Abstract

The IIb/β3 receptor is central to platelet aggregation. Biological studies of this receptor have been limited by the inability to reproduce IIb/β3 function in a cell system. Increasingly, efforts are being directed at studies of this receptor in mice models. The structure of murine (m) β3 has been reported. We now have sequenced the mIIb gene and found that it has the same size and organization as the human gene. The exon/intron borders are reported here, as are the distances between exons. mIIb protein is 1,033 amino acids (aa), 7 and 5 aa shorter than human (h) and rodent (r) IIb, respectively, with 79% and 90% homology, respectively. As part of the comparative analysis of the 3 known IIb chains included in this report, we found that a particular region of the IIb N-terminal β-propeller is highly conserved and speculate that it directly participates in ligand binding.

THE PLATELET-SPECIFIC integrin αIIb/β3 (GPIIb-IIIa, CD41, CD62) binds fibrinogen and other ligands after platelet activation.1,2 This receptor is densely packed on the surface of the platelet with 80,000 copies per platelet3 and also does not bind its ligand with high affinity until the platelet is activated and the receptors are “turned on.”4 Given the central role played by this receptor in thrombosis and the successful clinical application of anti-αIIb/β3–directed strategies to prevent thrombotic complications,5 a great deal of effort has been carried out to establish a functional assay system to study the αIIb/β3 receptor system ex vivo. These studies have focused on stable transfections in cell lines such as Chinese hamster ovary (CHO) or in lymphoid cells.6,7 Both lines suffer from the limited number of receptors on the surface and the artificial fashion in which these cells need to be activated. At best, these lines show binding in the nonactivated state and only modest increases after activation.

Attention has, therefore, focused on setting up more vigorous systems in in vivo models with an emphasis on murine studies. The mβ3 cDNA has been described8 and, subsequently, the mβ3 knockout has been produced with a phenotype similar to Glanzmann thrombasthenia.9 Furthermore, studies have been done with the first mβ3 knock-in, introducing a mutation into the mβ3 cytoplasmic tail (Y747F) and showing a mild decrease in platelet aggregation after agonist activation.10Additionally, studies have begun introducing human αIIb and β3 chains into primary megakaryocytic progenitors. For example, hβ3 constructs were introduced into mβ3 knockout marrow cells using a retroviral system, and the resulting megakaryocytes were rescued with regard to αIIb/β3 properties such as clot retraction, presumably secondary to mαIIb/hβ3 receptor complexes on the surface of the megakaryocytes.11 Such studies show that cross-species heterodimers readily form and are functional, although there are going to be important limitations in such studies, as it is known that αIIb/β3 receptors appear to have different species related properties such as in their sensitivity to RGD peptides.12,13 

To carry out similar studies for mαIIb, we have cloned the gene and derived the encoded cDNA sequence. The gene organization is remarkably well preserved. The encoded protein is described and compared with the known hαIIb and rαIIb.14,15 

MATERIALS AND METHODS

Isolation of the mαIIb λ and bacterial artificial chromosome (BAC) clones.

Full-length rαIIb cDNA was random-primer labeled16 with32P-dCTP and used to screen a λFIX mouse 129SV genomic library (Stratagene, La Jolla, CA) using nitrocellulose filter lifts of the plated phage. Individual positive colonies were obtained using repeat rounds of dilutional plating, and these were grown in large scale and purified using a cesium gradient as previously described.16 

DNA from the genomic clones was characterized by restriction digest and Southern blotting16 using again the rat αIIb cDNA as probe. A 6-kb BamHI fragment was subcloned from the original positive λFIX clone and subcloned into BamHI cut pBSK+ library (Stratagene).

