Abstract

We determined the breakpoint genes of the translocation t(4;11)(q21;p15) that occurred in a case of adult T-cell acute lymphocytic leukemia (T-ALL). The chromosome 11 breakpoint was mapped to the region between D11S470 and D11S860. The nucleoporin 98 gene (NUP98), which is rearranged in several acute myeloid leukemia translocations, is located within this region. Analysis of somatic cell hybrids segregating the translocation chromosomes showed that the chromosome 11 breakpoint occurs withinNUP98. The fusion partner of NUP98 was identified as theRAP1GDS1 gene using 3′ RACE. RAP1GDS1 codes for smgGDS, a ubiquitously expressed guanine nucleotide exchange factor that stimulates the conversion of the inactive GDP-bound form of several ras family small GTPases to the active GTP-bound form. In theNUP98-RAP1GDS1 fusion transcript (abbreviated asNRG), the 5′ end of the NUP98 gene is joined in frame to the coding region of the RAP1GDS1 gene. This joins the FG repeat-rich region of NUP98 to RAP1GDS1, which largely consists of tandem armadillo repeats. NRG fusion transcripts were detected in the leukemic cells of 2 other adult T-ALL patients. One of these patients had a variant translocation with a more 5′ breakpoint in NUP98. This is the first report of anNUP98 translocation in lymphocytic leukemia and the first time that RAP1GDS1 has been implicated in any human malignancy.

THE STUDY OF GENES at the breakpoints of chromosome translocations has identified a large number of genes involved in the development of human cancer.1-6 We previously reported the translocation t(4;11)(q21;p15) as a t(4;11)(q21;p14-15) in a 21-year-old man with T-cell acute lymphocytic leukemia (T-ALL).7 Somatic cell hybrids containing the der(4) and der(11) chromosomes enabled the localization of the chromosome 11 breakpoint to 11p15.5 in the region between theIGF2 and RRM1 loci.8 Studies using cosmids as fluorescence in situ hybridization (FISH) probes on the patient material further localized the breakpoint region to between the 11p15.5 markers D11S470 and RRM1.9 

We describe the identification of the chromosome 4 and 11 breakpoint genes as RAP1GDS1 and NUP98 and show that the (4;11)(q21;p15) translocation is recurrent in T-ALL. This is the first report of RAP1GDS1 involvement in any malignancy. NUP98has previously been shown to be involved in 3 distinct acute myeloid leukemia (AML) translocations. Two translocations involving theHOXA9 and DDX10 genes have been shown to be recurrent, whereas the translocation involving the HOXD13 gene has so far been reported in a single case of therapy-induced AML.10-13 

MATERIALS AND METHODS

Patient samples.

Table 1 summarizes the clinical and laboratory features of the patients described here. Patient no. 1, a 21-year-old man, presented with moderate hepato-splenomegaly, a large mediastinal mass, and a white blood cell count of 423 × 109/L, a platelet count of 109 × 109/L, and a hemoglobin level of 7.8 g/dL and was diagnosed as ALL (French-American-British [FAB] L1). The blood film showed 99% blasts. The patient underwent 2 matched bone marrow transplantations but relapsed on both occasions. Patient no. 2, a 25-year-old woman, presented with a white blood cell count of 1.8 × 109/L, a platelet count of 23 × 109/L, and a hemoglobin level of 5.5 g/dL and was diagnosed as ALL (FAB L1). She showed cervical, axillary, and inguinal lymphadenopathy. The blood film showed 87% blasts. Induction of remission was unsuccessful, and the patient died 34 days after presentation. Patient no. 3, a 49-year-old man who presented with a white blood cell count of 169 × 109/L, a platelet count of 116 × 109/L, and a hemoglobin level of 9.3 g/dL, was diagnosed as ALL (FAB L2). The chest x-ray and computerized tomographic (CT) scan showed a thymic mass. The blood film showed 99% blasts. After 4 weeks of induction therapy, the bone marrow showed morphological remission, although thymic enlargement was still evident on the CT scan. Three months later, the marrow showed several foci of primitive cells, which is suggestive of early relapse. A decision was made not to persist with intensive therapy. The patient died 14 months after presentation.

Table 1.

Clinical Features, Cytogenetics, Immunophenotype, and Gene Rearrangements of Patients With a t(4;11)(q21p14-15)

Patient No. Sex/ Age (yr) WBC (×109/L) Diagnosis Survival (mo)Karyotype Immunophenotype Gene RearrangementReference
1  M/21  423  ALL L1  43 46,XY,t(4;11)(q21p15) +2mar (presentation) 48,XY,t(4;11),−7, −7,−9,−9,11p+, 17p+,−20,−21, −21 +9 mar (final relapse)  CD2+, CD3+ (30%), CD4, CD5+, CD7+, CD8, CD10+, CD11b (14%), CD14, CD19, CD20, CD33+ (34%), CD34+, CD71+, HLA-DR+ IgH (R)  TCRγ (R)   7 This report  
2  F/25  1.8  ALL L1 1  46,XX,t(4;11)(q21p14-15),del(12)(p13), +del(13)(q12q14) CD2+ (13%), CD3, CD4, CD5+ (13%), CD7+, CD8, CD10+ (14%), CD13+ (5%), CD14, CD19, CD33+ (18%), CD34+ (5%)  IgH (G)  TCRγ (R)  This report 
3  M/49  169  ALL L2  14 46,XY,t(4;11)(q21p15), del(5)(q13q31)  CD2, CD4, CD5+, CD7+, CD8, CD10+ (9%), CD19, CD34+ IgH (G)  TCRγ (R) This report  
4  M/14  1.4  ALL L2  46,XY,t(4;11)(q21p14), 12p-/46,XY, t(4;11)(q21p14) CD2, CD5+, CD10, CD15+, pan-T+, TdT+ ND  21  
5  M/40  127  ALL  21 46,XY,t(4;11)(q21p15)  T (surface markers not reported) ND  22  
6  F/6  49  ALL L2  25+ 46,XX,t(4;11) (q21p14-15)  CD2+, CD5, CD7+, CD10, CD11b+, CD13+, CD14, CD15, CD19, CD20, CD22, CD33+, CD36, HLA-DR+, TdT+ ND  23 
Patient No. Sex/ Age (yr) WBC (×109/L) Diagnosis Survival (mo)Karyotype Immunophenotype Gene RearrangementReference
1  M/21  423  ALL L1  43 46,XY,t(4;11)(q21p15) +2mar (presentation) 48,XY,t(4;11),−7, −7,−9,−9,11p+, 17p+,−20,−21, −21 +9 mar (final relapse)  CD2+, CD3+ (30%), CD4, CD5+, CD7+, CD8, CD10+, CD11b (14%), CD14, CD19, CD20, CD33+ (34%), CD34+, CD71+, HLA-DR+ IgH (R)  TCRγ (R)   7 This report  
2  F/25  1.8  ALL L1 1  46,XX,t(4;11)(q21p14-15),del(12)(p13), +del(13)(q12q14) CD2+ (13%), CD3, CD4, CD5+ (13%), CD7+, CD8, CD10+ (14%), CD13+ (5%), CD14, CD19, CD33+ (18%), CD34+ (5%)  IgH (G)  TCRγ (R)  This report 
3  M/49  169  ALL L2  14 46,XY,t(4;11)(q21p15), del(5)(q13q31)  CD2, CD4, CD5+, CD7+, CD8, CD10+ (9%), CD19, CD34+ IgH (G)  TCRγ (R) This report  
4  M/14  1.4  ALL L2  46,XY,t(4;11)(q21p14), 12p-/46,XY, t(4;11)(q21p14) CD2, CD5+, CD10, CD15+, pan-T+, TdT+ ND  21  
5  M/40  127  ALL  21 46,XY,t(4;11)(q21p15)  T (surface markers not reported) ND  22  
6  F/6  49  ALL L2  25+ 46,XX,t(4;11) (q21p14-15)  CD2+, CD5, CD7+, CD10, CD11b+, CD13+, CD14, CD15, CD19, CD20, CD22, CD33+, CD36, HLA-DR+, TdT+ ND  23 

