The B-cell antigen receptor (BCR) comprises membrane Igs (mIgs) and a heterodimer of Ig (CD79a) and Igβ (CD79b) transmembrane proteins, encoded by the mb-1 and B29 genes, respectively. These accessory proteins are required for surface expression of mIg and BCR signaling. B cells from chronic lymphocytic leukemia (B-CLL) frequently express low to undetectable surface Ig, as well as CD79b protein. Recent work described genetic aberrations affecting B29 expression and/or function in B-CLL. Because the prevalence of CLL is increased among first degree relatives, we analyzed the B29 gene in 10 families including 2 affected members each. A few silent or replacement mutations were observed at the genomic level, which never lead to truncated CD79b protein. Both members of the same family did not harbor the same mutations. However, a single silent base change in the B29 extracellular domain, corresponding to a polymorphism, was detected on 1 allele of most patients. These results indicate that the few mutations observed in the B29 gene in these patients do not induce structural abnormalities of the CD79b protein and thus do not account for its low surface expression in B-CLL. Furthermore, genetic factors were not implicated, because identical mutations were not observed among 2 members of the same family.

B-CELL CHRONIC LYMPHOCYTIC leukemia (B-CLL), the leukemia with highest incidence in western countries, is a neoplastic disease characterized by a progressive accumulation of functionally incompetent, long-lived, small, mature lymphocytes in the blood, bone marrow, and lymphoid tissues.1,2B-CLL lymphocyte is characterized by (1) expression of CD5 antigen3; (2) constant expression of low amounts of surface Ig (sIg)4,5 and CD79b6,7; (3) inability to adequately respond when stimulated through the B-cell receptor (BCR) pathway8,9; (4) resistance to infection by the Epstein-Barr Virus (EBV), in contrast with normal CD5+ B cells, despite expressing the CD21 molecule10; (5) autoreactive binding specificities10,11; (6) a prolonged G0 phase; and (7) overexpression of the bcl-2 protein.12 

In B-CLL, B lymphocytes express low amounts of sIg. sIg on B cells bind noncovalently with a heterodimer Igα (CD79a)/Igβ (CD79b) to constitute the B-cell antigen receptor (BCR).13,14 CD79a and CD79b are encoded by the mb-1 and B29 genes, respectively. Both proteins contain an extracellular Ig-like domain, a transmembrane segment, and a cytoplasmic tail, which contains a motif sequence including 2 tyrosine residues. Phosphorylation of these tyrosine residues upon Ag receptor stimulation initiates signal transduction cascades.15 In addition, association of Ig with CD79a and CD79b is essential for intracellular transport and subsequent surface expression of this BCR16,17 and plays a major role in antigen internalization and induction of apoptosis through the BCR pathway.18 

Defects in the BCR may account for functional impairment in BCR signaling. In addition to low expression of sIg, it was also reported that the vast majority of B-CLL patients also express low to undetectable amounts of CD79b extracellular domain.6,7 

A study of mRNA in B-CLL by Thompson et al7 has recently shown that, whereas B29 mRNA was undetectable in half of their B-CLL samples, it was detected in the other samples at a level identical to that of normal B cells. However, B-CLL cells with a normal level of B29 mRNA had point mutations, insertions, or deletions in the B29 transmembrane and cytoplasmic domains, which could account for the low CD79b surface expression.

The possibility that genetic or familial factors may predispose to CLL is suggested by reports of multiple instances of the disease in some families, indicating a 2- to 7-fold excess risk in first degree relatives.19,20 In addition, the low incidence of CLL among individuals of Japanese origin, including those having migrated to Hawaii, suggests that genetic influences may play a stronger role than environmental factors in the pathogenesis of the disease.21However, the nature of the genetic predisposition remains unknown.

It is presently unclear whether the BCR could play a major role in the pathogenesis of the disease and whether the above-mentioned genetic defects observed in CD79b gene could constitute a primary event in B-CLL leukemogenesis. The study of familial cases should help address this question. We report a study at the genomic level of the B29 gene in 10 families, each with 2 siblings manifesting typical CLL. We found only a few mutations leading to amino acid replacement, none of which would be predicted to result in structural alterations of the CD79b protein. Because identical mutations of the B29 gene were not found in both affected siblings in the same family, genetics factors involving CD79b may not play a major role in CLL pathogenesis.

MATERIALS AND METHODS

Patients.

Total blood samples from 10 different Italian families, including 2 members affected with CLL, were stored at −20°C in the Clinica de la Sapienza (Rome, Italy). Families 1 through 8 have been studied for the VH gene expression of their Ig.21a Families 13 and 14 have been added in this study. All of the patients studied demonstrated typical CD5+ B-CLL. They comprised 9 men and 11 women aged from 35 to 95 years who were staged at diagnosis following Binet’ staging22 (stage A, 14 patients; stage B, 4; stage C, 1; in 1 case, stage could not be determined). Two patients progressed to stage B during evolution. At the time of the study, 5 patients had received previous treatment, whereas 15 patients did not receive any previous treatment.

DNA extraction.