The sequence in mαIIb Intron 12 was used to polymerase chain reaction (PCR)-screen a BAC mouse 129SV genomic library (Genome Systems, St Louis, MO), using the primers forward: 5′-ATGGACTTACCCCCATAGAT-3′ and reverse: 3′-ACTTCCCCGGGATTCTGCGC-3′ to give a 0.5-kb band. The BAC clone was then used to obtain the sequence through exon 15, and then a PCR-amplified region for exons 15 and 16 was randomly primer labeled and used to rescreen the original λFIX library to complete the characterization of the mαIIb gene.

mαIIb gene characterization.

The 5′-BamHI pBSK clone, the 5′- and 3′-λFIX clones, and the BAC clone described above were end sequenced with the appropriate primers (eg, T7, SP6, and T3 primers). Subsequent primers were generated based on the new data and used to prime the next round of sequencing reaction. All sequencing used fluorescenated dNTPs, and Sequenase (USB, Cleveland, OH) and an ABI 373A automated sequencer (PE Applied Biosystems, Foster City, CA). Sequences were stored and analyzed using MacDNasis (Hitachi Software, San Diego, CA) and the BLAST program at the National Center for Biotechnology, which hosts an internet site at URL: http://www.nlm.nih.gov/.

RESULTS AND DISCUSSION

Characterization of the mαIIb gene.

The only previously characterized αIIb cDNAs were those of human and rat.14,15 Using the rat αIIb cDNA, we screened a 129SV murine genomic λFIX library. Sequencing of overlapping αIIb+ clones helped to provide the majority of sequence of the mαIIb gene and its surrounding locus. In addition, we PCR-screened an mBAC 129SV murine genomic library using primers derived from these λ sequences. A single αIIb+ BAC clone was obtained and sequenced to fill the remaining sequence. The complete sequence for the murine αIIb gene and cDNA are available through GenBank at the National Center for Biotechnology (accession nos.AF170316 and AF169829). Using restriction mapping of the mαIIb BAC clone, we have previously reported that the murine gene is flanked by the KIAA-O553 gene upstream and the Granulin gene downstream, and that this organization is conserved in the hαIIb locus.17 The genes themselves are also organized into very similar exons and introns of virtually identical size. A summation of the exon/intron borders of the mαIIb gene with the distance between the various exons is shown in Table 1. Since the promoter region, through the beginning of the coding region of the mαIIb gene had been previously published,18 the data begin with exon 1’s splice donor region. It should be pointed out that the hαIIb gene has a “GC” instead of the canonical “GT” at the splice donor sequence for exons 5 and 8. This variation is also present for the mαIIb gene (double underlined in Table 1). The 3′-untranslated region is poorly conserved except in the immediate region around the purported polyadenylation signal site.

Table 1.