Details of the 3 patients reported in this study (no. 1, 2, and 3) and 3 patients from the literature (no. 4, 5, and 6) are presented. All features except for survival are at presentation. The comparatively long survival of patient no. 1 is at least in part due to the patient having undergone 2 allogeneic transplantations. The survival time of patient no. 5 is unknown but is at least 25 months. Where surface markers are positive in less than 50% of cells, the values are indicated in parentheses. Rearrangements of the heavy chain of Ig (IgH) and of the T-cell receptor γ gene (TCRγ) are indicated as G (germline, no rearrangement) or R (rearranged).

Abbreviations: WBC, white blood cell count; ND, not determined.

Somatic cell hybrid screening.

Human-mouse somatic cell hybrids containing the der(4) and der(11) chromosomes from patient no. 1 were described previously.8Polymerase chain reaction (PCR) was performed on 100 ng of DNA using AmpliTaq Gold (Perkin-Elmer, Foster City, CA), with an initial denaturation at 94°C for 9 minutes followed by 35 cycles of 96°C for 30 seconds, 60°C for 1 minute, and 72°C for 45 seconds. We used published primers for D11S47014and D11S860.15 Primers for NUP98 (Genbank accession no. U41815), exon B (N1428F, 5′GGCATCTTTGTT TGGGAACAACC; N1531R, 5′CAAAGCCCAAAGTGGCTGTCG), and exon C (N1585F 5′CAGGCTGTTCTCCAGCAGCACA; N1681R, 5′CCTTCTTCTTAGGGTCTGACATC) were designed based on the published intron/exon boundaries.12 For exon B, 10 μL of PCR product was digested using 10 U Taq I (New England Biolabs, Beverley, MA) to distinguish the mouse product from the human product.

3′ RACE.

Total RNA was extracted using Trireagent (Sigma, St Louis, MO). One-microgram aliquots of peripheral blood mononuclear cell total RNA were reverse transcribed using Superscript II and the Adapter Primer (AP) from the 3′ RACE kit (Life Technologies, Gaithersburg, MD). The Expand Long Template PCR System (Roche, Mannheim, Germany) was used in all subsequent PCR amplifications. The reverse transcription product was amplified with an NUP98 exon B primer, N1459F (5′ATTGGAGGGCCTCTTGGTACAGGAG), and the Abridged Universal Amplification Primer (AUAP; Life Technologies). Touchdown PCR was performed with an initial step at 94°C for 2 minutes, followed by 10 cycles of 95°C for 30 seconds, 70°C minus 1°C per cycle for 30 seconds, and 68°C for 8 minutes, followed by 25 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 68°C for 8 minutes plus 20 seconds per cycle. A biotinylated NUP98 exon B oligo, N1491F (5′GGCCCCTGGATTTAATACTACG), internal to the oligo used in the first round, was used to enrich for NUP98 containing sequences using streptavidin-coated magnetic beads (Promega, Madison, WI).16 Second-round PCR of the enriched product was performed using an NUP98 exon B primer, N1511F (5′CGACAGCCACTTTGGGCTTTGGAGC), internal to the previous 2 sense primers and the AUAP with cycling conditions identical to the first-round PCR. Second-round PCR products were electrophoresed in low melting point agarose gels, purified using Wizard PCR Preps (Promega), cloned into pGEM-T (Promega), and sequenced.

PCR and reverse transcription-PCR (RT-PCR) of fusion mRNAs.

Reverse transcription of 1 μg of total RNA with Superscript II and random hexamers was performed according to the manufacturer’s protocol (Life Technologies). One twentieth of the reverse transcription was used for PCR. NUP98 forward primers (N1265F or N1428F) and aRAP1GDS1 reverse primer, R108R (5′TTGAGCCAGGGCTTGAAAGAAGCTG), were used to amplify NRGfusion cDNAs, whereas the primers R 5′UTRF (GGTTCCTCACCCTCGGGGAGC) and N1848R (GGATGGTTCATCGTCATCCAGCC) were used to amplify RGN cDNAs. PCR using AmpliTaq Gold was performed with an initial step at 94°C for 9 minutes, followed by 35 cycles of 94°C for 30 seconds, 65°C for 1 minute, and 72°C for 45 seconds. PCR products were electrophoresed in low melting point agarose gels, purified using Wizard PCR Preps, and sequenced.

Southern analysis of PCR products.