Total DNA was purified from up to 10 mL of whole citrated blood with the QIAamp Blood Maxi kit (QIAGEN, Hilden, Germany). The purified DNA ranged in size up to 50 kb, with fragments of approximately 30 kb predominating. DNA yields ranged from 15 to 600 μg according to the cell densities.

Polymerase chain reaction (PCR) amplification.

PCR amplification was performed with genomic DNA using Taq DNA polymerase (GIBCO-BRL, Bethesda, MD) and 2 sets of oligonucleotides for the B29 gene. The first one, designed to amplify the Ig domain and the transmembrane region, consisted of the forward primer 5′GTAGTGCTTGTTCGCGGATC3′ (corresponding to nucleotides 2006-2025 in the DNA sequence23) and the reverse primer 5′CTTGTCCAGCAGCAGGAAGA3′ (corresponding to nucleotides 2824-2805). The second one, designed to amplify the intracytoplasmic domain, consisted of the forward primer 5′GATGACAGCAAGGCTGGCAT3′ (nucleotides 3122-3141) and the reverse primer 5′CTCCTGGCCTGGGTGCTCA3′ (3368-3350).

Thirty cycles of amplification were performed under the following conditions: 95°C for 30 seconds, 60°C for 30 seconds (for Ig domain and transmembrane segment) or 65°C for 30 seconds (for intracytoplasmic domain), and 72°C for 1 minute.

Amplification of VH Ig genes was performed from genomic DNA using 5′ primers designed to anneal to the leader sequence (LH) of VH1 to VH6 families, and a consensus JH 3′ primer. The LHprimers consisted of the following: LH1: 5′CCATGGACTGGACCTGG3′; LH2: 5′ATGGACACACTTTGCTMCAC3′; LH3: 5′CCATGGAGTTTGGGCTGAGC3′; LH4: 5′ATGAAACACCTGTGGTTCTTCC3′; LH5: 5′ATGGGGTCAACCGCCATCC3′; and LH6: 5′ATGTCTGTCTCCTTCCTCATC3′. The consensus JHprimer consisted of 5′ACCTGAGGAGACGGTGACCAGGGT3′. In all cases, 30 cycles of amplification (95°C for 30 seconds, 65°C for 30 seconds, and 72°C for 1 minute) were performed.

Cloning and sequencing of B29 and VH Ig genes.

PCR products were gel purified and subcloned into a TA cloning vector, followed by transformation into INVαF′ cells (Invitrogen, San Diego, CA). Recombinant plasmids were purified and sequence analysis was performed.

Nucleotide sequence data of VH Ig genes were analyzed and compared with the GenBank database (Bethesda, MD). The complete sequences have been contributed to GenBank for families 1 to 8 (accessions nos. AF087415-AF087430) .

RESULTS

Clinical and biological data in 10 families affected with CLL.

Ten families, each with 2 members affected with CLL, were studied. Clinical and biological data concerning these patients are reported in Table 1. Except for 2 patients (1A and 14B), they all had lymphocytosis, whether treated or not. It can be observed in the 6 families with vertical transmission of the disease that the mean age of the parental generation was 81 years as compared with a mean of 50 years for the second generation. This earlier appearance of CLL in the second generation suggested that genetic factors could influence the development of the disease.

Table 1.

Clinical and Biological Data in Members With CLL From 10 Different Italian Families

Family Sex/Age Relationship Stage Treatment LY
 1A  F/81  MO  B  CB  1  
 1B  M/57  SO A  NO  30  
 2A  M/43  BR  A  NO  30 
 2B  F/52  SI  C  NO  120  
 3A  F/85  MO A  CB  40  
 3B  F/63  DA  A  NO  
 4A  F/68  MO  A  NO  20  
 4B  M/35  SO A-B  FLU  7  
 5A  M/62  BR  A  NO  45 
 5B  F/56  SI  A  NO  15  
 6A  F/95  MO A  NO  40  
 6B  F/56  DA  B  NO  28 
 7A  F/57  SI  B  CB  8  
 7B  M/60  BR A-B  NO  75  
 8A  M/72  FA  A  NO  15 
 8B  M/43  SO   NO  40  
13A  F/57  SI A  NO  18  
13B  F/59  SI  A  NO  25  
14A M/88  FA  A  NO  58  
14B  M/48  SO  FLU  
Family Sex/Age Relationship Stage Treatment LY
 1A  F/81  MO  B  CB  1  
 1B  M/57  SO A  NO  30  
 2A  M/43  BR  A  NO  30 
 2B  F/52  SI  C  NO  120  
 3A  F/85  MO A  CB  40  
 3B  F/63  DA  A  NO  
 4A  F/68  MO  A  NO  20  
 4B  M/35  SO A-B  FLU  7  
 5A  M/62  BR  A  NO  45 
 5B  F/56  SI  A  NO  15  
 6A  F/95  MO A  NO  40  
 6B  F/56  DA  B  NO  28 
 7A  F/57  SI  B  CB  8  
 7B  M/60  BR A-B  NO  75  
 8A  M/72  FA  A  NO  15 
 8B  M/43  SO   NO  40  
13A  F/57  SI A  NO  18  
13B  F/59  SI  A  NO  25  
14A M/88  FA  A  NO  58  
14B  M/48  SO  FLU  

Abbreviations: MO, mother; FA, father; SO, son; SI, sister; BR, brother; DA, daughter; CB, chlorambucil; FLU, fludarabin; NO, no treatment; LY, lymphocyte count ×10−9/L; 1A, 1B, two members of family 1.