Exon/Intron Organization of the mIIb Gene

Splice Donor Intron No. (size) Splice Acceptor
acatggaagGTGAGCGCTAAAGGACATATGGGCG  1 (1,623 bp) GTGCTCATCCAGCTTTCCTACACAGcgtgtccat  
  H  G  S  V  S  I  
tcgacctcaGTGAGTCTCAAGAATGAAGGGGAAA 2 (89 bp)  CTCCACCTTTACTTGTGCCCTCCAGgggatgaga 
F  D  L   R  D  E   
gtcattgtgGTGGGTACTGTGGACAAGTCAAAGG  3 (97 bp) CTACTCTCCTGTGGGTCTGCTCTAGgcctgtgcc  
 V  I  V  A  C  A  
agagttttcGTAAGCTCTGGTTTGCCATTCGCTC  4 (222 bp) GCTGATCCCCGCTTGCCTCTTGTAGgcggagaca  
E  S  F  R  G  D    
gtgacccagGC̲AAGTCACAGGCAAAAGCAAACAA 5 (535 bp)  TTCACGACCAGGACTTCTTTTTCAGgctggggag 
 V  T  Q   A  G  E  
tttttttagGTAGTGCCCAGGAATCCAACCCACT  6 (91 bp) AGCCCTCTCCCTGTGCCCTTCCTAGgtctcctgg  
F  F  L  G  L  L   
gttaccgggGTAACGCTGGCAGCTCCTTTCCAAG  7 (312 bp) CGGTAAACTGTGCTGTGTCTTTCAGgatattcgg  
G  Y  R  G  Y  S   
gcactacagGC̲AAGGAATGCAGGGGGCGAGGGGG 8 (135 bp)  ATTTGCTGACCCTTGCTCTCCCCAGagtacgtat 
S  T  T   E  Y  V   
ttgggagcgGTGAGTAGTGGCTCTCTCACCGCTT  9 (160 bp) CATTTTGGTGTGTCCCTCCATGCAGgtggaaatt  
 L  G  A  V  E  I  
GgagaacagGTCGGGGCGGTGACCCCATGGGCAT  10 (142 bp) AATGGAAGTGCTATTCCTCTTGTAGatggcttca  
 G  E  Q  M  A  S  
cggggacggGTGAGAAGAGGGAATGTCCCACCCT  11 (153 bp) CTAACCTTACCCATCTGGTCCACAGgaggcatga  
 G  D  G  R  H  D  
gctataatgGTGAGTGGGGGAGCTGCATTTGGCC  12 (3,121 bp) CCACACTCTTTCTCTCTCCTTCTAGatattgctg  
G  Y  N  D  I  A   
gatacccagGTGACTATGGGTTACAGCCAGCCAG  13 (273 bp) TTGACCCTTCTCCCTATGCCTATAGacctgattg  
G  Y  P  D  L  I   
tgtgtacagGTGAGCTCTGACTAGGGGGAGGGAC  14 (84 bp) AGCGAGCCTCTTCCAATCCCATCAGagctcagcc  
  V  Y  R  A  Q  P  
agtcagctgGTGAGGAGGTGGAGGTCACGGACTT 15 (84 bp)  CACAAACCTGCCCTCATCTTTGCAGcttcaacat 
  V  S  C   F  N  I 
agaagctgcGTGAGTGCCATGGAGTGAGGGGTTG  16 (89 bp) TGGATCCTTCCTGCTTGCCATGCAGatctaaagg  
Q  K  L  H  L  K   
ttccttcggGTATGCTCAGGCTAGGATGGGAGGG  17 (107 bp) CAGACTCTTGCCGTGCGCACGCTAGgatgaggcc  
 F  L  R  D  E  A  
caggagcagGTAGGAATAGTGGGACGAGCAAGAT  18 (310 bp) ACACGCATCCCATTGTGTCCCCTAGacacggatc  
 Q  E  Q  T  R  I  
agctactgcGTGAGAGAGTCTTTCACTCTACCCA  19 (117 bp) CCTAAACCAAGCACTCCCCATACAGgggggactc  
  A  T  A  G  D  S  
aacattgagGTGAGGTACCACCATGGGGCATAGC 20 (1,438 bp)  GCCCCACCTGTCTGTGCATCTCCAGggctttgag 