PCR products were electrophoresed through agarose gels and transferred to Hybond N+ membrane (Amersham Pharmacia Biotech, Uppsala, Sweden). Hybridization to end-labeled oligo probes was performed for 16 hours at 42°C in a 20-mL solution of 4× SSPE, 1% sodium dodecyl sulfate (SDS), 1 in 20 dilution of blotto (5% nonfat dried milk powder, 0.02% sodium azide), and 0.1 mg/mL denatured salmon sperm DNA. After washing at 42°C in 2× SSC, 0.1% SDS, the membranes were autoradiographed at −80°C.

NUP98 and RAP1GDS1 probes.

Probes were generated by PCR after reverse transcription of peripheral blood mononuclear cell RNA and gel purified from low melting point agarose gels using Wizard PCR Preps. The identity of the probes was confirmed by sequencing. The 1,084-bp NUP98 cDNA probe was amplified using the primers N301F and N1384R, using AmpliTaq Gold with an initial step at 94°C for 9 minutes followed by 35 cycles of 94°C for 30 seconds, 65°C for 1 minute, and 72°C for 45 seconds. The RAP1GDS1 primers, R11F (5′TCAGTGATACCTTGAAGAAGCTG) and R1673R (5′CTTTCCACAGTAAGTCTCTCTGCTC), were developed from the cDNA sequence (Genbank accession no. X63465). A 1,665-bp RAP1GDS1cDNA probe was amplified using the Expand Long Template PCR System with an initial step at 94°C for 2 minutes, followed by 10 cycles of 94°C for 10 seconds, 63°C for 30 seconds, and 68°C for 2 minutes, followed by 35 cycles of 94°C for 10 seconds, 63°C for 30 seconds, and 68°C for 2 minutes plus 20 seconds per cycle.

Northern analysis.

Ten micrograms of RNA was electrophoresed in a 1% agarose/1.2 mol/L formaldehyde gel, blotted onto Brightstar plus membrane (Ambion, Austin, TX) according to the manufacturer’s protocol, and UV fixed to the membrane. Multiple tissue Northerns were from Clontech (Palo Alto, CA). Hybridization to random nonamer-labeled probe was performed at 42°C in a 20-mL solution of 1 mol/L NaCl, 10% dextran sulphate, 1% SDS, 50% deionized formamide, and 0.2 mg/mL denatured salmon sperm DNA. Membranes were washed to a final stringency of 0.2× SSPE, 1% SDS at 65°C and autoradiographed at −80°C.

RESULTS

Identification of NUP98 as the chromosome 11 breakpoint gene.

FISH analysis of cosmid probes had narrowed the chromosome 11 breakpoint region of patient no. 1 to between RRM1 andD11S470 on 11p15.5 (Fig1).9 The hybrids containing the der(4) and der(11) chromosomes8 were tested with primers specific toD11S470 and D11S860. D11S470 was on the der(4) chromosome, and D11S860 was on the der(11) chromosome (results not shown). This narrowed the breakpoint to the region between D11S860 and D11S470. The nucleoporin 98 (NUP98) gene maps to a similar region and is located proximal to the region recognized by the cosmid Z104.10 Analysis of the PAC pDJ1173a5 shows that ZNF195, the zinc finger gene within Z104, is distal to D11S470.17 NUP98was absent from the PAC sequence, placing NUP98 proximal toD11S470 and therefore within the breakpoint region (Fig 1).

Fig. 1.

Position of the chromosome 11 breakpoint with respect to the 11p15.5 markers used for FISH and PCR mapping. NUP98 lies within the candidate breakpoint region indicated by the arrowed line. The β chain of hemoglobin (HBBC) and the H-ras oncogene (HRAS) are at the extremities of 11p15.5. C and T denote centromeric and telomeric, respectively.

Fig. 1.

Position of the chromosome 11 breakpoint with respect to the 11p15.5 markers used for FISH and PCR mapping. NUP98 lies within the candidate breakpoint region indicated by the arrowed line. The β chain of hemoglobin (HBBC) and the H-ras oncogene (HRAS) are at the extremities of 11p15.5. C and T denote centromeric and telomeric, respectively.

We therefore sought to investigate NUP98 as a candidate breakpoint gene. Five exons, named A through E, have been defined in the NUP98 breakpoint region.12 Most NUP98 breakpoints occur between exons B and C.10-13 The der(4)- and der(11)-containing hybrids derived from patient no. 1 were tested by PCR for the presence of exons B and C. The der(11) hybrid contained exon B and the der(4) hybrid contained exon C (Fig 2). Because exons B and C are on the complementary derivative chromosomes, NUP98 is disrupted between exons B and C in patient no. 1 and is the chromosome 11 breakpoint gene.

Fig. 2.

PCR analysis of the der(4) and der(11) containing somatic cell hybrids. m is the pUC19/Hpa II molecular weight marker, H is normal human, M is mouse, 4 is the der(4) hybrid, and 11 is the der(11) hybrid. (A) NUP98 exon B PCR product digested withTaq I. Mouse and human NUP98 cDNA sequences are highly conserved and the exon B PCR also amplified mouse NUP98. The mouse and human exon B PCR products were distinguished by a TaqI restriction site, which is present in the mouse product but absent in the human product. (B) NUP98 exon C PCR product.

Fig. 2.

PCR analysis of the der(4) and der(11) containing somatic cell hybrids. m is the pUC19/Hpa II molecular weight marker, H is normal human, M is mouse, 4 is the der(4) hybrid, and 11 is the der(11) hybrid. (A) NUP98 exon B PCR product digested withTaq I. Mouse and human NUP98 cDNA sequences are highly conserved and the exon B PCR also amplified mouse NUP98. The mouse and human exon B PCR products were distinguished by a TaqI restriction site, which is present in the mouse product but absent in the human product. (B) NUP98 exon C PCR product.

Identification of RAP1GDS1 as the chromosome 4 breakpoint gene by 3′ RACE.

3′ RACE was used to determine the chromosome 4 gene fused toNUP98 in patient no. 1. Experiments were performed in parallel on the presentation sample of patient no. 1 and peripheral blood mononuclear cells from a normal individual. One predominant band was seen in the normal individual. Additional bands were seen in the leukemic presentation sample (results not shown). The bands were sequenced and analyzed using the BLAST algorithm to search the GenBank sequence database.18 The common band was shown to correspond to the normal 4.05-kb NUP98 transcript.

