The bleeding diathesis associated with congenital deficiency of factor XI (FXI) is variable and correlates poorly with standard coagulation assays. Platelets are reported to contain FXI activity that may substitute for the plasma protein. The presence of this platelet activity in some patients deficient in plasma FXI could partly explain the variable bleeding associated with the deficiency state. Polyclonal antibodies to plasma FXI recognize a 220 kD platelet membrane protein distinct in structure from plasma FXI. The messenger RNA (mRNA) coding for this protein has been postulated to be an alternatively spliced FXI message lacking the fifth exon found in the liver (wild type) message. We analyzed RNA from platelets, leukocytes, and bone marrow for FXI mRNA by reverse transcription polymerase chain reaction (RT-PCR) technology. Single FXI mRNA species were identified by RT-PCR in platelet and bone marrow RNA, but not leukocyte RNA, that are the same size as the message from liver RNA. Sequencing of PCR products confirmed that the FXI mRNA species in platelets is identical to the one in liver. Wild-type FXI mRNA was also identified in three leukemia cell lines with megakaryocyte features (MEG-01, HEL 92.1.7, and CHRF-288-11). The data show that platelets contain wild-type FXI mRNA. FXI protein, therefore, may be present in platelets and may be released during platelet activation. The data do not support the premise that the 220 kD platelet protein that cross-reacts with FXI antibodies is a product of an alternatively spliced mRNA from the FXI gene.

FACTOR XI (FXI) IS THE zymogen of a plasma serine protease produced primarily in the liver that contributes to blood coagulation through activation of factor IX by limited proteolysis.1-4 This activity is most important during major hemostatic challenges such as trauma or surgery.5,6Unlike bleeding associated with classic hemophilia (deficiency of factor VIII or factor IX), hemorrhage in FXI deficiency is highly variable and correlates poorly with standard assays of blood coagulation such as the activated partial thromboplastin time (aPTT).7,8 Indeed, there are individuals with extremely low plasma levels of FXI (< 1% of normal) who do not experience bleeding despite trauma or surgery.9,10 It has been suggested that coinheritance of other coagulation abnormalities such as von Willebrand disease exacerbates hemorrhage in FXI deficiency,11although this premise has been challenged.12 Conceivably, multiple factors contribute to the wide range of bleeding symptoms observed in these patients.

It has been postulated that a mild phenotype in some patients with severe FXI deficiency may be due to the presence of FXI-like activity associated with platelets, which may bypass the requirement for plasma FXI in certain situations.13 Platelets may contain small amounts of FXI activity (<1% of plasma activity)14 and three groups have reported on the partial purification of a 220 kD polypeptide from platelet extracts that is recognized by anti-FXI polyclonal antibodies.14-16 This protein appears to have a substantially different structure than plasma FXI (a 160 kD dimeric molecule consisting of two identical 80 kD polypeptides).17,18 Based on polymerase chain reaction (PCR) studies of platelet RNA, it has been proposed that the 220 kD platelet protein is a tetramer of a 50 to 55 kD polypeptide that is the product of an alternatively spliced FXI messenger RNA (mRNA) lacking the fifth exon normally found in the full-length message from liver.19,20 Consistent with this is a recent report of a truncated FXI complementary DNA (cDNA) lacking the fifth exon, isolated from a library for the human megakaryoblastic leukemia cell line CHRF-288-11.20 To determine if FXI mRNA or related novel messages are present in blood tissues, we used reverse transcription PCR (RT-PCR) technology to analyze RNA from human platelets, leukocytes, and bone marrow, as well as human leukemia cell lines with megakaryocytic features, for the presence of FXI mRNA. The results show that normal platelets and bone marrow, as well as established megakaryoctye cell lines, contain FXI mRNA that is identical to the mRNA found in liver, but failed to identify novel splice products of the FXI gene.

MATERIALS AND METHODS

Materials and Reagents

Molecular biology.

The human liver FXI cDNA was a gift from Dr Dominic Chung (University of Washington, Seattle, WA). TaKaRa long range DNA polymerase for PCR was from Pan Vera Corp (Madison, WI). A Thermo-sequenase radiolabeled terminator sequencing system for DNA sequencing was from Amersham Life Sciences (Arlington Heights, IL). Guanidinium isothiocyanate extraction buffer was from Promega Corporation (Madison, WI). A Ready-To-Go T-Primed First-strand Kit for RT of RNA was from Pharmacia Biotech (Piscataway, NJ). Omniscript RT for PCR with or without RT (Qiagen, Valencia, CA). Oligonucleotide primers were prepared by the DNA core facility of the Vanderbilt University Cancer Center. SeaKem LE agarose and NuSieve agarose were from FMC Bioproducts (Rockland, ME).

Cell lines and tissue culture.

The MEG-01 human megakaryoblastic cell line (ATCC CRL-2021)21 and the human erythroleukemia cells line HEL 92.1.7 (ATCC TIB 175)22 were from the American Tissue Type Collection (Rockville, MD). The CHRF-288-11 human megakaryoblastic cell line23 was a gift from Dr Michael Lieberman (University of Cincinnati, Cincinnati, OH). The 293 human fetal kidney fibroblast cell line transfected with a full-length FXI cDNA derived from liver was described previously.24,25 RPMI 1640 medium was from Mediatech (Herndon, VA), and Dulbecco’s modified Eagle medium (DMEM) and Fischer’s media were from Life Technologies (Grand Island, NY).

Purification of platelets and leukocytes.