 N  I  E   G  F  E  
gacacccggGTAAGGGCTCTGTGATGTAACTCTA  21 (149 bp) TGACGTTGGATTTTCCCTCTTCCAGataggaatc  
 D  T  R  I  G  I  
ggtcaggagGTACTGAGCTGGGCAGCATGGCTGA  22 (260 bp) CTTCTTTTCACCTTCTCCCCTCCAGcaagaacag  
  V  R  S  K  N  S  
gcttcgaggGTGAGAGACCAAGCATGGGACGGGG 23 (212 bp)  TCTCTGGGGACTTGGACACTTGCAGgaattcctt 
  L  R  G   N  S  F 
acctatgagGTAGGGAGGAGCCTCTGGGTAAGAT  24 (141 bp) GCCACCCCGCTATCTCCACCCCCAGctccacaac  
 T  Y  E  L  H  N  
tctcccaagGTAAGGTTCTGGGAGAGAGAAGGAG  25 (100 bp) TTGATTGTGTCCTTGTTCCCCCCAGgtggactgg  
 S  P  K  V  D  W  
gttctggtgGTGAGAAGGCTCAGCGGGCTCGAGC  26 (630 bp) CTTACCACACATCCATCCCCCTCAGagctgcgac  
 V  L  V  S  C  D  
ctccgccagGTGGGGCTAGACCCGGATGGGCGGG  27 (229 bp) CGCCTGTCACCCCCGCCCCATACAGaggccgcag  
 L  R  Q  R  P  Q  
caagctcggGTAAGAGACCCTGGTTCTCCTGCTG  28 (218 bp) GAAGTGACATCTAGTTTGCCCTCAGgtgcagaca  
 Q  A  R  V  Q  T  
atgtggaagGTGAGGCTGAAAGGGAGACACAAAC  29 (2,050 bp) AGCTCCTGTGCCCTTCCCCCTCCAGgctggcttc  
 M  W  K  A  G  F   
GaagagCAGCAGAGGGGGCGGGGTTCCTGGT 〈〈〈103 bp〉〉〉     ACCGAGCTTGACAGTGAT  
 E  E ter       poly A signal 
Splice Donor Intron No. (size) Splice Acceptor
acatggaagGTGAGCGCTAAAGGACATATGGGCG  1 (1,623 bp) GTGCTCATCCAGCTTTCCTACACAGcgtgtccat  
  H  G  S  V  S  I  
tcgacctcaGTGAGTCTCAAGAATGAAGGGGAAA 2 (89 bp)  CTCCACCTTTACTTGTGCCCTCCAGgggatgaga 
F  D  L   R  D  E   
gtcattgtgGTGGGTACTGTGGACAAGTCAAAGG  3 (97 bp) CTACTCTCCTGTGGGTCTGCTCTAGgcctgtgcc  
 V  I  V  A  C  A  
agagttttcGTAAGCTCTGGTTTGCCATTCGCTC  4 (222 bp) GCTGATCCCCGCTTGCCTCTTGTAGgcggagaca  
E  S  F  R  G  D    
gtgacccagGC̲AAGTCACAGGCAAAAGCAAACAA 5 (535 bp)  TTCACGACCAGGACTTCTTTTTCAGgctggggag 
 V  T  Q   A  G  E  
tttttttagGTAGTGCCCAGGAATCCAACCCACT  6 (91 bp) AGCCCTCTCCCTGTGCCCTTCCTAGgtctcctgg  
F  F  L  G  L  L   
gttaccgggGTAACGCTGGCAGCTCCTTTCCAAG  7 (312 bp) CGGTAAACTGTGCTGTGTCTTTCAGgatattcgg  
G  Y  R  G  Y  S   
gcactacagGC̲AAGGAATGCAGGGGGCGAGGGGG 8 (135 bp)  ATTTGCTGACCCTTGCTCTCCCCAGagtacgtat 
S  T  T   E  Y  V   
ttgggagcgGTGAGTAGTGGCTCTCTCACCGCTT  9 (160 bp) CATTTTGGTGTGTCCCTCCATGCAGgtggaaatt  
 L  G  A  V  E  I  
GgagaacagGTCGGGGCGGTGACCCCATGGGCAT  10 (142 bp) AATGGAAGTGCTATTCCTCTTGTAGatggcttca  