A band that was slightly larger than the normal NUP98 band had the 5′ end of NUP98 fused with the coding region of the guanine nucleotide disassociation stimulator gene, RAP1GDS1.The fusion maintained the reading frame of RAP1GDS1. We hereafter denote this hybrid transcript as NRG (forNUP98-RAP1GDS1). The RAP1GDS1 sequence in NRGstarts at nucleotide 5 of the coding sequence. The methionine and the first G of the codon for aspartic acid are lost. However, the aspartic acid is retained in the fusion protein, because the last base of NUP98 exon B is a G (Fig 3).

Fig. 3.

Nucleotide and amino acid sequences around the junctions of the (A) NRG and (B) NRG2 fusion transcripts (Genbank accession nos.AF133331 and AF133333, respectively).

Fig. 3.

Nucleotide and amino acid sequences around the junctions of the (A) NRG and (B) NRG2 fusion transcripts (Genbank accession nos.AF133331 and AF133333, respectively).

Other RACE products that were cloned and sequenced had an identicalNUP98 - RAP1GDS1 junction to NRG but continued into presumed RAP1GDS1 intron/exon splice sites and terminated in either introns of RAP1GDS1 or as yet-unsequenced exons ofRAP1GDS1 (data not shown).

RT-PCR.

RT-PCR of patient no. 1 using primers flanking theNUP98-RAP1GDS1 junction gave a product of the expected size (395 bp), confirming that an NRG fusion mRNA was formed (Fig 4). No bands were seen in the peripheral blood mononuclear cells from normal controls. Two T-ALL patients with a similar karyotype (patients no. 2 and 3; see Table 1) were also tested for the fusion mRNA by RT-PCR (Fig 4). Patient no. 2 was clearly positive, with an RT-PCR product of identical size to that of patient no. 1. Patient no. 3 had a smaller RT-PCR product of 162 bp. Sequencing showed that patient no. 3 had a novel in-frame fusion ofNUP98 to RAP1GDS1 with the NUP98 breakpoint immediately preceding exon A and an RAP1GDS1 junction (nucleotide 5 of the coding sequence) identical to that of patients no. 1 and 2 (Fig 3). This transcript, denoted as NRG2, also maintains the first aspartic acid in the RAP1GDS1 sequence.

Fig. 4.

RT-PCR analysis of NRG and RGN fusion transcripts in 3 t(4;11)(q21;p15) patients. P1, P2, and P3 are RT-PCR products from peripheral blood mononuclear cells from the patients. C1 and C2 are RT-PCR products from peripheral blood mononuclear cells of normal donors. Samples marked with a minus sign are negative control RT-PCRs without reverse transcriptase. H2O controls are negative control RT-PCRs without target. The lane marked m contains both SPP1/EcoRI and pUC19/Hpa II molecular weight markers. The most prominent bands in the RGN PCR of patient no. 3 are alternative splicings of RGN with and without exon B.

Fig. 4.

RT-PCR analysis of NRG and RGN fusion transcripts in 3 t(4;11)(q21;p15) patients. P1, P2, and P3 are RT-PCR products from peripheral blood mononuclear cells from the patients. C1 and C2 are RT-PCR products from peripheral blood mononuclear cells of normal donors. Samples marked with a minus sign are negative control RT-PCRs without reverse transcriptase. H2O controls are negative control RT-PCRs without target. The lane marked m contains both SPP1/EcoRI and pUC19/Hpa II molecular weight markers. The most prominent bands in the RGN PCR of patient no. 3 are alternative splicings of RGN with and without exon B.

The complexity of minor bands seen with all 3 patients in theNRG RT-PCR (Fig 4) is a repeatable observation. Whereas some of the faint upper bands in patient no. 3 appear to be the same size as the NRG RT-PCR products in patients no. 1 and 2, they do not contain NUP98 exon B, as shown by hybridization with the N1511F oligo (data not shown), confirming that NRG2 is not just an alternatively spliced version of NRG.

We analyzed expression of the complementary fusion cDNA,RAP1GDS-NUP98 (RGN), by RT-PCR. Primers that could amplify RGN from all 3 patients showed that RGN is only expressed in patient no. 3 (Fig 4).

Some of the RACE products of patient no. 1 showed an insertion of the trinucleotide CAG at the NUP98-RAP1GDS1 junction. The variable insertion of CAG was also seen in RT-PCR products from all 3 patients (data not shown). This insertion is most likely due to alternative splicing of intronic sequence immediately adjacent to an exon. Because there are 2 distinct NUP98 breakpoint regions in our patients, we deduce that it probably comes from the intron adjacent to the firstRAP1GDS1 exon in the translocation. The CAG conforms to the consensus sequence YAG (Y is a pyrimidine) of the 3′ end of an intron.19 Alternative splicing involving a single trinucleotide has previously been reported for the c-kit gene.20 

Northern analysis.

A 1,084-bp NUP98 cDNA probe was used for Northern analysis (Fig 5A). The normal controls show 4.05- and 7.25-kb bands. The 4.4-kb NRG transcript can be seen above the 4.05-kb NUP98 transcript for the presentation samples of patients no. 1 and 2. In patient no. 3, the NRG2 transcript cannot readily be seen as it migrates just above the normalNUP98 band. NRG is not seen in the remission sample from patient no. 1. The relapse specimen from the same patient shows markedly increased NRG expression compared with the endogenousNUP98. The increased NRG expression in the relapse specimen may be related to the addition to the short arm of the previously normal chromosome 11 (Table 1).

Fig. 5.

Northern analysis of NRG expression. (A) Hybridization using a NUP98 cDNA probe. (B) Hybridization of the same membrane with a RAP1GDS1 cDNA probe. (C) 18S rRNA from the ethidium bromide-stained gel before transfer. RNA was isolated from 2 normal controls (C1 and C2) and from the 3 patients (P1, P2, and P3). pres is a presentation sample, rem is a remission sample, and rel is a relapse sample. Each lane contains 5 μg of total RNA from peripheral blood mononuclear cells, except that P1 rem contains 5 μg of total RNA from bone marrow. The lane marked m is a RNA ladder (Promega). The band in this lane in (C) is marker and not 18S RNA. N indicates theNUP98 4.05- and 7.25-kb bands. The 7.25-kb band is a precursor that also contains the NUP96 coding sequence.47 RG indicates the 2.8- and 4.1-kb RAP1GDS1 bands. NRG indicates the 4.4-kb NRG transcript. NRG2 in patient no. 3 is not indicated, because it is not distinguishable from the 4.05-kbNUP98 and 4.1-kb RAP1GDS1 bands. The arrowheads indicate higher molecular weight transcripts that hybridize with both the NUP98 and RAP1GDS1 probes.