The procedure for obtaining human blood specimens was approved by the Institutional Review Board of Vanderbilt University. Platelets were isolated either from peripheral blood or expired platelet-pheresis products from the Vanderbilt Hospital blood bank by differential centrifugation. Briefly, blood (120 mL) was obtained from the antecubital vein of healthy normal individuals into a 1/10th volume of 3.8% sodium citrate anticoagulant. Anticoagulated blood or the platelet-pheresis product was placed in 50 mL polypropylene centrifuge tubes and erythrocytes and leukocytes were pelleted by centrifugation at 300g for 10 minutes in a Sorval RC5 Superspeed centrifuge fitted with an SS-34 rotor (Sorval, Inc, Wilmington, DE). The top half of the platelet rich supernatant was gently aspirated and placed into fresh centrifuge tubes using polypropylene pipettes, and centrifugation was repeated as above. The top half of the platelet-rich plasma was aspirated from the tube and used as the source of platelets for RNA purification. The platelet count was determined using a Technicon H-3 hematology analyzer (Bayer-Miles, Tarrytown, NY). A typical platelet preparation from fresh blood contains 5 to 10 × 109 platelets and from a pheresis product 1 to 5 × 1011 platelets. Samples of purified platelets were stained with Wright’s stain and examined under a microscope. Rare leukocytes or erythrocytes (<1 per 10,000 platelets) were detected in some platelet preparations, whereas others had no detectable cells. Platelets were pelleted at 3,500g for 20 minutes, dissolved in guanidinium thiocyanate extraction buffer (5 to 10 × 109 platelets/mL of guanidinium thiocyanate), and stored at 4°C pending RNA isolation.

Leukocytes were purified as follows: Twenty mL of peripheral blood collected into a 1/10th volume of 3.8% sodium citrate was diluted 1:1 with RPMI 1640 medium. Eight mL of the diluted blood was layered onto 4 mL of Ficoll Hypaque (Lymphoprep Ficoll Hypaque, Nycomed Pharma AS, Oslo) in a 15 mL tube followed by centrifugation at 800g for 30 minutes in a DPR-6000 centrifuge (Damon/International Equipment Co Division, Needham Heights, MA). The pellet (erythrocytes and granulocytes) and the intermediate layer halfway down the Ficoll Hypaque (monocytes and lymphocytes) were carefully collected and subjected to a second purification on Ficoll Hypaque as above. The erythrocyte/granulocyte fraction (1 mL in volume) was brought up to 15 mL with 150 mmol/L NH4Cl, 10 mmol/L KHCO3 to lyse red cells, then centrifuged at 1,000g for 5 minutes in a Beckman TJ-6 bench-top centrifuge to pellet the granulocytes. The monocyte/lymphocyte fraction underwent centrifugation in a similar manner. Microscopic evaluation of the granulocyte and mononuclear cell preparations showed contamination with some platelets (<1 per 10 leukocytes) with the contamination being somewhat greater for the mononuclear cell preparations than the granulocytes. The majority of platelets do not sediment through Ficoll Hypaque and remain in the upper layer. Leukocytes were dissolved in guanidinium thiocyanate extraction buffer (1 × 106 cells/0.2 mL extraction buffer). Normal human bone marrow, 5 mL, was obtained from a donor harvest for bone marrow transplantation. The cells were pelleted by centrifugation at 3,000g for 10 minutes and the pellet was dissolved in 2 mL of guanidinium thiocyanate extraction buffer. All cell lysates were stored at 4°C pending RNA purification.

Cultures of MEG-01, HEL 92.1.7, and CHRF-288-11 megakaryocytic leukemia cells and 293 cells transfected with a human liver FXI cDNA.

Cell lines were maintained in a 37°C fully humidified incubator with a 5% CO2 atmosphere. MEG-01 was grown in RPMI 1640 containing 10% heat-inactivated fetal calf serum (FCS), 2 mmol/L L-glutamine, 1 mmol/L sodium pyruvate, 1.5 gm/L sodium bicarbonate, 10 mmol/L HEPES, and penicillin/streptomycin/amphotericin B. HEL 92.1.7 cells were grown in RPMI 1640 containing 10% heat-inactivated FCS, 2 mmol/L L-glutamine, and penicillin/streptomycin. CHRF-288-11 was grown in Fischer’s medium supplemented with 10% heat-inactivated FCS and penicillin/streptomycin. Cells were grown to a concentration of approximately 1 × 107/20 mL media, then washed four times with phosphate-buffered saline, pelleted by centrifugation at 1,000g for 10 minutes, and dissolved in 2 mL of guanidinium thiocyanate extraction buffer. Cells that were adherent to the culture flasks were released by incubation with trypsin/EDTA and then treated as above. Extracts were stored at 4°C pending RNA purification. 293 cells transfected with a wild-type FXI liver cDNA24,25 were grown in DMEM 5% FCS, 2 mmol/L L-glutamine, 1 mmol/L sodium pyruvate, and penicillin/streptomycin/amphotericin B. These cells, which served as a positive control for the RT/PCR process, were processed into guanidinium thiocyanate extraction buffer as above.

Isolation of RNA and RT.

Total RNA from platelets and cell lines was isolated using standard guanidinum thiocyantate/phenol:chloroform extraction and precipitated with 70% ethanol.26 Leukocyte, bone marrow, and cell line poly-A RNA were isolated from the guanidinium isothyocyante extractions using a PolyA Tract System 1000 (Promega) according to the manufacturer’s instructions. PolyA RNA was eluted from the system using nuclease-free water. A Ready-To-Go T-Primed first-strand RT kit (Pharmacia) was used for RT reactions. Briefly, 5 μg of total RNA (platelets) or 100 to 1,000 ng of poly A RNA (leukocytes, bone marrow, or cell lines) was mixed with oligo-dT and random hexanucleotides as recommended by the manufacturer. Samples were heated at 65°C for 5 minutes, placed on ice for 2 minutes, and then added to tubes containing the Ready-To-Go beads. After 1 minute of incubation at room temperature, samples were mixed, transferred to a 37°C water bath, and incubated for 2 hours. To show that signals obtained from PCR reactions were RT dependent and, therefore, not due to contamination of RNA preparations with genomic or cDNA, RNA underwent RT in the presence or absence of RT as follows: 2 μg of RNA was added to reaction mixtures containing 1× buffer, 0.5 mmol/L of each deoxyribonucleoside (dNTPs), 0.5 μmol/L of random hexanucleotides, and 10 units of RNase inhibitor, and incubated at 37°C for 2 hours either in the presence or absence of 4 units of Omniscript RT. Reactions were then cooled on ice and 8 to 10 μL was used as template in a 50 μL PCR reaction.