 G  E  Q  M  A  S  
cggggacggGTGAGAAGAGGGAATGTCCCACCCT  11 (153 bp) CTAACCTTACCCATCTGGTCCACAGgaggcatga  
 G  D  G  R  H  D  
gctataatgGTGAGTGGGGGAGCTGCATTTGGCC  12 (3,121 bp) CCACACTCTTTCTCTCTCCTTCTAGatattgctg  
G  Y  N  D  I  A   
gatacccagGTGACTATGGGTTACAGCCAGCCAG  13 (273 bp) TTGACCCTTCTCCCTATGCCTATAGacctgattg  
G  Y  P  D  L  I   
tgtgtacagGTGAGCTCTGACTAGGGGGAGGGAC  14 (84 bp) AGCGAGCCTCTTCCAATCCCATCAGagctcagcc  
  V  Y  R  A  Q  P  
agtcagctgGTGAGGAGGTGGAGGTCACGGACTT 15 (84 bp)  CACAAACCTGCCCTCATCTTTGCAGcttcaacat 
  V  S  C   F  N  I 
agaagctgcGTGAGTGCCATGGAGTGAGGGGTTG  16 (89 bp) TGGATCCTTCCTGCTTGCCATGCAGatctaaagg  
Q  K  L  H  L  K   
ttccttcggGTATGCTCAGGCTAGGATGGGAGGG  17 (107 bp) CAGACTCTTGCCGTGCGCACGCTAGgatgaggcc  
 F  L  R  D  E  A  
caggagcagGTAGGAATAGTGGGACGAGCAAGAT  18 (310 bp) ACACGCATCCCATTGTGTCCCCTAGacacggatc  
 Q  E  Q  T  R  I  
agctactgcGTGAGAGAGTCTTTCACTCTACCCA  19 (117 bp) CCTAAACCAAGCACTCCCCATACAGgggggactc  
  A  T  A  G  D  S  
aacattgagGTGAGGTACCACCATGGGGCATAGC 20 (1,438 bp)  GCCCCACCTGTCTGTGCATCTCCAGggctttgag 
 N  I  E   G  F  E  
gacacccggGTAAGGGCTCTGTGATGTAACTCTA  21 (149 bp) TGACGTTGGATTTTCCCTCTTCCAGataggaatc  
 D  T  R  I  G  I  
ggtcaggagGTACTGAGCTGGGCAGCATGGCTGA  22 (260 bp) CTTCTTTTCACCTTCTCCCCTCCAGcaagaacag  
  V  R  S  K  N  S  
gcttcgaggGTGAGAGACCAAGCATGGGACGGGG 23 (212 bp)  TCTCTGGGGACTTGGACACTTGCAGgaattcctt 
  L  R  G   N  S  F 
acctatgagGTAGGGAGGAGCCTCTGGGTAAGAT  24 (141 bp) GCCACCCCGCTATCTCCACCCCCAGctccacaac  
 T  Y  E  L  H  N  
tctcccaagGTAAGGTTCTGGGAGAGAGAAGGAG  25 (100 bp) TTGATTGTGTCCTTGTTCCCCCCAGgtggactgg  
 S  P  K  V  D  W  
gttctggtgGTGAGAAGGCTCAGCGGGCTCGAGC  26 (630 bp) CTTACCACACATCCATCCCCCTCAGagctgcgac  
 V  L  V  S  C  D  
ctccgccagGTGGGGCTAGACCCGGATGGGCGGG  27 (229 bp) CGCCTGTCACCCCCGCCCCATACAGaggccgcag  
 L  R  Q  R  P  Q  
caagctcggGTAAGAGACCCTGGTTCTCCTGCTG  28 (218 bp) GAAGTGACATCTAGTTTGCCCTCAGgtgcagaca  
 Q  A  R  V  Q  T  
atgtggaagGTGAGGCTGAAAGGGAGACACAAAC  29 (2,050 bp) AGCTCCTGTGCCCTTCCCCCTCCAGgctggcttc  
 M  W  K  A  G  F   
GaagagCAGCAGAGGGGGCGGGGTTCCTGGT 〈〈〈103 bp〉〉〉     ACCGAGCTTGACAGTGAT  
 E  E ter       poly A signal 