Analysis of mutations in B29 DNA from B-CLL cells.

DNA from 20 patients corresponding to the 10 families described above had the B29 gene sequenced. For each B-CLL sample analyzed, 2 classes of B29 DNA clones were identified in the PCR-generated clones corresponding to both B29 alleles. Mutations identified on the B29 DNA sequence are described in Tables 2 and3. In all patients (except patient 3B), 1 allele had the silent mutation TGT→TGC at amino acid position 122 (Cys) in the Ig domain (Table 2), corresponding to a polymorphism of the B29 sequence. In the Ig domain, only 1 other silent mutation was observed (patient 1A), whereas 7 replacement mutations producing an amino acid change were noted in 7 patients: patient 1A at position 56 (Lys → Arg), 13A at position 56 (Lys → Glu), 2A at position 61 (Val → Ala), 4B at position 66 (Tyr → His), 5B at position 72 (Gly → Ser), 3B at position 99 (Ser → Phe), and 2B at position 102 (Glu → Gly). These mutations do not affect known important sites of this domain, namely the 5 extracellular cysteine residues allowing for intrachain and interchain (with Igα) S-S bonds or the 4 glycosylation sites on the Asn residues. Concerning the transmembrane portion, 1 silent mutation was observed in patient 4A at amino acid position 145, whereas 4 replacement mutations at positions 145 (Phe → Ser), 167 (Leu → Pro), 169 (Ile → Leu), and 169 (Ile → Thr) were noted in patients 4B, 14A, 5B, and 7B, respectively. Mutations in the intracytoplasmic domain were detected in only 4 patients (Table 3): 2 silent mutations at amino acid position 192 in patient 6A and 193 in patient 14B and 2 replacement mutations at amino acid position 202 (Asp → Asn) and 223 (Gly →Ser) in patients 2A and 5A, respectively. The Tyr residues, substrates for phosphorylation, were not affected by the mutations. All of the replacement mutations of the B29 gene are described in Fig 1.

Table 2.

Mutations in B29 Ig and Transmembrane Domains

Patient Allele Nucleotide Change Amino Acid ChangeB29 Domain Affected
 1A  1  2254 AAA → AGA 56 Lys → Arg  Ig  
  2377 GAA → GAG 
  2453 TGT → TGC  
 2  None  
 1B 1  None  
 2  2453 TGT → TGC  
 2A  2453 TGT → TGC  
 2  2269 GTG → GCG 61 Val → Ala  Ig  
  2453 TGT → TGC  
 2B 1  2453 TGT → TGC  
 2  2392 GAA → GGA 102 Glu → Gly  Ig  
 3A  1  None  
 2453 TGT → TGC  
 3B  1  2383 TCC → TTC 99 Ser → Phe  Ig  
 2  None  
 4A  None  
 2  2453 TGT → TGC 
  2711 TTC → TTT  
 4B  1  2453 TGT → TGC 
 2  2283 TAC → CAC  66 Tyr → His  Ig 
  2710 TTC → TCC  145 Phe → Ser  TM  
 5A 1  None  
 2  2453 TGT → TGC  
 5B  2453 TGT → TGC  
  2780 ATC → CTC 169 Ile → Leu  TM  
 2  2301 GGC → AGC 72 Gly → Ser  Ig  
 6A  1  None  
 2453 TGT → TGC  
 6B  1  None  
 2453 TGT → TGC  
 7A  1  2453 TGT → TGC 
 2  
 7B  1  2453 TGT → TGC 
  2781 ATC → ACC  169 Ile → Thr  TM  
 2453 TGT → TGC  
 8A  1  2453 TGT → TGC 
 2  
 8B  1  None  
 2453 TGT → TGC  
13A  1  2453 TGT → TGC  
 2453 TGT → TGC  
  2253 AAA → GAA 56 Lys → Glu  Ig  
13B  1  None 
  2453 TGT → TGC  
14A  1  2453 TGT → TGC 
 2  2453 TGT → TGC  
  2775 CTG → CCG 167 Leu → Pro  TM  
14B  1  None  
 2453 TGT → TGC 
Patient Allele Nucleotide Change Amino Acid ChangeB29 Domain Affected
 1A  1  2254 AAA → AGA 56 Lys → Arg  Ig  
  2377 GAA → GAG 
  2453 TGT → TGC  
 2  None  
 1B 1  None  
 2  2453 TGT → TGC  
 2A  2453 TGT → TGC  
 2  2269 GTG → GCG 61 Val → Ala  Ig  
  2453 TGT → TGC  
 2B 1  2453 TGT → TGC  
 2  2392 GAA → GGA 102 Glu → Gly  Ig  
 3A  1  None  
 2453 TGT → TGC  
 3B  1  2383 TCC → TTC 99 Ser → Phe  Ig  
 2  None  
 4A  None  
 2  2453 TGT → TGC 
  2711 TTC → TTT  
 4B  1  2453 TGT → TGC 
 2  2283 TAC → CAC  66 Tyr → His  Ig 
  2710 TTC → TCC  145 Phe → Ser  TM  
 5A 1  None  
 2  2453 TGT → TGC  
 5B  2453 TGT → TGC  
  2780 ATC → CTC 169 Ile → Leu  TM  
 2  2301 GGC → AGC 72 Gly → Ser  Ig  
 6A  1  None  
 2453 TGT → TGC  
 6B  1  None  
 2453 TGT → TGC  
 7A  1  2453 TGT → TGC 
 2  
 7B  1  2453 TGT → TGC 
  2781 ATC → ACC  169 Ile → Thr  TM  
 2453 TGT → TGC  
 8A  1  2453 TGT → TGC 
 2  
 8B  1  None  
 2453 TGT → TGC  
13A  1  2453 TGT → TGC  
 2453 TGT → TGC  
  2253 AAA → GAA 56 Lys → Glu  Ig  
13B  1  None 
  2453 TGT → TGC  
14A  1  2453 TGT → TGC 
 2  2453 TGT → TGC  
  2775 CTG → CCG 167 Leu → Pro  TM  
14B  1  None  
 2453 TGT → TGC 