PCR amplification of RT mRNA and cDNA libraries.

Oligonucleotide primer pairs for PCR (Table1) were designed using OSP software27 and published sequences for human FXI,18,28 glycoprotein IIb (GPIIb),29 and CD-18.30 Three sets of primers were prepared for FXI to amplify sequences represented by exons 3 through 6 of the FXI heavy chain, exons 10-14 from the carboxy-terminus of the heavy chain and catalytic light chain, and exons 3-15 covering the entire sequence encoding the mature protein (Fig 1). An additional pair of primers amplifying parts of exon 10 and 11 were prepared (Table 1) for use in identifying a common polymorphism in exon 1131 known to be present in one of the platelet donors (see below). PCR reactions for GPIIb, CD-18, and exons 3-6, 10-14, and 10-11 of FXI were amplified in reactions containing 1× TaKaRa reaction buffer, 1.5 mmol/L magnesium chloride, 100 μmol/L of each dNTPs, 10 pmol of each primer, 2.5 units of TaKaRa LA Taq polymerase, and 3.0 μL of RT mRNA in a total volume of 50.0 μL. PCR was performed on a Perkin Elmer model 460 DNA Thermal Cycler (Foster City, CA). The following cycling parameters were used: one cycle of denaturation at 94°C for 3 minutes, annealing at 60°C for 40 seconds and extension at 70°C for 1 minute, followed by 38 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 1 minute. Long-range PCR to amplify the 1.6 kb long fragment covering FXI exons 3-15 was performed in a total volume of 50 μL containing 1× TaKaRa reaction buffer, 1.5 mmol/L magnesium chloride, 400 μmol/L of each deoxyribonucleoside (dNTP), 10 pmol of each primer, 2.5 units of TaKaRa LA Taq polymerase, and 3.0 μL of RT mRNA. PCR was performed on a PTC-100 Thermal Cycler (MJ Research) using the following cycling conditions: an initial cycle of denaturation at 94°C for 3 minutes followed by 38 cycles of denaturation at 94°C for 40 seconds and annealing/extension at 66°C for 2 minutes. Small PCR fragments were size fractionated by electrophoresis on 2% NuSieve agarose gels. Long-range PCR fragments were separated on 1% SeaKem LE agarose gels.

Table 1.

Oligonucleotide Primers Used for Polymerase Chain Reaction Amplification of Reverse-Transcribed RNA. Primer Sequences are 5′-3′, Left-to-Right

Protein Position Oligonucleotide Sequence
Factor XI (exon 3-6)  5′ primer  AAGATGTTTACTCTTCACTTTCACGG  
Factor XI (exon 3-6)  3′ primer  CACTTTATCGAGCTTCGTTATTCTGG  
Factor XI (exon 10-15)  5′ primer  CTAAAATACTTCACGGGAGAGGAGG  
Factor XI (exon 10-15)  3′ primer  TCACTAAGGGTATCTTGGCTTTCTGG  
Factor XI (exon 3-15)  5′ primer  CTGCTTTGAAGGAGGGGACATTACTACGG  
Factor XI (exon 3-15)  3′ primer  CCTCATTGTGTTTGCAGGACAGAGGGC  
Factor XI (exon 10-11)  5′ primer  AAATACTTCACGGGAGAGGAGG  
Factor XI (exon 10-11)  3′ primer  CGGCTGTTAATATCCACTGGTTTC 
Glycoprotein IIb  5′ primer  GGGCGTGTGTATTTGTTCCTG 
Glycoprotein IIb  3′ primer  AGGTCTGGGTATCCGTTGTC  
CD18 5′ primer  GTCTGAGGACTCCAGCAATG  
CD18  3′ primer CACTCACACTGGGGAAGAAC 
Protein Position Oligonucleotide Sequence
Factor XI (exon 3-6)  5′ primer  AAGATGTTTACTCTTCACTTTCACGG  
Factor XI (exon 3-6)  3′ primer  CACTTTATCGAGCTTCGTTATTCTGG  
Factor XI (exon 10-15)  5′ primer  CTAAAATACTTCACGGGAGAGGAGG  
Factor XI (exon 10-15)  3′ primer  TCACTAAGGGTATCTTGGCTTTCTGG  
Factor XI (exon 3-15)  5′ primer  CTGCTTTGAAGGAGGGGACATTACTACGG  
Factor XI (exon 3-15)  3′ primer  CCTCATTGTGTTTGCAGGACAGAGGGC  
Factor XI (exon 10-11)  5′ primer  AAATACTTCACGGGAGAGGAGG  
Factor XI (exon 10-11)  3′ primer  CGGCTGTTAATATCCACTGGTTTC 
Glycoprotein IIb  5′ primer  GGGCGTGTGTATTTGTTCCTG 
Glycoprotein IIb  3′ primer  AGGTCTGGGTATCCGTTGTC  
CD18 5′ primer  GTCTGAGGACTCCAGCAATG  
CD18  3′ primer CACTCACACTGGGGAAGAAC 
Fig. 1.

Strategy for PCR amplification of human FXI mRNA. The FXI cDNA is encoded by 15 exons. Three sets of oligonucleotide primers (Table 1) were designed to amplify a 400 bp fragment from exons 3 to 6 of the heavy chain (primers 1 and 2), a 552 bp fragment from exons 10 to 14 of the C-terminus of the heavy chain and the catalytic light chain (primers 3 and 4), and a 1,673 bp fragment from exons 3 to 15 covering the coding region for the mature plasma protein (primers 5 and 6). A1 to A4 designate the four apple domains of the heavy chain; E, exon.

Fig. 1.