Genomic organization at the exon/intron borders are shown beginning with exon 1’s splice donor region. 9 bp of the exons and 25 bp of the introns are shown at the splicing junctions. Total intron size is indicated. Splice donors and acceptors are underlined. The “GC” instead of “GT” splice donors for exons 5 and 8 are double-underlined. The termination codon and polyadenylation signal in exon 30 are boxed, and the left out sequence between the sequences shown is indicated.

Characterization of the mαIIb cDNA.

We extracted the mαIIb cDNA from the above sequence and have used these sequences for reverse transcriptase (RT)-PCR of murine platelet RNA with amplification of expected band size and have confirmed portions of the sequence. A comparison with rat and human protein sequence is shown in Fig 1. mαIIb is 1,033 amino acids (aa), 7 and 5 aa shorter than human and rodent αIIb, respectively. There is 79% and 90% homology between hαIIb and rαIIb with mαIIb, respectively, which is near average for these cross-species homology.15 As expected, the signal peptides have lower homology than the remaining mature proteins, but the region surrounding the start of the mature protein is well conserved (see arrow in Fig 1). The least-conserved region is near the cleavage site into the light and heavy chain. Although the cleavage site itself is conserved (underlined “RR” in Fig 1), homology with hαIIb and rαIIb is only 50% and 60%, respectively. In contrast, the transmembrane and cytoplasmic domains are highly conserved.

Fig. 1.

Cross-species comparison of mIIb with hIIb and rIIb. The single-letter amino acid sequence of mIIb is shown at the top and those of the other 2 species are shown below. A”:” refers to an identical homologous aa. A “–” refers to a missing aa. The start site for mature IIb is indicated by an arrow. The 3 regions of the N-terminal β-propeller regions discussed are grayed in and labeled. The transmembrane domain is crosshatched grayed in and is also labeled. The double-arginine cleavage site is underlined.

Fig. 1.

Cross-species comparison of mIIb with hIIb and rIIb. The single-letter amino acid sequence of mIIb is shown at the top and those of the other 2 species are shown below. A”:” refers to an identical homologous aa. A “–” refers to a missing aa. The start site for mature IIb is indicated by an arrow. The 3 regions of the N-terminal β-propeller regions discussed are grayed in and labeled. The transmembrane domain is crosshatched grayed in and is also labeled. The double-arginine cleavage site is underlined.

Studies of natural-occurring and directed mutations have suggested that the 3 upper surface loops of the N-terminal β-propeller of αIIb may be involved in ligand binding. Our cross-species comparison shows that there is 100% conservation at the middle of these 3 loops (grayed area for the “W3 loop” in Fig 1). However, there is poor conservation in the other 2 loops (“W2/3 loop” and “W3/4 loop” in Fig1). We would have expected a loop involved in ligand binding to be highly preserved. One possible explanation for this divergence could be that these differences in receptor loop structure help to accommodate for species differences in the primary structure of the fibrinogen ligand itself. Supporting this, it has been shown that the αIIb/β3 receptor of different species have different sensitivities to RGD peptide inhibition of fibrinogen binding so that rodent and murine platelets are much more resistant to RGD peptide inhibition than human platelets.12 Whether this difference in species RGD sensitivity is caused by the rapid evolution of sequences in the W2/3 and W3/4 loops remains to be investigated.

Supported in part by National Institutes of Health Grant No. HL40387.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