Two kinds of B29 DNA clones were detected in B-CLL cell samples, corresponding to 2 alleles (1 and 2). Numbering of the nucleotides begins with the first base of the complete DNA sequence described in Hashimoto et al.23 

Abbreviations: Ig, Ig domain; TM, transmembrane domain.

Table 3.

Mutations in B29 Intracytoplasmic Domain

Patient Allele Nucleotide Change Amino Acid Change
 2A  1  None  
 2  3285 GAC → AAC 202 Asp → Asn  
 5A  1  None  
 3348 GGT → AGT  223 Gly → Ser  
 6A  None  
 2  3148 GAA → GAG  
14B  None  
 2  3151 GAT → GAC 
Patient Allele Nucleotide Change Amino Acid Change
 2A  1  None  
 2  3285 GAC → AAC 202 Asp → Asn  
 5A  1  None  
 3348 GGT → AGT  223 Gly → Ser  
 6A  None  
 2  3148 GAA → GAG  
14B  None  
 2  3151 GAT → GAC 

Only 4 patients of 20 had silent or replacement mutations. Numbering of the nucleotides begins with the first base of the complete DNA sequence described in Hashimoto et al.23 

Fig. 1.

Replacement mutations in B29 genes. Among 20 patients affected with CLL, 10 express replacement mutations in 1 allele of their B29 gene; 1 patient, 5B, expresses replacement mutation on both alleles (1) and (2). Ig domain, Ig-like domain; TM, transmembrane segment; intracytoplasmic, intracytoplasmic domain. Underlined amino acids correspond to the replacement mutations.

Fig. 1.

Replacement mutations in B29 genes. Among 20 patients affected with CLL, 10 express replacement mutations in 1 allele of their B29 gene; 1 patient, 5B, expresses replacement mutation on both alleles (1) and (2). Ig domain, Ig-like domain; TM, transmembrane segment; intracytoplasmic, intracytoplasmic domain. Underlined amino acids correspond to the replacement mutations.

The only identical mutation observed between 2 members of the same family was the silent TGT → TGC (amino acid position 122) in the Ig domain. We never observed another identical silent or replacement mutation between both members from the 10 different families.

As we used whole blood for DNA extraction because blood samples were stored as pellets at −20°C and fresh cells were not available, the possibility exists that the amplified B29 gene could be derived from nontumoral cells such as T cells, neutrophils, and monocytes. However, the majority of patients included in this study displayed high numbers of monoclonal B cells. In these conditions, most patients had a remarkable excess of neoplastic DNA used for the PCR amplification and sequencing; thus, any important deletion or insertion affecting the B29 gene should not escape detection.

VH gene usage.

The composition of the H chain variable domain sequences obtained from the 20 patients with familial clustering of CLL is summarized in Table 4. The VH distribution (VH1, 10%; VH2, 0%; VH3, 4%; VH4, 30%; VH5, 10%; and VH6, 5%) is close to that corresponding to the normal complexity of the system (VH1, 22%; VH2, 6%; VH3, 43%; VH4, 22%; VH5, 6%; and VH6, 2%), except for VH2, which is not represented in our familial cases. Among the 18 patients whose VH genes have been sequenced, 14 cases expressed less than 98% similarity with the germinal counterpart, and 11 of 18 had less than 95% similarity. Among these 11 cases, 8 presented a CDR/FR rate of mutation greater than 0.3, which could suggest, at least for some cases, the existence of an antigen-driven selection process.21a 

Table 4.