Strategy for PCR amplification of human FXI mRNA. The FXI cDNA is encoded by 15 exons. Three sets of oligonucleotide primers (Table 1) were designed to amplify a 400 bp fragment from exons 3 to 6 of the heavy chain (primers 1 and 2), a 552 bp fragment from exons 10 to 14 of the C-terminus of the heavy chain and the catalytic light chain (primers 3 and 4), and a 1,673 bp fragment from exons 3 to 15 covering the coding region for the mature plasma protein (primers 5 and 6). A1 to A4 designate the four apple domains of the heavy chain; E, exon.

DNA sequencing.

The PCR fragments representing FXI exons 3-6 from normal platelets, bone marrow, 293 control cells, MEG-01, HEL, and CHRF-288-11 RNA were subjected to dideoxy-chain termination sequencing using a Thermo Sequenase radiolabeled terminator cycle sequencing kit according to the manufacturers recommendations. Sequencing of the exon 10-11 product from the platelet RNA of an individual known to carry a polymorphism in exon 11 was performed in a similar manner. Fragments were sequenced in both directions using the oligonucleotide primers originally used to produce the PCR fragments. Reaction products were run on standard 7% polyacrylamide gels followed by autoradiography overnight. Sequences were compared with the published sequence for the human FXI cDNA.18 

RESULTS

PCR analysis for FXI mRNA in platelets and bone marrow.

The human FXI gene contains 15 exons. Exon 1 is not translated, whereas exon 2 encodes a signal peptide that is not present on the mature molecule.28 Exons 3-10 encode the FXI heavy chain and exons 11-15 encode the catalytic light chain.28 Three sets of PCR primers were used to amplify portions of the FXI message from RT RNA (Fig 1). The expected PCR products generated from the primer pairs, based on the published cDNA sequence for FXI18 are: 400 bp for exons 3-6, 552 bp for exons 10-14, and 1,673 bp for exons 3-15. PCR products of the expected sizes were generated when RT RNA from the 293 cell line transfected with a liver FXI cDNA (control cells) was used as template (Fig 2A, lane 1). Human pancreas has previously been showed by Northern blot analysis to express FXI mRNA.25 PCR products similar to those from the control cell line were obtained when a human pancreas cDNA library was used as template for all three sets of PCR primers (data not shown). When the PCR template was RT RNA from normal human platelets, single products were obtained that were identical in size to those from reactions with the 293 control cells (Fig 2A). Note, in Fig 2A the control sample in lane one for the exon 3-15 PCR product appears very heavy. This is due to overexposure of the film to show the PCR products from platelets, which are faint. The exon 3-15 PCR product represents a nearly full-length FXI message. As platelet RNA appears to be partially degraded on ethidium-stained agarose gels (data not shown), it is likely that there are very few full-length FXI messages in platelet RNA, accounting for the weakness of this PCR product. Peripheral blood platelets are anucleate cell fragments lacking the machinery for RNA synthesis (except perhaps for mitochondrial RNA). RNA in platelets, therefore, must be produced by megakaryocytes. We identified FXI message by RT-PCR in RNA from normal human bone marrow (Fig3, lane 1). Whereas the cell of origin of the message is not determined by this experiment, the results are consistent with a megakaryocytic origin for the FXI message identified in platelets. The positive result with bone marrow RNA could have been due to platelets within the bone marrow sample. However, the bone marrow RNA was prepared from a small sample (5 mL), and in our experience there is insufficient platelet RNA in this volume to generate a positive signal by RT-PCR. The DNA sequences of the exon 3-6 PCR fragments from platelets, bone marrow, pancreas, and the 293 control cells were identical to the published sequence for the human FXI cDNA.18 

Fig. 2.

PCR amplification of FXI mRNA from platelets and megakaryocytic cell lines. PCR was performed as described in the Materials and Methods section. (A) RT RNA extracted from human platelets was used as template to amplify exons 3-6 (top), exons 10-14 (middle), and exons 3-15 (bottom) of the FXI message. Lanes 1, RNA from 293 cells transfected with the human wild-type FXI cDNA (positive control); 2, RNA extracted from fresh platelets; 3 and 4, RNA extracted from platelets obtained by platelet-pheresis; and 5, no template (negative control). (B) RT poly-A RNA from megakaryocytic cell lines was used as template to amplify exons 3-6 of the FXI message. Lanes 1, HEL 92.1.7 cells; 2, MEG-01 cells; 3, CHRF-288-11 cells; and 4, no template (negative control). The positions of molecular weight markers (MWM) in kilobases are shown at the left of the figure.

Fig. 2.

PCR amplification of FXI mRNA from platelets and megakaryocytic cell lines. PCR was performed as described in the Materials and Methods section. (A) RT RNA extracted from human platelets was used as template to amplify exons 3-6 (top), exons 10-14 (middle), and exons 3-15 (bottom) of the FXI message. Lanes 1, RNA from 293 cells transfected with the human wild-type FXI cDNA (positive control); 2, RNA extracted from fresh platelets; 3 and 4, RNA extracted from platelets obtained by platelet-pheresis; and 5, no template (negative control). (B) RT poly-A RNA from megakaryocytic cell lines was used as template to amplify exons 3-6 of the FXI message. Lanes 1, HEL 92.1.7 cells; 2, MEG-01 cells; 3, CHRF-288-11 cells; and 4, no template (negative control). The positions of molecular weight markers (MWM) in kilobases are shown at the left of the figure.

Fig. 3.

PCR amplification of FXI exons 3-6, GPIIb, and CD-18 using RT RNA from human platelets, bone marrow, and leukocytes. PCR was performed as described in the Materials and Methods section. Lanes 1, bone marrow; 2, 293 cells transfected with wild-type FXI cDNA; 3, fresh platelets; 4, platelets from platelet-pheresis; 5, granulocytes; 6, mononuclear leukocytes. MWM indicates a 100 bp DNA ladder that serves as molecular weight markers. The intense marker band is 500 bp in size.