REFERENCES

REFERENCES
1
Phillips
DR
Charo
IF
Parise
LV
Fitzgerald
LA
The platelet membrane glycoprotein IIb-IIIa complex.
Blood
71
1988
831
2
Ginsberg
MH
Xiaoping
D
O’Toole
TE
Loftus
JC
Plow
EF
Platelet integrins.
Thromb Haemost
70
1993
87
3
Wagner
CL
Mascelli
MA
Neblock
DS
Weisman
HF
Coller
BS
Jordan
RE
Analysis of GPIIb/IIIa receptor number by quantification of 7E3 binding to human platelets.
Blood
88
1996
907
4
Shattil
SJ
Ginsberg
MH
Integrin signaling in vascular biology.
J Clin Invest
100
1997
S91
(11 suppl)
5
Coller
BS
Platelet GPIIb/IIIa antagonists: The first anti-integrin receptor therapeutics.
J Clin Invest
100
1997
S57
(11 suppl)
6
Tozer
EC
Baker
EK
Ginsberg
MH
Loftus
JC
A mutation in the alpha subunit of the platelet integrin alphaIIbbeta3 identifies a novel region important for ligand binding.
Blood
93
1999
918
7
Loh
E
Qi
W
Vilaire
G
Bennett
JS
Effect of cytoplasmic domain mutations on the agonist-stimulated ligand binding activity of the platelet integrin alphaIIbbeta3.
J Biol Chem
271
1996
30233
8
Cieutat
AM
Rosa
JP
Letourneur
F
Poncz
M
Rifat
S
A comparative analysis of cDNA-derived sequences for rat and mouse beta3 integrins (GPIIIa) with their human counterpart.
Biochem Biophys Res Commun
193
1993
771
9
Hodivala-Dilke
KM
McHugh
KP
Tsakiris
DA
Rayburn
H
Crowley
D
Ullman-Cullere
M
Ross
FP
Coller
BS
Teitelbaum
S
Hynes
RO
Beta3-integrin-deficient mice are a model for Glanzmann thrombasthenia showing placental defects and reduced survival.
J Clin Invest
103
1999
229
10
Law
DA
DeGuzman
F
Ministri
K
Phillips
DR
Demonstration of a role for the β3 cytoplasmic tyrosine residues in platelet function using mice expressing a mutant (Y747F) β3.
Blood
92
1998
701a
(abstr, suppl 1)
11
Wilcox
DA
Hodivala-Dilke
KM
Hynes
RO
White
GC
II
Of mice and men: Detection of a functional murine αIIb-human β3 heterodimer complex on the surface of megakaryocytes derived from retrovirus transduced bone marrow cells from β3-knockout mice.
Blood
92
1998
702a
(abstr, suppl 1)
12
Cox
D
Motoyama
Y
Seki
J
Aoki
T
Dohi
M
Yoshida
K
Pentamidine: A non-peptide GPIIb/IIIa antagonist—In vitro studies on platelets from humans and other species.
Thromb Haemost
68
1992
731
13
Jennings
LK
White
MM
Mandrell
TD
Interspecies comparison of platelet aggregation, LIBS expression and clot retraction: Observed differences in GPIIb-IIIa functional activity.
Throm Haemost
74
1995
1551
14
Poncz
M
Eisman
R
Heidenreich
R
Silver
SM
Vilaire
G
Surrey
S
Schwartz
E
Bennett
JS
Structure of the platelet membrane glycoprotein IIb. Homology to the alpha subunits of the vitronectin and fibronectin membrane receptors.
J Biol Chem
262
1987
8476
15
Poncz
M
Newman PJ. Analysis of rodent platelet glycoprotein IIb: Evidence for evolutionarily conserved domains and alternative proteolytic processing.
Blood
75
1990
1282
16
Sambrook
J
Fritsch
EF
Maniatis
T
Molecular Cloning: A Laboratory Manual
ed 2
1989
Cold Spring Harbor Laboratory Press
Cold Spring Harbor, NY
17
Thornton
MA
Poncz
M
Korostishevsky
M
Yakobson
E
Usher
S
Seligsohn
U
Peretz
H
The human platelet αIIb gene is not closely linked to its integrin partner β3.
Blood
94
1999
2039
18
Denarier
E
Martin
F
Martineau
S
Marguerie
G
PCR cloning and sequence of the murine GPIIb gene promoter.
Biochem Biophys Res Commun
195
1993
1360

Author notes

Address reprint requests to Mortimer Poncz, MD, The Children’s Hospital of Philadelphia, 34th St and Civic Center Blvd, Philadelphia, PA 19104; e-mail: poncz@emailchop.edu.