Characteristics of the Twenty Sequenced Genes

Patients VH Family Germinal CounterpartHomology % FR Mutation RS CDR MutationRS CDR/FR D JH
CLL-1A  VH5  V5-a 98.3  3  0.5  2  0  1.5  2-15  JH5b  
CLL-1B VH3  V3-15  100  0  0  0  0  0  3-09 JH4b  
CLL-2A  VH6  V6-01  95.4  11  0.8  2  0.27  2-15  JH4d  
CLL-2B  VH3  V3-73  90.3 16  2.2  13  3.3  0.81  2-02  JH6b  
CLL-3A VH3  V3-21  93.3  11  1.2  9  2  0.82  2-21 JH4b  
CLL-3B  VH3  V3-23  93.3  14  2.5  2  0.43  3-22  JH4b  
CLL-4A  VH5  V5-51  92.2 17  2.4  6  5  0.35  ND  JH5b  
CLL-4B VH4  V4-34  96.9  5  4  4  >4  0.8  5-05 JH6b  
CLL-5A  VH1  V1-02  90.1  21  1.33  3  0.38  2-21  JH4b  
CLL-5B  VH4  V4-34  94.8 13  2.25  2  >2  0.15  2-21  JH4b  
CLL-6A VH3  V3-23  90.8  22  0.83  5  4  0.22 6-19  JH4b  
CLL-6B  VH1  V1-18  93.2  16  4  1  0.25  ND  JH4b  
CLL-7A  VH3 V3-13  99.0  2  1  1  >1  0.5  2-15  JH4b 
CLL-7B  VH4  V4-34  92.4  16  0.78  6  0.37  3-22  JH4b  
CLL-8A  VH3  V3-23  93.2  12 0.71  8  >8  0.67  3-03  JH4b  
CLL-8B  VH3 V3-30.3  98.3  5  0.67  0  0  0  2-02  JH4b 
CLL-13A  VH4  V4-39  95.6  10  4  3  >3 0.3  6-19  JH4a  
CLL-13B  VH3  ND       ND  JH5a  
CLL-14A  VH4 ND        2-02  JH4a  
CLL-14B VH4  V4-59  94.8  10  1  5  0.6  0.5  3-22 JH1 
Patients VH Family Germinal CounterpartHomology % FR Mutation RS CDR MutationRS CDR/FR D JH
CLL-1A  VH5  V5-a 98.3  3  0.5  2  0  1.5  2-15  JH5b  
CLL-1B VH3  V3-15  100  0  0  0  0  0  3-09 JH4b  
CLL-2A  VH6  V6-01  95.4  11  0.8  2  0.27  2-15  JH4d  
CLL-2B  VH3  V3-73  90.3 16  2.2  13  3.3  0.81  2-02  JH6b  
CLL-3A VH3  V3-21  93.3  11  1.2  9  2  0.82  2-21 JH4b  
CLL-3B  VH3  V3-23  93.3  14  2.5  2  0.43  3-22  JH4b  
CLL-4A  VH5  V5-51  92.2 17  2.4  6  5  0.35  ND  JH5b  
CLL-4B VH4  V4-34  96.9  5  4  4  >4  0.8  5-05 JH6b  
CLL-5A  VH1  V1-02  90.1  21  1.33  3  0.38  2-21  JH4b  
CLL-5B  VH4  V4-34  94.8 13  2.25  2  >2  0.15  2-21  JH4b  
CLL-6A VH3  V3-23  90.8  22  0.83  5  4  0.22 6-19  JH4b  
CLL-6B  VH1  V1-18  93.2  16  4  1  0.25  ND  JH4b  
CLL-7A  VH3 V3-13  99.0  2  1  1  >1  0.5  2-15  JH4b 
CLL-7B  VH4  V4-34  92.4  16  0.78  6  0.37  3-22  JH4b  
CLL-8A  VH3  V3-23  93.2  12 0.71  8  >8  0.67  3-03  JH4b  
CLL-8B  VH3 V3-30.3  98.3  5  0.67  0  0  0  2-02  JH4b 
CLL-13A  VH4  V4-39  95.6  10  4  3  >3 0.3  6-19  JH4a  
CLL-13B  VH3  ND       ND  JH5a  
CLL-14A  VH4 ND        2-02  JH4a  
CLL-14B VH4  V4-59  94.8  10  1  5  0.6  0.5  3-22 JH1 

Abbreviations: GC, germline counterpart; FR, framework; RS, replacement/silent mutation ratio; CDR, complementary determining region; CDR/FR, CDR/FR mutation ratio; when all mutations induced replacements, results are expressed as > number of replacements observed; ND, not determined.

DISCUSSION

The B-CLL lymphocyte differs from the normal CD5+ B cell by constant expression of low amounts of surface Ig and CD79b4,5; resistance to infection by the EBV virus, despite expressing the CD21 molecule10; inability to adequately respond when stimulated through the BCR pathway8,9; and overexpression of the bcl-2 protein.12 It remains unknown whether some of the particular characteristics of the B-CLL lymphocyte could be malignancy-related.