Fig. 5.

Northern analysis of NRG expression. (A) Hybridization using a NUP98 cDNA probe. (B) Hybridization of the same membrane with a RAP1GDS1 cDNA probe. (C) 18S rRNA from the ethidium bromide-stained gel before transfer. RNA was isolated from 2 normal controls (C1 and C2) and from the 3 patients (P1, P2, and P3). pres is a presentation sample, rem is a remission sample, and rel is a relapse sample. Each lane contains 5 μg of total RNA from peripheral blood mononuclear cells, except that P1 rem contains 5 μg of total RNA from bone marrow. The lane marked m is a RNA ladder (Promega). The band in this lane in (C) is marker and not 18S RNA. N indicates theNUP98 4.05- and 7.25-kb bands. The 7.25-kb band is a precursor that also contains the NUP96 coding sequence.47 RG indicates the 2.8- and 4.1-kb RAP1GDS1 bands. NRG indicates the 4.4-kb NRG transcript. NRG2 in patient no. 3 is not indicated, because it is not distinguishable from the 4.05-kbNUP98 and 4.1-kb RAP1GDS1 bands. The arrowheads indicate higher molecular weight transcripts that hybridize with both the NUP98 and RAP1GDS1 probes.

A second new transcript of approximately 5.8 kb was seen in the presentation and relapse samples of patient no. 1. This band is also present in patient no. 2 but is not discernible on Fig 5A. Patient no. 3 showed a 5.5-kb transcript. The shorter size corresponds approximately to the size difference (233 bp) between NRG andNRG2.

RAP1GDS1 shows 2.8- and 4.1-kb transcripts in all tissues tested (Fig 6). When the patient was Northern probed with the RAP1GDS1 probe, the 4.1-kb transcript was visible as a distinct band slightly lower than the NRG transcript, although the 2 bands are not readily distinguishable after photo-reproduction (Fig 5B). The 5.8- and 5.5-kb bands are present in the patient samples, confirming that they areNRG transcripts. They are probably generated by the same mechanism that generates the upper 4.1-kb RAP1GDS1 transcript.

Fig. 6.

Multiple tissue Northern analysis of RAP1GDS1. Each lane contains 2 μg of polyA RNA. (A) Hybridization with aRAP1GDS1 cDNA probe shows two predominant bands of 4.1 and 2.8 kb. (B) Hybridization with a β-actin cDNA probe (Clontech).

Fig. 6.

Multiple tissue Northern analysis of RAP1GDS1. Each lane contains 2 μg of polyA RNA. (A) Hybridization with aRAP1GDS1 cDNA probe shows two predominant bands of 4.1 and 2.8 kb. (B) Hybridization with a β-actin cDNA probe (Clontech).

DISCUSSION

We originally reported a t(4;11)(q21;p14-15) translocation in a patient with T-ALL.7 Molecular analysis then localized the chromosome 11 breakpoint to 11p15.5. 8 Subsequently, 2 further T-ALL patients (no. 2 and 3), karyotyped as t(4;11)(q21;p14-15) and t(4;11)(q21;p15), respectively, were identified by us. Three other patients have been reported with either a t(4;11)(q21;p14-15) or a t(4;11)(q21;p15) as the primary translocation.21-23 The clinical data, cytogenetics, and immunophenotype of all 6 patients are summarized in Table 1.

Whereas different surface markers have been tested in each individual, the following generalizations can be drawn: (1) the cytochemistry and surface markers of all 6 patients are consistent with T-ALL; (2) the leukemic cells are positive for CD7 and CD5 and usually positive for CD2, but are negative for CD4 and CD8; (3) CD10 is often positive in a proportion of the cells; and (4) most express 1 or more of the myeloid markers CD11b, CD13, and CD33 in a proportion of the cells. None of the 6 patients with the primary translocation was an infant. They ranged from 6 to 53 years of age, with a preponderance of younger individuals, as is typical for T-ALL.24 All had a fairly short survival after diagnosis. Patient no. 1, who showed the longest survival, underwent 2 matched allogeneic bone marrow transplants but relapsed with aggressive disease on both occasions.

Four of the 6 patients presented with additional karyotypic rearrangements (Table 1). This may account for some of the differences between their clinical pictures. Interestingly, the 2 patients who presented with a very low white blood cell count both had a 12p deletion.

We identified NUP98 as the chromosome 11 breakpoint gene by PCR analysis of somatic cell hybrids containing the derivative chromosomes of patient no. 1. It was shown that exons B and C of NUP98 were found on the der(11) and der(4) chromosomes, respectively, thereby mapping the breakpoint to the intron between exons B and C. This confirms the previously reported orientation of NUP98 with regard to the centromere.11 Because the principal transcript in the other NUP98 translocations fuses the 5′ end of the NUP98 gene in frame to the 3′ end of a second gene, we used 3′ RACE and identified the RAP1GDS1 gene as the 3′ partner. RAP1GDS1 has previously been mapped to 4q21-25.25 

RT-PCR showed that NUP98-RAP1GDS1 (NRG) fusion mRNAs were present in patients no. 1, 2, and 3. Sequencing showed that the same RAP1GDS1 sequence, starting at nucleotide 5 of the coding region, was present in all 3 patients (Fig 3). Patients no. 1 and 2 had an identical fusion mRNA containing the 5′ sequence ofNUP98 up to and including exon B, whereas patient no. 3 lackedNUP98 exons A and B. Breakpoints in NUP98 have been reported to occur between exons B and C10-13 or between exons D and E,12 with a predominance of breakpoints between exons B and C.

The breakpoint in patient no. 3 (in the intron preceding exon A) is the most proximal NUP98 breakpoint reported. The more proximal breakpoint position is consistent with the Northern results in which the NRG2 fusion band is almost identically sized to the 4.05-kbNUP98 transcript. NRG2 is 233 bp shorter thanNRG on account of the missing exons A and B.