Fig. 3.

PCR amplification of FXI exons 3-6, GPIIb, and CD-18 using RT RNA from human platelets, bone marrow, and leukocytes. PCR was performed as described in the Materials and Methods section. Lanes 1, bone marrow; 2, 293 cells transfected with wild-type FXI cDNA; 3, fresh platelets; 4, platelets from platelet-pheresis; 5, granulocytes; 6, mononuclear leukocytes. MWM indicates a 100 bp DNA ladder that serves as molecular weight markers. The intense marker band is 500 bp in size.

A recent report describes a truncated FXI message lacking exon 5 in the megakaryocytic leukemia cell line CHRF-288-11.20 The absence of this exon in platelet or bone marrow mRNA should have resulted in PCR products of 241 bp for the exon 3-6 primer pair and 1,514 bp for the exon 3-15 primers. We did not observe either of these smaller species in any fresh platelet preparation (three separate donors, Figs 2A and 3 and data not shown) or in platelet-pheresis products from our blood bank (three separate donors, Figs 2A and 3).

PCR analysis for FXI mRNA in leukemia cell lines with megakaryoblastic features.

Cell lines MEG-01,21 HEL 92.1.7,22 and CHRF-288-1123 are derived from tissues of patients with acute nonlymphocytic leukemia. These cell lines have been shown to possess features and express proteins typically found in normal megakaryocytes. An FXI cDNA lacking exon 5 and a small part of the 3′-portion of exon 4 has been isolated from a cDNA library prepared from CHRF-288-11 RNA, and the MEG-01 line is reported to express an FXI mRNA of 1.9 kb (the message in liver is 2.1 kb) detectable by Northern blot analysis.20 RNA was isolated from cells and analyzed by RT-PCR with the exon 3-6 primer pair specific for the FXI heavy chain (Fig 2B). PCR products identical to the one from the control cell line were obtained with RNA from all three cell lines. No product that could represent a truncated FXI mRNA was identified in the cell lines. DNA sequences of the exon 3-6 PCR products for all cell lines were identical to the published sequence for the human FXI cDNA from liver.18 

PCR analysis of RNA from peripheral blood leukocytes.

A major concern when isolating RNA from peripheral blood platelets is contamination of the platelet preparation with small numbers of leukocytes that contain relatively large amounts of RNA compared to platelets. Although the platelet isolation technique used in this study produced several platelet preparations with no apparent leukocyte contamination by visual microscopic inspection, some leukocyte contribution to all platelet RNA preparations could not be ruled out. To address this potential problem, RNA was isolated and reverse transcribed from granulocytes and from mononuclear leukocytes (a combination of lymphocytes and monocytes) and along with platelet RNA was analyzed by PCR for leukocyte- and platelet-specific markers, in addition to FXI. The results of a representative experiment are shown in Fig 3. All platelet preparations and bone marrow were positive for GPIIb. As suspected, one of six platelet preparations gave a positive signal for CD-18, a component of the leukocyte marker LFA-1,30 indicating white cell contamination of the platelet preparation (data not shown). Both granulocytes and mononuclear cells were consistently positive for CD18. In addition, some preparations of mononuclear cells were positive for GPIIb, which is typically only found on platelets and megakaryocytes.32This is consistent with the platelet contamination noted in the leukocyte preparation. Most importantly, granulocytes and mononuclear cells did not give a positive signal for FXI. It is our impression that platelets contain very small amounts of FXI mRNA, and the low level of platelet contamination of the mononuclear cells would not provide sufficient platelet RNA to detect the FXI message. Although low levels of leukocyte expression of FXI mRNA can not be ruled out by this analysis, the results show that platelets are the major source of FXI mRNA in peripheral blood.

Control experiments for potential contamination of RNA preparations with DNA.

An obvious concern when using PCR to detect mRNA is the generation of a false-positive signal due to contamination with genomic or cDNA. Analysis by a technique that does not involve amplification steps, such as Northern blot or RNAse protection analysis can overcome this limitation. However, we were unable to show FXI message by these techniques in any of the RNA preparations in this study except for the transfected 293 cells that overexpress the message (data not shown). The amount of FXI message, therefore, is below the level of detection for these types of assays. In our experiments, PCR primer pairs were selected to amplify fragments with more than one exon, eliminating the possibility of genomic DNA being responsible for the signals. Control PCR reactions in which the template was RNA that had not been reverse transcribed were performed for all RNA preparations (Fig4). These reactions did not generate PCR products indicating that RNA preparations were not contaminated with factor XI cDNA, and that PCR products in reactions using RT RNA as template were dependent on the RT reaction. This shows that the template for the PCR signals is, indeed, mRNA.

Fig. 4.

Control reactions for RT dependence. Reactions for RT of RNA from human platelets or human megakaryocytic cell lines were performed as described in the Materials and Methods section either in the absence (-) or presence (+) of RT. The reaction products were then subject to PCR amplification using the oligonucleotide primer pair specific for exons 3-6 of human factor XI. PCR products were obtained only for reactions in which RT was present. Lanes 1, platelet RNA; 2, HEL 92.1.7 cells; 3, MEG-01 cells; 4, CHRF-288-11 cells; 5, 293 cells transfected with wild-type FXI cDNA. The position of the molecular weight marker is shown at the left of the figure.

Fig. 4.

Control reactions for RT dependence. Reactions for RT of RNA from human platelets or human megakaryocytic cell lines were performed as described in the Materials and Methods section either in the absence (-) or presence (+) of RT. The reaction products were then subject to PCR amplification using the oligonucleotide primer pair specific for exons 3-6 of human factor XI. PCR products were obtained only for reactions in which RT was present. Lanes 1, platelet RNA; 2, HEL 92.1.7 cells; 3, MEG-01 cells; 4, CHRF-288-11 cells; 5, 293 cells transfected with wild-type FXI cDNA. The position of the molecular weight marker is shown at the left of the figure.