Because genetic or familial factors have been suggested in the etiology of CLL19,20 and genetic aberrations were reported to exist at the level of the B29 gene,7 we were interested in studying the B29 gene in several families who had 2 affected members each. The excess risk of CLL for individuals with affected first degree relatives suggests that familial CLL might constitute a useful model to study the pathogenesis of this disease, as has been the case in other neoplastic disorders. However, previous studies in familial CLL cases failed to show the presence of consistent chromosomal or proto-oncogene abnormalities.24,25 We could not perform such karyotypic studies on our patients, because the material we studied here consisted of blood samples frozen at −20°C. Furthermore, the number of cases reporting common HLA phenotypes among affected CLL siblings is small.19,26,27 The study of family histories or family trees from our series shows evidence favoring a vertical transmission, which may be consistent with the expression of an autosomal dominant gene. Anticipation as defined by worsening severity or earlier age at onset with each generation for an inherited disease has been reported to occur in familial cases of CLL. In a recent series of 9 parent-child pairs with CLL,28 8 showed younger ages at onset in the child and showed a mean decline in age at onset of 21 years, with very similar results found in a British study.29 This suggests that dynamic mutation of unstable DNA sequence repeats could be a common mechanism of inherited hematopoietic malignancy, with implications for the role of somatic mutation in the more frequent sporadic cases. In the 6 families from our series in which a vertical transmission was observed, the mean age of the parental generation was 81 years as compared with a mean age of 50 years for the second generation, which is lower than the mean age of 64 years found in French series.30 Because sampling bias is unlikely to explain these findings, these results could point to the existence among familial CLL patients of another genetic mechanism for developing disease.

In B cells, the CD79b protein is supposed to be essential in the transport of sIg to the membrane,16,17 initiation of signal transduction through the BCR,15 and apoptosis.18 Thus, a defect in expression of this protein may play a major role in the pathophysiology of the disease. Recent work indicating the presence of genetic aberrations leading to affected expression and/or function in B-CLL patients suggests that these alterations could have a genetic origin.7 To better define whether these aberrations could play a primary role in CLL leukemogenesis, we have sequenced the B29 gene at the genomic level in 10 different families including 2 affected members each.

Our results demonstrated that some mutations were present either in the Ig, transmembrane, or cytoplasmic domains of the CD79b protein, but we never observed any insertion or deletion in the B29 gene leading to a truncated protein. Indeed, we have not screened normal genomic DNA for mutations in B29 gene, but the few published sequences derived from normal subjects showed the presence of some polymorphism such as the TGT or TGC in AA position 12231 that we frequently found in our series. Thus, because the few mutations described in the present work have not been reported before in normal B29 gene sequence, it is difficult to conclude whether they correspond to new polymorphisms or whether they are CLL related. However, they are not genetically determined, because they never occured at the same position among 2 members of the same family.

Our results are in accordance with those reported by Rassenti et al,32 who studied unrelated patients affected with CLL and also failed to observe deletion or insertion in Ig, transmembrane, or cytoplasmic domains, but only base substitutions. Thus, our familial CLL did not differ from these common CLL cases. However, both our series and that from Rassenti et al32 differ with the results reported by Thompson et al,7 who demonstrated by sequencing cDNA clones generated from B-CLL cell B29 mRNA, that point mutations, insertions, or deletions, largely located in the B29 transmembrane and cytoplasmic domains, affected B29 expression and/or function. This discrepancy with our data could result from a different origin of the 10 families studied here, but the present findings exclude, at least in our ethnic group, the presence of causal mutations. Both alleles were sequenced and genetic alterations were not detected in paternal and maternal alleles. The few mutations observed here did not induce structural abnormalities of the protein, which could explain its low expression in CLL; furthermore, these mutations are not coding for amino acids involved in the intrachain or interchain bonds between the CD79b and CD79a proteins, namely the Cys of the Ig domain, glycosylation sites, or intracytoplasmic sites for phosphorylation. Thus, the function of the CD79b protein would not be predicted to be affected by these mutations.

Analysis of the VH gene usage among these 10 families affected with CLL showed a higher level of mutation than that described in previous studies concerning unrelated patients,33,34 and the vast majority of the CLL variable domains contained a high degree of somatic mutation and exhibited an excess of replacement mutations in the CDR intervals. These findings suggest that familial CLL cases may preferentially derive from B-cell progenitors that have responded to antigen.21a 

Because our results appear to exclude the possibility that a genetic defect could account for the low expression of the CD79b molecule in B-CLL, it would be interesting to study the possibility that the low expression of the CD79b protein on the B-CLL could result from a mechanism of alternative splicing. This event could result in overexpression of a truncated CD79 transcript form, which lacks exon 3, encoding for the extracellular domain of this molecule, and low if any expression of the complete CD79b transcript. Previous work has shown that both transcripts exist in B cells in normal conditions,35 although activated B cells inverse relative expression of the truncated form.36 Thus, the possibility exists that low expression of CD79b in CLL could result from preferential transcription of the truncated CD79b form. Although this possibility needs to be tested, results from Thompson el al7 indicate that transcripts coding for the complete protein are found in consistent amounts in at least half of the CLL patients they have studied. Most of these patients were expressing low to undetectable amounts of the CD79b membrane protein, indicating that CD79b expression may not be exclusively explained by the absence of complete transcripts.