The absence of the reciprocal RGN transcript in patients no. 1 and 2 (Fig 4) indicates that NRG is the leukemia-associated transcript. It is unclear why the reciprocal transcript is absent asRAP1GDS1 is universally expressed and RGN is under the control of the RAP1GDS1 promoter. A similar situation has been observed for the BCR-ABL translocation in which the reciprocalABL-BCR transcript is not expressed in all CML patients, although ABL is also universally expressed.26 

Nup98 is a component of the nuclear pore complex, involved in the export of RNA and protein from the nucleus.27,28 The previously described fusion partners of NUP98 are functionally diverse.10-13,HOXA9 and HOXD13 code for transcription factors required for normal development29,30and DDX10 codes for a putative RNA helicase.31Another nucleoporin gene, NUP214, is also involved in translocations in leukemia. NUP214, also known as CAN, is fused to either the DEK gene or to the SET gene in cases of AML.32,33 

Both nup98 and nup214 contain multiple phenylalanine-glycine (FG) repeats. The FG repeats are presumed contact sites for multiprotein transport complexes that mediate bidirectional transport across the nuclear pores.34 All known NUP98 and NUP214translocations retain the majority of the FG repeats.10-13The FG repeats are also retained in the 3 patients reported here (Fig7). Patient no. 3, who has the most 5′ breakpoint yet reported, still has 30 of the 37 FG repeats.

Fig. 7.

Schematic representation of the NUP98, smgGDS, NRG, and NRG2 proteins. Vertical arrowheads represent breakpoints in NUP98 and smgGDS. FG, FG (phenylalanine-glycine) repeat-rich areas; GLEBS, GLEBS (Gle2p-binding motif) -like motif48; NRM, nucleoporin RNA binding motif; ARMADILLO, tandem armadillo repeats.

Fig. 7.

Schematic representation of the NUP98, smgGDS, NRG, and NRG2 proteins. Vertical arrowheads represent breakpoints in NUP98 and smgGDS. FG, FG (phenylalanine-glycine) repeat-rich areas; GLEBS, GLEBS (Gle2p-binding motif) -like motif48; NRM, nucleoporin RNA binding motif; ARMADILLO, tandem armadillo repeats.

The FG repeat-containing nup98 portion of the nup98-hoxa9 fusion protein acts as a potent activator of hoxa9 activity by recruiting the CBP and p300 transcriptional coactivators.35 The CBP/p300 binding activity of the nup98-hoxa9 fusion protein is correlated to its transforming activity. The transforming ability is retained when the FG repeat region from nup98 is exchanged for that of nup214, which directly implicates the FG repeats in the transforming activity. Not all of the FG repeats are required to interact with CBP/p300 or to transform, because a nup98-hoxa9 splice variant with 20 FG repeats still retains transforming ability.35 

The entire coding region, except for the initial methionine ofRAP1GDS1, is retained in the NRG and NRG2transcripts. The product rap1gds, usually referred to as smgGDS, has guanine nucleotide exchange factor (GEF) activity.36 GEFs stimulate or inhibit exchange of GDP for GTP at small GTPase proteins to convert the inactive GDP bound form to the active GTP bound form. SmgGDS was first reported as a stimulator of GDP/GTP exchange for rap1a, then called smg p21a.37 SmgGDS also acts on rap1b as well as on other small GTPases, including K-ras, rac1, rac2, rhoA, and ralB.36,38,39 Interestingly, rap1a and K-ras are antagonistic, because the protein smg p21a/rap1a was first identified as Krev-1, which has the ability to revert K-ras–transformed NIH 3T3 fibroblasts.40 However, rap1 is unlikely to be the principal target of smgGDS, because smgGDS cooperates with K-ras in transformation.41 RhoA and rac2 have been reported to be more important targets for smgGDS than rap1a.38 

SmgGDS is structurally unique among the GEFs, because it shows no homology to other GEFs and is composed largely of tandem repeats of the 43 amino acid armadillo motif (Fig 7).42 The armadillo motif was originally found in the Drosophila melanogasterarmadillo gene and its vertebrate homologues β-catenin and plakoglobin.43,44 Subsequently, it was identified in a number of other genes that contain tandem repeats of armadillo,42 including importin α.45 It has been suggested that armadillo repeats mediate protein-protein interactions. 42

Determining the cellular location of nrg will be critical in determining its role in malignancy. SmgGDS normally interacts with membrane-bound and cytoplasmic ras superfamily GTPPases. If the nrg hybrid protein is cytoplasmic, its function may involve alterations of signaling via ras family small GTPases. However, by analogy to other armadillo proteins, such as β-catenin and importin α, smgGDS may have an as yet undescribed cytoplasmic-nuclear shuttling capacity. The armadillo repeats of smgGDS may lead it to mimic β-catenin and interact with the transcription factors involved in the wingless signaling pathway.46 Alternatively, the amino terminal end of nup98 might relocate smgGDS to the nuclear pore so that the fusion protein may modify nuclear transport. Because nrg contains an intact smgGDS sequence, it may act as a second GEF for ran in promoting nuclear transport. Finally, nrg may be located in the nucleus, where it may modify transcription, as happens with other nup98 fusion proteins.35 Transcription factors that interact with the armadillo repeats may become coupled to transcription factors that interact with FG repeats.

This report shows that NUP98 can be involved in T-ALL as well as myeloid malignancies. Moreover, the identification of 3 patients with the NRG fusion shows that the t(4;11)(q21;p15) is a recurrent translocation in T-ALL. Whether NRG is capable of causing cellular transformation and hematological malignancy is the subject of further investigation in our laboratory.

ACKNOWLEDGMENT

The authors thank Ed Sage for his support during the duration of this research. Jenny Hardingham, Viki Kalatzis, and Jennie Finch were involved in the preliminary work that led to this investigation. We also thank Alec Morley, Tim Hughes, Luen Bik To, Lesley Snell, and Pam Dyson for access to patient material and information; Peter Little, Marcel Mannens, and Bert Redeker for cosmids; Nick Wickham for reading the manuscript; Peter Aplan, Leonie Ashman, and Sarah Swinburne for discussions; and Tina Bianco for assistance with figure preparation.

Supported by the National Health and Medical Research Council, Anti Cancer Foundation of South Australia, and the Queen Elizabeth Hospital Research Foundation. D.J.H. was supported by the Queen Elizabeth Hospital Research Foundation.

