpha and gamma by recombinant HIV-1 glycoprotein 120.
AIDS Res Hum Retroviruses.
9
1993
957
962
16
Ensoli
B
Salahuddin
SZ
Gallo
RC
AIDS-associated Kaposi's sarcoma: a molecular model for its pathogenesis.
Cancer Cells.
1
1989
93
96
17
Nakamura
S
Salahuddin
SZ
Biberfeld
P
et al
Kaposi's sarcoma cells: long-term culture with growth factor from retrovirus-infected CD4+ T cells.
Science.
242
1988
426
430
18
Ensoli
B
Gendelman
R
Markham
P
et al
Synergy between basic fibroblast growth factor and HIV-1 tat protein in induction of Kaposi's sarcoma.
Nature.
371
1994
674
680
19
Sirianni
MC
Vincenzi
L
Fiorelli
V
et al
Gamma-interferon production in peripheral blood mononuclear cells and tumor infiltrating lymphocytes from Kaposi's sarcoma patients: correlation with the presence of human herpesvirus-8 in peripheral blood mononuclear cells and lesional macrophages.
Blood.
91
1998
968
976
20
van de Winkel
J
Capel
P
Human IgG Fc receptor heterogeneity: molecular aspects and clinical implications.
Immunol Today.
14
1993
215
221
21
Nagarajan
S
Chesla
S
Cobern
L
Anderson
P
Zhu
C
Selvaraj
P
Ligand binding and phagocytosis by CD16 (Fc gamma receptor III) isoforms.
J Biol Chem.
270
1995
26,762
25,770
22
Tax
W
Tamboer
W
Jacobs
C
Frenken
L
Koene
R
Role of polymorphic Fc receptor Fc gamma RIIa in cytokine release and adverse effects of murine IgG1 anti-CD3/T cell receptor antibody (WT31).
Transplantation.
63
1997
106
112
23
Peltz
GA
Grundy
HO
Lebo
RV
Yssel
H
Barsh
GS
Moore
KW
Human Fc gamma RIII: cloning, expression, and identification of the chromosomal locus of two Fc receptors for IgG.
Proc Natl Acad Sci U S A.
86
1989
1013
1017
24
Su
Y
Brooks
DG
Li
L
et al
Myelin protein zero gene mutated in Charcot-Marie-tooth type 1B patients.
Proc Natl Acad Sci U S A.
90
1993
10,856
10,860
25
Parren
PW
Warmerdam
PA
Boeije
LC
et al
On the interaction of IgG subclasses with the low affinity Fc gamma RIIa (CD32) on human monocytes, neutrophils, and platelets. Analysis of a functional polymorphism to human IgG2.
J Clin Invest.
90
1992
1537
1546
26
Warmerdam
PA
van de Winkel
JG
Gosselin
EJ
Capel
PJ
Molecular basis for a polymorphism of human Fc gamma receptor II (CD32).
J Exp Med.
172
1990
19
25
27
Warmerdam
PA
van de Winkel
JG
Vlug
A
Westerdaal
NA
Capel
PJ
A single amino acid in the second Ig-like domain of the human Fc gamma receptor II is critical for human IgG2 binding.
J Immunol.
147
1991
1338
1343
28
Wu
J
Edberg
J
Redecha
P
et al
A novel polymorphism of Fc gamma RIIIa (CD16) alters receptor function and predisposes to autoimmune disease.
J Clin Invest.
100
1997
1059
1070
29
Koene
H
Kleijer
M
Algra
J
Roos
D
von dem Borne
A
de Haas
M
Fc gamma RIIIa-158V/F polymorphism influences the binding of IgG by natural killer cell Fc gamma RIIIa, independently of the Fc gamma RIIIa-48L/R/H phenotype.
Blood.
90
1997
1109
1114
30
Ory
PA
Clark
MR
Kwoh
EE
Clarkson
SB
Goldstein
IM
Sequences of complementary DNAs that encode the NA1 and NA2 forms of Fc receptor III on human neutrophils.
J Clin Invest.
84
1989
1688
1691
31
Ory
PA
Goldstein
IM
Kwoh
EE
Clarkson
SB
Characterization of polymorphic forms of Fc receptor III on human neutrophils.
J Clin Invest.
83
1989
1676
1681
32
Lehrnbecher
T
Foster
CB
Zhu
S
et al
Variant genotypes of the low affinity Fc gamma receptors in two control populations and a review of low affinity Fc gamma receptor polymorphisms in control and disease populations.
Blood.
94
1999
4220
4232
33
Foster
CB
Lehrnbecher
T
Mol
F
et al
Host defense molecule polymorphisms influence the risk for immune-mediated complications in chronic granulomatous disease.
J Clin Invest.
102
1998
2146
2155
34
Manger
K
Repp
R
Spriewald
BM
et al
Fcgamma receptor IIa polymorphism in Caucasian patients with systemic lupus erythematosus: association with clinical symptoms.
Arthritis Rheum.
41
1998
1181
1189
35
Norris
CF
Surrey
S
Bunin
GR
Schwartz
E
Buchanan
GR
McKenzie
SE
Relationship between Fc receptor IIA polymorphism and infection in children with sickle cell disease.
J Pediatr.
128
1996
813
819
36
Abadi
J
Zhon
Z
Dobroszycki
J
Pirofski
L
Fc gamma RIIa polymorphism in human immunodeficiency virus-infected children with invasive pneumococcal disease.
Pediatr Res.