In these conditions, the possibility that a defect at the posttranscriptional level accounting for the discrepancy between the presence of adequate transcripts and very low expression of CD79b and sIg needs to be considered. This defect could occur at the level of intracellular synthesis, could consist of accelerated proteolysis of CD79b and sIg proteins, or in inadequate transport of the BCR to the cell membrane as described on tolerant B lymphocytes.37 

Supported by Grant No. 98003512 from the Fondation contre la Leucémie and Grant No. 9734 from the Association pour la Recherche sur le Cancer.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

REFERENCES

REFERENCES
1
Dameshek
W
Chronic lymphocytic leukemia an accumulative disease of immunologically incompetent lymphocytes.
Blood
29
1967
566
2
Dighiero
G
Travade
P
Chevret
S
Fenaux
P
Chastang
C
Binet
JL
B-cell chronic lymphocytic leukemia. Present status and future directions.
Blood
78
1991
1901
3
Boumsell
L
Bernard
A
Lepage
V
Some chronic lymphocytic leukemia cells bearing surface immunoglobulins share determinants with T cells.
Eur J Immunol
8
1978
900
4
Dighiero
G
Bodega
E
Mayzner
R
Binet
JL
Individual cell-by-cell quantitation of lymphocyte surface membrane Ig in normal and CLL lymphocytes and during ontogeny of mouse B lymphocytes by immunoperoxydase assay.
Blood
55
1980
93
5
Ternynck
T
Dighiero
G
Follezou
JY
Binet
JL
Comparison of normal and CLL lymphocyte surface Ig determinants using peroxidase-labeled antibodies. I. Detection and quantitation of light chain determinants.
Blood
43
1974
789
6
Zomas
AP
Matutes
E
Morilla
R
Owusu-Ankomah
K
Seon
BK
Catovsky
D
Expression of the immunoglobulin-associated protein B29 in B cell disorders with the monoclonal antibody SN8 (CD79b).
Leukemia
10
1996
1966
7
Thompson
AA
Talley
JA
Do
HN
Kagan
HL
Kunbel
L
Berenson
J
Cooper
MD
Saxon
A
Wall
R
Aberrations of the B-cell receptor B29 (CD79b) gene in chronic lymphocytic leukemia.
Blood
90
1997
1387
8
Karray
S
Merle-Beral
H
Vazquez
A
Gérard
JP
Debré
P
Galanaud
P
Functional heterogeneity of B-CLL lymphocytes: Dissociated responsiveness to growth factors and distinct requirements for a first activation signal.
Blood
70
1987
1105
9
Michel
F
Merle-Beral
H
Legac
E
Michel
A
Debré
P
Bismuth
G
Defective calcium response in B-chronic lymphocytic leukemia cells. Alteration of early protein tyrosine phosphorylation and of the mechanism responsible for cell calcium influx.
J Immunol
150
1993
3627
10
Borche
L
Lim
A
Binet
JL
Dighiero
G
Evidence that chronic lymphocytic leukemia B lymphocytes are frequently committed to production of natural autoantibodies.
Blood
76
1990
562
11
Bröker
BM
Klajman
A
Youinou
P
Jouquan
J
Worman
CP
Murphy
J
Mackenzie
L
Quartey-Papafio
R
Blaschek
M
Collins
P
Lal
S
Lydyard
PM
Chronic lymphocytic leukemic (CLL) cells secrete multispecific autoantibodies.
J Autoimmun
1
1988
469
12
Schena
M
Larsson
LG
Gottardi
D
Gaidano
G
Carlsson
M
Nilsson
K
Caligaris-Cappio
F
Growth- and differentiation-associated expression of bcl-2 in B-chronic lymphocytic leukemia cells.
Blood
79
1992
2981
13
Reth
M
Antigen receptors on B lymphocytes.
Annu Rev Immunol
10
1992
97
14
van Noesel
CI
van Lier
RA
Architecture of the human B-cell antigen receptors.
Blood
82
1993
363
15
Sanchez
M
Misulovin
Z
Burkhardt
AL
Mahajan
S
Costa
T
Franke
R
Bolen
JB
Nussenzweig
M
Signal transduction by immunoglobulin is mediated through Ig alpha and Ig beta.
J Exp Med
178
1993
1049
16
Venkitaraman
AR
Williams
GT
Dariavach
P
Neuberger
MS
The B-cell antigen receptor of the five immunoglobulin classes.
Nature
352
1991
777
17
Sitia
R
Neuberger
MS
Milstein
C
Regulation of membrane IgMexpression in secretory B cells: Translational and post-translational events.
EMBO J
6
1987
3969
18
Tseng
J
Eisfelder
BJ
Clark
MR