Sequences reported in this manuscript have been deposited in the Genbank database with accession nos. AF133331 and AF133333.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

REFERENCES

REFERENCES
1
Rabbitts
TH
Chromosomal translocations in human cancer.
Nature
372
1994
143
2
Sawyers
CL
Molecular genetics of acute leukaemia.
Lancet
349
1997
196
3
Look
AT
Oncogenic transcription factors in the human acute leukemias.
Science
278
1997
1059
4
Gilliland
DG
Molecular genetics of human leukemia.
Leukemia
12
1998
S7
(suppl 1)
5
Rowley
JD
The critical role of chromosome translocations in human leukemias.
Annu Rev Genet
32
1998
495
6
Nowell
PC
Rowley
JD
Knudson
AG
Jr
Cancer genetics, cytogenetics—Defining the enemy within.
Nat Med
4
1998
1107
7
Hardingham
JE
Peters
GB
Dobrovic
A
Dale
BM
Kotasek
D
Ford
HE
Story
CJ
Sage
RE
A rare translocation (4;11)(q21;p14-15) in an acute lymphoblastic leukemia expressing T-cell and myeloid markers.
Cancer Genet Cytogenet
56
1991
255
8
Kalatzis
V
Peters
GB
Dobrovic
A
Mapping of the chromosome 11 breakpoint of the t(4;11)(q21;p14-15) translocation.
Cancer Genet Cytogenet
69
1993
122
9
Dobrovic
A
Peters
G
Finch
J
Kalatzis
V
Fitzgerald
D
Hardingham
JE
Sage
RE
Localisation of chromosome 11 breakpoint in a translocation t(4;11) (q21:p15) in T cell acute lymphoblastic leukemia.
Amer J Hum Genet
55
1994
298
(suppl)
10
Nakamura
T
Largaespada
DA
Lee
MP
Johnson
LA
Ohyashiki
K
Toyama
K
Chen
SJ
Willman
CL
Chen
IM
Feinberg
AP
Jenkins
NA
Copeland
NG
Shaughnessy
JD
Jr
Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia.
Nat Genet
12
1996
154
11
Borrow
J
Shearman
AM
Stanton
VP
Jr
Becher
R
Collins
T
Williams
AJ
Dube
I
Katz
F
Kwong
YL
Morris
C
Ohyashiki
K
Toyama
K
Rowley
J
Housman
DE
The t(7;11)(p15;p15) translocation in acute myeloid leukaemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9.
Nat Genet
12
1996
159
12
Arai
Y
Hosoda
F
Kobayashi
H
Arai
K
Hayashi
Y
Kamada
N
Kaneko
Y
Ohki
M
The inv(11)(p15q22) chromosome translocation of de novo and therapy-related myeloid malignancies results in fusion of the nucleoporin gene, NUP98, with the putative RNA helicase gene, DDX10.
Blood
89
1997
3936
13
Raza-Egilmez
SZ
Jani-Sait
SN
Grossi
M
Higgins
MJ
Shows
TB
Aplan
PD
NUP98-HOXD13 gene fusion in therapy-related acute myelogenous leukemia.
Cancer Res
58
1998
4269
14
Miwa
T
Sudo
K
Nakamura
Y
Imai
T
Fifty sequenced-tagged sites on human chromosome 11.
Genomics
17
1993
211
15
McNoe
LA
Eccles
MR
Reeve
AE
Dinucleotide repeat polymorphism at the D11S860 locus.
Nucleic Acids Res
20
1992
1161
16
Lankiewicz
S
Gisselmann
G
Hatt
H
Enhanced RACE method using specific enrichment by biotinylated oligonucleotides bound to streptavidin coated magnetic particles.
Nucleic Acids Res
25
1997
2037
17
Hussey
DJ
Parker
NJ
Hussey
ND
Little
PFR
Dobrovic
A
Characterization of a KRAB family zinc finger gene, ZNF195, mapping to chromosome band 11p15.5.
Genomics
45
1997
451
18
Altschul
SF
Madden
TL
Schäffer
AA
Zhang
J
Zhang
Z
Miller
W
Lipman
DJ
Gapped BLAST and PSI-BLAST: A new generation of protein database search programs.
Nucleic Acids Res
25
1997
3389
19
Moore
MJ
Query
CC
Sharp
PA
Splicing of precursors to messenger RNAs by the spliceosome
The RNA World.
Atkins
J
Gesteland
R
1993
303
Cold Spring Harbor Laboratory
Cold Spring Harbor, NY
20
Crosier
PS
Ricciardi
ST
Hall
LR
Vitas
MR
Clark
SC
Crosier
KE
Expression of isoforms of the human receptor tyrosine kinase c-kit in leukemic cell lines and acute myeloid leukemia.
Blood
82
1993
1151
21
Inoue
S
Tyrkus
M
Ravindranath
Y
Gohle
N
A variant translocation between chromosomes 4 and 11, t(4q;11p) in a child with acute leukemia.
Am J Pediatr Hematol Oncol
7
1985
211
22
Bloomfield
CD
Goldman
AI
Alimena
G
Berger
R
Borgstrom
GH
Brandt
L
Catovsky
D
de la Chapelle
A
Dewald
GW
Garson
OM
Garwicz
S
Golomb
HM
Hossfeld
DK
Lawler
SD
Mitelman
F
Nilsson
P
Pierre
RV
Philip
P
Prigogina
E
Rowley
JD
Sakurai
M
Sandberg
AA
Secker Walker
LM
Tricot
G
Van Den Berghe
H
Van Orshoven
A
Vuopio
P
Whang-Peng
J
Chromosomal abnormalities identify high-risk and low-risk patients with acute lymphoblastic leukemia.
Blood
67
1986
415
23
Pui
CH
Frankel
LS
Carroll
AJ
Raimondi
SC
Shuster
JJ
Head
DR
Crist
WM
Land
VJ
Pullen
DJ
Steuber
CP
Clinical characteristics and treatment outcome of childhood acute lymphoblastic leukemia with the t(4;11)(q21;q23): A collaborative study of 40 cases.
Blood
77
1991
440
24
Catovsky
DFR
The Lymphoid Leukaemias.
1990
Butterworth
London, UK
25
Riess
O
Epplen
C
Siedlaczck
I
Epplen
JT
Chromosomal assignment of the human smg GDP dissociation stimulator gene to human chromosome 4q21-q25.
Hum Genet
92
1993
629
26
Melo
JV
Gordon
DE