Finally, several polymorphisms that do not result in amino acid changes have been reported in the coding sequence for the human FXI gene.31 One of these polymorphisms, a T to C change at base pair 1234 within exon 11, was known to be present in one copy of the FXI gene from one of our platelet donors. A PCR primer pair that amplifies portions of exons 10 and 11 (Table 1) was used to generate a 216 bp fragment from the platelet RNA of this donor, and the base pair sequence of the PCR product was determined (Fig5). The sequence shows both a T and a C residue at base pair 1234, consistent with the known heterozygous state for this person. This result could not have been created by genomic DNA contamination of the sample, as the PCR product involves parts of two exons separated by several kilobases of intron sequence in the gene.28 The pattern is highly unlikely to be caused by cDNA contamination because two separate sequences are present in the PCR product and no cDNAs containing the T to C polymorphism have been created in our laboratory. These data also confirm that platelet RNA is the template responsible for the PCR products in our experiments.

Fig. 5.

Nucleotide sequence of an RT-PCR amplified portion of FXI exon 11 from platelet RNA. RT-PCR and DNA sequencing were performed as described in the Materials and Methods section using platelet RNA from an individual known to be heterozygous for a T to C polymorphism within amino acid codon 379 of FXI (nucleotide position 1234 of the human cDNA sequence18) and a person homozygous for the wild-type (T) allele. The arrow indicates the position of the polymorphism. Note the signal for both a T and C residue at this position for the heterozygous individual.

Fig. 5.

Nucleotide sequence of an RT-PCR amplified portion of FXI exon 11 from platelet RNA. RT-PCR and DNA sequencing were performed as described in the Materials and Methods section using platelet RNA from an individual known to be heterozygous for a T to C polymorphism within amino acid codon 379 of FXI (nucleotide position 1234 of the human cDNA sequence18) and a person homozygous for the wild-type (T) allele. The arrow indicates the position of the polymorphism. Note the signal for both a T and C residue at this position for the heterozygous individual.

DISCUSSION

The bleeding diathesis associated with FXI deficiency has been perplexing since the first description of FXI-deficient patients in 1953.33 Congenital deficiency of FXI is a relatively rare disorder with a particularly high incidence in people of Ashkenazi Jewish descent.34 Excessive bleeding is typically triggered by trauma or surgical procedures, however, hemorrhage does not correlate well with plasma FXI levels determined by contact activation initiated clotting assays.7,8 In a seminal study, Asakai et al5 presented an explanation for some of the variation when they noted that hemorrhage depends not only on the FXI level in plasma, but also on the tissue involved. Bleeding from the oral cavity and urinary tract are particularly common, likely due to the high levels of fibrinolytic activity in these tissues. Nevertheless, there are severely deficient patients who do not bleed with surgical procedures, suggesting an alternative procoagulant activity may be present in some individuals that substitutes for plasma FXI. It has been proposed that the platelets of some people contain an FXI-like activity that may modify bleeding in the absence of plasma FXI.14,15 

Platelet α-granules, contain numerous proteins involved in hemostasis and fibrinolysis that are also present in plasma.35 The source of granule proteins appears to vary. The vWF 36 and the A chain of factor XIII37 are apparently of megakaryocyte origin, as megakaryocytes express mRNA for these proteins. In contrast, megakaryocytes do not express mRNA for albumin or the α and β chains of fibrinogen, indicating these proteins are taken up into granules from the plasma.38 Our results show FXI mRNA in human platelets and bone marrow, as well as three cell lines with megakaryocyte features. Furthermore, platelets are the major source of FXI mRNA in peripheral blood, because leukocyte RNA does not contain FXI message. The amount of FXI message in platelets and the leukemia cell lines appears to be small. Nevertheless, the data suggest FXI similar to the protein produced by the liver may be present in platelets, and could be released at sites of platelet activation to increase local concentrations of this clotting factor at a wound site. It should be noted that it is difficult to postulate a role for a platelet pool of FXI in the variable bleeding observed in FXI deficiency, because this protein would presumably be affected by the same mutation that produced the plasma deficiency state.

The presence of FXI mRNA in platelets does not provide definitive proof that FXI protein is present. The issue of whether or not platelets contain FXI protein, and the form this protein takes, is a controversial one. Evidence for platelet FXI comes from three major lines of investigation: (1) assays of FXI activity, (2) antibody-based immunologic studies of FXI antigen, and (3) molecular biology investigations of FXI mRNA. Well-washed platelets contain small amounts of activity that shorten the abnormally long clotting time of FXI-deficient plasma in an aPTT assay.13,39,40 The nature of this activity is difficult to determine by this type of assay, however, as complex platelet extracts contain factors that interact with the clotting cascade at many levels. Indeed, Schiffman et al41,42 and Osterud et al43 made this point when they examined platelet extracts for FXI activity and concluded no appreciable activity was present.

Using immunoprecipitation techniques with polyclonal antihuman FXI antibodies, three groups have reported on the partial purification of a 220 kD protein from platelets by immunoprecipitation.14-16The protein appears to be on the platelet surface, because it copurifies with the membrane fraction of sonicated platelets.13 The migration of this protein through SDS-polyacrylamide gels is different from plasma FXI, a 160 kD homodimer comprised of identical disulfide-bond–linked 80 kD polypeptides.17 Under reducing conditions the platelet protein migrates as a single 50 to 55 kD protein implying that the 220 kD protein is a polymer of a smaller subunit. The protein shares some features with plasma FXI, in addition to cross-reactivity with antibodies. Like plasma FXI, the platelet protein is cleaved by factor XIIa, and the cleaved form appears to cleave the synthetic substrate S-2366, indicating it is a protease.15 In contrast, unlike plasma FXI the platelet protein is not activated by trypsin, its proposed catalytic domain is substantially larger than that of factor XIa, and it has not been shown that it has FXIa activity (ie, activates factor IX). Although this protein may eventually be shown to possess FXI activity, it is difficult to invoke it at present as an explanation for variable bleeding in FXI deficiency because it is not known if some people have the protein while others lack it.