B-cell antigen receptor-induced apoptosis requires both Igα and Igβ.
Blood
89
1997
1513
19
Conley
CL
Misiti
J
Laster
AJ
Genetic factors predisposing to chronic lymphocytic leukemia and to autoimmune disease.
Medicine
59
1980
323
20
Linet
MS
Van Natta
ML
Brookmeyer
R
Khoury
MJ
McCaffrey
LD
Humphrey
RL
Szklo
M
Famillial cancer history and chronic lyphocytic leukemia. A case-control study.
Am J Epidemiol
130
1989
655
21
Finch
SC
Linet
MS
Chronic leukemias.
Baillieres Clin Hematol
5
1992
27
21a
Pritsch O, Troussard X, Magnac C, Mauro F, Davi F, Payelle-Brogard B, Macro M, Dumas G, Pulik M, Clerget F, Mandelli F, Chiorazzi N, Schroeder HW Jr, Leporrier M, Dighiero G: VH gene usage by family members affected with chronic lymphocytic leukemia. Br J Haematol (in press)
22
Binet
JL
Auquier
A
Dighiero
G
Chastang
C
Piguet
H
Goasguen
J
Vaugier
G
Potron
G
Colona
P
Oberling
F
Thomas
M
Tchernia
G
Jacquillat
C
Boivin
P
Lesty
C
Duault
MT
Monconduit
M
Belabbes
S
Gremy
F
A new prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis.
Cancer
48
1981
198
23
Hashimoto
S
Chiorazzi
N
Gregersen
PK
The complete sequence of the human CD79b (Igβ/B29) gene: Identification of a conserved exon/intron organization, immunoglobulin-like regulatory regions, and allelic polymorphism.
Immunogenetics
40
1994
145
24
Dighiero
G
Travade
P
Chevret
S
Fenaux
P
Chastang
C
Binet
JL
B-cell chronic lymphocytic leukemia. Present status and future directions. French Cooperative Group on CLL.
Blood
78
1991
1901
25
Linet
MS
Blattner
WA
The epidemiology of chronic lymphocytic leukemia
Chronic Lymphocytic Leukemia.
Polliack
A
Catovsky
D
1988
11
Harwood Academic
Chur, Switzerland
26
Schweitzer
M
Melief
CJM
Ploem
JE
Chronic lymphocytic leukaemia in 5 siblings.
Scand J Haematol
11
1973
97
27
Linet
MS
Bias
WB
Dorgan
JF
McCaffrey
LD
Humphrey
RL
HLA antigens in chronic lymphocytic leukemia.
Tissue Antigens
31
1988
71
28
Horwitz
M
Goode
EL
Jarvik
GP
Anticipation in familial leukemia.
Am J Hum Genet
59
1996
990
29
Catovsky
D
The search for genetic clues in chronic lymphocytic leukemia.
Hematol Cell Ther
39
1997
S5
30
Dighiero
G
Maloum
K
Desablens
B
Cazin
B
Navarro
M
Leblay
R
Leporrier
M
Jaubert
J
Lepeu
G
Dreufus
B
Binet
JL
Travade
P
Chlorambucil in indolent chronic lymphocytic leukemia.
N Engl J Med
338
1998
1506
31
Hashimoto
S
Gregersen
PK
Chiorazzi
N
The human Ig-β cDNA sequence, a homologue of murine B29, is identical in B cell and plasma cell lines producing all the human Ig isotypes.
J Immunol
150
1993
491
32
Rassenti
LZ
Padmanabha
S
Kipps
TJ
Expression of the B-cell receptor Ig beta (CD79b) in chronic lymphocytic leukemia.
Blood
90
1997
454a
(abstr, suppl 1)
33
Schroeder
HW
Dighiero
G
The pathogenesis of chronic lymphocytic leukemia: Analysis of the antibody repertoire.
Immunol Today
15
1994
288
34
Fais
F
Ghiotto
F
Hashimoto
S
Sellars
B
Allen
SL
Schulman
P
Vinciguerra
VP
Rai
K
Rassenti
L
Kipps
TJ
Dighiero
G
Schroeder
HW
Ferrarini
M
Chiorazzi
N
Chronic lymphocytic leukemia B cells express restricted sets of mutated and unmutated antigen receptors.
J Clin Invest
102
1998
1515
35
Hashimoto
S
Chiorazzi
N
Gregersen
PK
Alternative splicing of CD79a (Ig-alpha/mb-1) and CD79b (Ig-beta/B29) RNA transcripts in human B cells.
Mol Immunol
32
1995
651
36
Koyama
M
Nakamura
T
Higashihara
M
Herren
B
Kuwata
S
Shibata
Y
Okumura
K
Kurokawa
K
The novel variants of mb-1 and B29 transcripts generated by alternative mRNA splicing.
Immunol Lett
47
1995
151
37
Bell
SE
Goodnow
CC
A selective defect in IgM antigen receptor synthesis and transport causes loss of cell surface IgM expression on tolerant B lymphocytes.
EMBO J
13
1994
816

Author notes

Address reprint requests to Béatrice Payelle-Brogard, PhD, Unité d’Immunohématologie et d’Immunopathologie, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France.