Cross
NC
Goldman
JM
The ABL-BCR fusion gene is expressed in chronic myeloid leukemia.
Blood
81
1993
158
27
Powers
MA
Forbes
DJ
Dahlberg
JE
Lund
E
The vertebrate GLFG nucleoporin, Nup98, is an essential component of multiple RNA export pathways.
J Cell Biol
136
1997
241
28
Zolotukhin
AS
Felber
BK
Nucleoporins nup98 and nup214 participate in nuclear export of human immunodeficiency virus type 1 Rev.
J Virol
73
1999
120
29
Lawrence
HJ
Helgason
CD
Sauvageau
G
Fong
S
Izon
DJ
Humphries
RK
Largman
C
Mice bearing a targeted interruption of the homeobox gene HOXA9 have defects in myeloid, erythroid, and lymphoid hematopoiesis.
Blood
89
1997
1922
30
Muragaki
Y
Mundlos
S
Upton
J
Olsen
BR
Altered growth and branching patterns in synpolydactyly caused by mutations in HOXD13.
Science
272
1996
548
31
Savitsky
K
Ziv
Y
Bar-Shira
A
Gilad
S
Tagle
DA
Smith
S
Uziel
T
Sfez
S
Nahmias
J
Sartiel
A
Eddy
RL
Shows
TB
Collins
FS
Shiloh
Y
Rotman
G
A human gene (DDX10) encoding a putative DEAD-box RNA helicase at 11q22-q23.
Genomics
33
1996
199
32
von Lindern
M
Fornerod
M
van Baal
S
Jaegle
M
de Wit
T
Buijs
A
Grosveld
G
The translocation (6;9), associated with a specific subtype of acute myeloid leukemia, results in the fusion of two genes, dek and can, and the expression of a chimeric, leukemia-specific dek-can mRNA.
Mol Cell Biol
12
1992
1687
33
von Lindern
M
van Baal
S
Wiegant
J
Raap
A
Hagemeijer
A
Grosveld
G
Can, a putative oncogene associated with myeloid leukemogenesis, may be activated by fusion of its 3′ half to different genes: Characterization of the set gene.
Mol Cell Biol
12
1992
3346
34
Radu
A
Moore
MS
Blobel
G
The peptide repeat domain of nucleoporin Nup98 functions as a docking site in transport across the nuclear pore complex.
Cell
81
1995
215
35
Kasper
LH
Brindle
PK
Schnabel
CA
Pritchard
CE
Cleary
ML
van Deursen
JM
CREB binding protein interacts with nucleoporin-specific FG repeats that activate transcription and mediate NUP98-HOXA9 oncogenicity.
Mol Cell Biol
19
1999
764
36
Mizuno
T
Kaibuchi
K
Yamamoto
T
Kawamura
M
Sakoda
T
Fujioka
H
Matsuura
Y
Takai
Y
A stimulatory GDP/GTP exchange protein for smg p21 is active on the post-translationally processed form of c-Ki-ras p21 and rhoA p21.
Proc Natl Acad Sci USA
88
1991
6442
37
Yamamoto
T
Kaibuchi
K
Mizuno
T
Hiroyoshi
M
Shirataki
H
Takai
Y
Purification and characterization from bovine brain cytosol of proteins that regulate the GDP/GTP exchange reaction of smg p21s, ras p21-like GTP-binding proteins.
J Biol Chem
265
1990
16626
38
Chuang
TH
Xu
X
Quilliam
LA
Bokoch
GM
SmgGDS stabilizes nucleotide-bound and -free forms of the Rac1 GTP-binding protein and stimulates GTP/GDP exchange through a substituted enzyme mechanism.
Biochem J
303
1994
761
39
Iouzalen
N
Camonis
J
Moreau
J
Identification and characterization in Xenopus of XsmgGDS, a RalB binding protein.
Biochem Biophys Res Commun
250
1998
359
40
Kitayama
H
Sugimoto
Y
Matsuzaki
T
Ikawa
Y
Noda
M
A ras-related gene with transformation suppressor activity.
Cell
56
1989
77
41
Fujioka
H
Kaibuchi
K
Kishi
K
Yamamoto
T
Kawamura
M
Sakoda
T
Mizuno
T
Takai
Y
Transforming and c-fos promoter/enhancer-stimulating activities of a stimulatory GDP/GTP exchange protein for small GTP-binding proteins.
J Biol Chem
267
1992
926
42
Peifer
M
Berg
S
Reynolds
AB
A repeating amino acid motif shared by proteins with diverse cellular roles (letter).
Cell
76
1994
789
43
Peifer
M
Wieschaus
E
The segment polarity gene armadillo encodes a functionally modular protein that is the Drosophila homolog of human plakoglobin.
Cell
63
1990
1167
44
McCrea
PD
Turck
CW
Gumbiner
B
A homolog of the armadillo protein in Drosophila (plakoglobin) associated with E-cadherin.
Science
254
1991
1359
45
Gorlich
D
Henklein
P
Laskey
RA
Hartmann
E
A 41 amino acid motif in importin-alpha confers binding to importin-beta and hence transit into the nucleus.
EMBO J
15
1996
1810
46
Dierick
H
Bejsovec
A
Cellular mechanisms of wingless/Wnt signal transduction.
Curr Top Dev Biol
43
1999
153
47
Fontoura
BM
Blobel
G
Matunis
MJ
A conserved biogenesis pathway for nucleoporins: Proteolytic processing of a 186-kilodalton precursor generates Nup98 and the novel nucleoporin, Nup96.
J Cell Biol
144
1999
1097
48
Pritchard
CE
Fornerod
M
Kasper
LH
van Deursen
JM
RAE1 is a shuttling mRNA export factor that binds to a GLEBS-like NUP98 motif at the nuclear pore complex through multiple domains.
J Cell Biol
145
1999
237

Author notes

Address reprint requests to Alexander Dobrovic, PhD, Chief Medical Scientist, Department of Haematology-Oncology, The Queen Elizabeth Hospital, Woodville, SA 5011, Australia; e-mail:adobrovic@medicine.adelaide.edu.au.