Using flow cytometry, Hu et al44 detected binding of anti-FXI antibodies to platelets from normal and FXI-deficient patients, a finding supported by earlier studies.14 These authors propose that the binding site for the antibody is a FXI-like molecule encoded by a modified message from the FXI gene that may circumvent mutations responsible for plasma FXI deficiency. The findings are consistent with this hypothesis, however, other possibilities must be considered. The simplest explanation is that the antibody is cross-reacting with a protein that may have homology to FXI, but is not a product of the FXI gene. In this circumstance it would not be expected to be affected by a mutation causing deficiency of plasma FXI. Alternatively, the antibodies could bind to normal FXI in normal platelets, and to mutant FXI molecules in platelets from FXI-deficient patients. A common point mutation associated with FXI deficiency in Ashkenazi Jews is a phenylalanine to leucine substitution at amino acid 283.5 The mutation interferes with normal dimer formation of FXI, resulting in reduced secretion of the protein into plasma.45 Factor XI associated with platelets may be stored in granules and not be secreted, however, and abnormal proteins could be retained within the platelets. Taken as a whole, the data obtained with FXI antibodies indicate that platelets contain a protein that is a protease and that has some homology to plasma FXI. The range of activities of this protein and its role in hemostasis, if any, remain to be determined.

Using PCR techniques, Hsu et al have recently provided evidence for an alternatively spliced mRNA from the FXI gene,20 and postulate that it codes for the 50 to 55 kD subunit of the platelet protein identified by FXI antibodies. With platelet RNA as template, each exon of the FXI gene could be amplified individually by RT/PCR except for exon 5, which encodes a portion of the apple two domain of the FXI heavy chain. This group also isolated a novel FXI cDNA lacking exon 5 and the 3′-terminal bp of exon 4 from a leukemia cell line cDNA library.20 This cell line, CHFR-288-11, shows megakaryocytic features including expression of platelet factor 4, vWF, and glycoprotein IIb/IIIa, as well as induction of multinucleation and hyperploidy upon stimulation with phorbol ester.23 We were interested to determine if the novel FXI message identified in the cDNA library of this cell line, is present in normal human blood tissues and in freshly prepared RNA from megakaryocyte cell lines.

We did not find evidence for truncated FXI mRNA in normal platelets or in the three megakaryoblast cell lines tested, including CHRF-288-11. All PCR products representing the FXI heavy chain contain normal sequence for exon 5. The results with RT-PCR cannot exclude the presence of low levels of alternatively spliced message, however, the data indicate the predominant message for FXI in platelets and cell lines is identical to the message produced in liver. Generation of FXI mRNA lacking exon 5 that would maintain an open reading frame would require an unusual mRNA splicing event that would ignore nearly perfect consensus donor splice junctions at the 3′-end of exons 4 and 5.28 Our studies failed to identify this species in normal blood cells. It is possible that some individuals may have a polymorphism in the FXI gene that could allow this splicing event to occur, and that we did not identify it in the platelets of the six individuals we tested. However, this possibility would not explain the discrepancy between our data with CHRF-288-11 mRNA and the previously published results of the novel alternatively spliced FXI message from a library prepared from this same cell line.20 

In summary, our results show FXI mRNA in platelets, suggesting platelets may contain FXI of megakaryocytic origin that is similar to plasma FXI produced in the liver. Although platelets appear to contain a membrane protein that cross-reacts with FXI antibodies, our data do not support the premise that this protein is a product of an alternatively spliced message from the FXI gene. This is supported by the failure of mutations in the FXI gene causing plasma FXI deficiency to influence the presence of the platelet membrane protein.44 

ACKNOWLEDGMENT

The authors are grateful to Dr Jerry Ware (Scripps Inst, LaJolla, CA) for providing cDNA libraries and information regarding HEL and CHRF-288-11 cells, and to Dr Michael Lieberman (University of Cincinnati, Cincinnati, OH) for providing the CHRF-288-11 cell line. We thank Dr Mortimer Poncz (University of Pennsylvania, Philadelphia, PA) for recommendations concerning leukocyte and platelet specific markers, and Dr George J. Broze, Jr (Washington University, St. Louis, MO) for his thoughtful reading of the manuscript. We also wish to thank Mr Mao-Fu Sun for expert technical assistance.

Supported by National Institutes of Health Grants HL02917 and HL58837. D.G. is an Established Investigator of the American Heart Association.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