42
1997
259
262
37
Koene HR, von dem Borne AEGK, Roos D, de Haas M. Polymorphisms of Fc gamma RIIIa on NK cells and macrophages. In: van de Winkel JGJ, Hogarth PM, eds. The Immunoglobulin Receptors and Their Physiological and Pathological Roles in Immunity. Kluwer Academic Publisher; 1998:135-140.
38
Winkler
C
Modi
W
Smith
MW
et al
Genetic restriction of AIDS pathogenesis by an SDF-1 chemokine gene variant. ALIVE Study, Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC).
Science.
279
1998
389
393
39
Martin
MP
Dean
M
Smith
MW
et al
Genetic acceleration of AIDS progression by a promoter variant of CCR5.
Science.
282
1998
1907
1911
40
Dean
M
Carrington
M
Winkler
C
et al
Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene: Hemophilia Growth and Development Study, Multicenter AIDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study.
Science.
273
1996
1856
1862
41
McDermott
DH
Zimmerman
PA
Guignard
F
Kleeberger
CA
Leitman
SF
Murphy
PM
CCR5 promoter polymorphism and HIV-1 disease progression: Multicenter AIDS Cohort Study (MACS).
Lancet.
352
1998
866
870
42
Zimmerman
PA
Buckler-White
A
Alkhatib
G
et al
Inherited resistance to HIV-1 conferred by an inactivating mutation in CC chemokine receptor 5: studies in populations with contrasting clinical phenotypes, defined racial background, and quantified risk.
Mol Med.
3
1997
23
36
43
Smith
MW
Dean
M
Carrington
M
et al
Contrasting genetic influence of CCR2 and CCR5 variants on HIV-1 infection and disease progression: Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC), ALIVE Study.
Science.
277
1997
959
965
44
Carrington
M
Nelson
G
Martin
M
et al
HLA and HIV-1: heterozygote advantage and B*35-Cw*04 disadvantage.
Science.
283
1999
1748
1752
45
Jiang
X
Arepally
G
Poncz
M
McKenzie
S
Rapid detection of the Fc gamma RIIA-H/R (131) ligand-binding polymorphism using an allele-specific restriction enzyme digestion (ASRED).
J Immunol Meth.
199
1996
55
59
46
Hessner
M
Curtis
B
Endean
D
Aster
R
Determination of neutrophil antigen gene frequencies in five ethnic groups by polymerase chain reaction with sequence-specific primers.
Transfusion.
36
1996
895
899
47
Masood
R
Zheng
T
Tupule
A
et al
Kaposi's sarcoma-associated herpesvirus infection and multiple myeloma.
Science.
278
1997
1970
1973
48
Davis
DA
Humphrey
RW
Newcomb
FM
et al
Detection of serum antibodies to a Kaposi's sarcoma-associated herpesvirus-specific peptide.
J Infect Dis.
175
1997
1071
1079
49
Cochran
WG
Some methods for strengthening the common χ2 tests.
Biometrics.
10
1954
417
451
50
Mantel
N
Haenszel
WJ
Statistical aspects of the analysis of data from retrospective studies of disease.
J Natl Cancer Inst.
22
1959
719
51
Kedes
DH
Operskalski
E
Busch
M
Kohn
R
Flood
J
Ganem
D
The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission.
Nat Med.
2
1996
918
924
52
Gao
SJ
Kingsley
L
Li
M
et al
KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma.
Nat Med.
2
1996
925
928
53
Miles
SA
Rezai
AR
Salazar-Gonzalez
JF
et al
AIDS Kaposi's sarcoma-derived cells produce and respond to interleukin 6.
Proc Natl Acad Sci U S A.
87
1990
4068
4072
54
Nair
BC
DeVico
AL
Nakamura
S
et al
Identification of a major growth factor for AIDS-Kaposi's sarcoma cells as oncostatin M.
Science.
255
1992
1430
1432
55
Miles
SA
Martinez-Maza
O
Rezai
A
et al
Oncostatin M as a potent mitogen for AIDS-Kaposi's sarcoma-derived cells.
Science.
255
1992
1432
1434
56
Bellamy
R
Ruwende
C
Corrah
T
McAdam
KP
Whittle
HC
Hill
AV
Variations in the NRAMP1 gene and susceptibility to tuberculosis in West Africans.
N Engl J Med.
338
1998
640
644
57
Wirthmueller
U
Kurosaki
T
Murakami
MS
Ravetch
JV
Signal transduction by Fc gamma RIII (CD16) is mediated through the gamma chain.
J Exp Med.
175
1992
1381
1390
58
Cassatella
MA
Anegon
I
Cuturi
MC
Griskey
P
Trinchieri
G
Perussia
B
Fc gamma R(CD16) interaction with ligand induces Ca2+ mobilization and phosphoinositide turnover in human natural killer cells. Role of Ca2+ in Fc gamma R(CD16)-induced transcription and expression of lymphokine genes.
J Exp Med.
169
1989
549
567
59
Jawahar
S
Moody
C
Chan
M
Finberg
R
Geha
R
Chatila
T
Natural killer (NK) cell deficiency associated with an epitope-deficient Fc receptor type IIIA (CD16-II).
Clin Exp Immunol.
103
1996
408
413
60
de Vries
E
Koene
H
Vossen
J
et al
Identification of an unusual Fc gamma receptor IIIa (CD16) on natural killer cells in a patient with recurrent infections.
Blood.
88
1996
3022
3027
61
Chanock
SJ
Foster
CB
SNPing away at innate immunity.
J Clin Invest.
104
1999
369
370