REFERENCES

REFERENCES
1
Lindquist
P
Fujikawa
K
Davie
E
Activation of bovine factor IX (Christmas factor) by factor XIa (activated plasma thromboplastin antecedent) and a protease from Russel’s viper venom.
J Biol Chem
253
1978
1902
2
DiScipio
R
Kurachi
K
Davie
E
Activation of human factor IX (Christmas factor).
J Clin Invest
61
1978
1528
3
Osterud
B
Bouma
B
Griffin
G
Human blood coagulation factor IX: Purification, properties, and mechanism of activation by activated factor XI.
J Biol Chem
253
1978
5946
4
Walsh
P
Bradford
H
Sinha
D
Piperno
J
Tuszynzki
G
Kinetics of the factor XIa catalyzed activation of human coagulation factor IX.
J Clin Invest
73
1984
1392
5
Asakai
R
Chung
D
Davie
E
Seligsohn
U
Factor XI deficiency in Ashkenazi Jews in Israel.
N Engl J Med
325
1991
153
6
Seligsohn
U
Factor XI deficiency.
Thromb Haemost
70
1993
68
7
Ragni
M
Sinha
D
Seaman
F
Lewis
J
Spero
J
Walsh
P
Comparison of bleeding tendency, factor XI coagulant activity, and factor XI antigen in 25 factor XI-deficient kindreds.
Blood
65
1985
719
8
Bolton-Maggs
P
Wan-Yin
B
McGraw
A
Slack
J
Kernoff
P
Inheritance and bleeding in factor XI deficiency.
Brit J Haematol
69
1988
521
9
Rapaport
S
Proctor
R
Patch
M
Yettra
M
The mode of inheritance of PTA deficiency: Evidence for the existence of major PTA deficiency and minor PTA deficiency.
Blood
18
1961
149
10
Edson
J
White
J
Krivit
W
The enigma of severe factor XI deficiency without hemorrhagic symptoms.
Thromb Diath Haemorrh
18
1967
342
11
Tavori
S
Brenner
B
Tirski
I
The effect of combined factor XI deficiency with von Willebrand factor abnormalities on hemorrhagic diathesis.
Thromb Haemost
63
1990
36
12
Brenner
B
Laor
A
Lupo
H
Zivelin
A
Lanir
N
Seligsohn
U
Bleeding predictors in factor XI-deficient patients.
Blood Coagul Fibrinolysis
8
1997
511
13
Lipscomb
M
Walsh
R
Human platelets and factor XI: Localization in platelet membranes of factor XI-like activity and its functional distinction from plasma factor XI.
J Clin Invest
63
1979
1006
14
Tuszynski
G
Bevacqua
S
Schmaier
A
Colman
R
Walsh
P
Factor XI antigen and activity in human platelets.
Blood
59
1982
1148
15
Schiffman
S
Yeh
C
Purification and characterization of platelet factor XI.
Thromb Res
60
1990
87
16
Komiyama
Y
Nomura
S
Murakami
T
Masuda
M
Egawa
H
Murata
L
Okubo
S
Kokawa
T
Yasunaga
K
Purification and characterization of platelet-type factor XI from human platelets.
Thromb Haemost
69
1993
1238
(abstract)
17
Bouma
B
Griffin
J
Human blood coagulation factor XI, purification, properties, and mechanism of activation by activated factor XII.
J Biol Chem
252
1977
6432
18
Fujikawa
K
Chung
D
Hendrickson
L
Davie
E
Amino acid sequence of human factor XI, a blood coagulation factor with four tandem repeats that are highly homologous with plasma prekallikrein.
Biochemistry
25
1986
2417
19
Hsu
T
Walsh
P
Platelet factor XI mRNA amplified from human platelets by reverse transcription polymerase chain reaction.
Blood
82
1993
207A
(abstract)
20
Hsu
T
Shore
S
Seshsmma
T
Bagasra
O
Walsh
P
Molecular cloning of platelet factor XI, an alternative splicing product of the plasma factor XI gene.
J Biol Chem
273
1998
13787
21
Ogura
M
Morishima
Y
Ohno
R
Hirabayashi
N
Nagura
H
Saito
H
Establishment of a novel human megakaryoblastic leukemia cell line, MEG-01, with positive Philadelphia chromosome.
Blood
66
1985
1384
22
Martin
P
Papayannopoulou
T
HEL cells: A new human erythroleukemia cell line with spontaneous and induced globin expression.
Science
216
1982
1233
23
Fugman
D
Witte
D
Jones
C
Aronow
B
Lieberman
M
In vitro establishment and characterization of a human megakaryoblastic cell line.
Blood
75
1990
1252
24
Sun
Y
Gailani
D
Identification of a factor IX binding site on the third apple domain of activated factor XI.
J Biol Chem
271
1996
29023
25
Gailani
D
Sun
M
Sun
Y
A comparison of murine and human factor XI.
Blood
90
1997
1055
26
Chomczynski
P
Sacchi
N
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162
1987
156
27
Hillier
L
Green
P
OSP: A computer program for choosing PCR and DNA sequencing primers.
PCR Methods Appl
1
1991
124
28
Asakai
R
Davie
E
Chung
D
Organization of the gene for human factor XI.
Biochemistry
26
1987
7221
29
Frachet
P
Uzan
G
Thevenon
D
Denarier
E
Prandini
M
Marguerie
G
GP IIb and GP IIIa amino acid sequences deduced from human megakaryocyte cDNAs.
Mol Biol Rep
14
1990
27
30
Kishimoto
T
O’Connor
K
Lee
A
Roberts
T
Springer
T
Cloning of the beta subunit of the leukocyte adhesion proteins: Homology to an extracellular matrix receptor defines a novel supergene family.
Cell
48
1987
681
31
Martincic
D
Zimmerman
S
Ware
R
Sun
M
Whitlock
J
Gailani
D
Identification of mutations and polymorphisms in the factor XI genes of an African-American family by dideoxy fingerprinting.
Blood
92
1998
3309
32
Bennet
JS
Poncz
M
Platelet glycoproteins IIb and IIIa
Molecular Basis of Thrombosis and Hemostasis.
High
K
Roberts
H
1995
579
Dekker
New York, NY
33
Rosenthal
R
Dreskin
O
Rosenthal
N
New hemophilia-like disease caused by deficiency of a third plasma thromboplastin factor.
Proc Soc Exp Biol Med
82
1953
171
34
Seligsohn
U
High gene frequency of factor XI (PTA) deficiency in Ashkenazi Jews.
Blood
51
1978
1223
35
Niewiarowski
S
Holt
J
Cook
J
Biochemistry and physiology of secreted platelet proteins
Hemostasis and Thrombosis: Basic Principles and Clinical Practice
ed 3
Colman
R
Hirsh
J
Marder
V
Salzman
E
1994
546
Lippincott
Philadelphia, PA
36
Ginsberg
D
Konkle
B
Gill
J
Montgomery
R
Bockenstedt
P
Johnson
T
Yang
A
Molecular basis of human von Willebrand disease: Analysis of platelet von Willebrand factor mRNA.
Proc Natl Acad Sci USA
86
1989
3723
37
Poon
M
JA
R
Low
S
Sinclair
G
Jones
A
Blahey
W
Ruether
B
Hoar
D
Hemopoietic origin of factor XIII A subunits in platelets, monocytes, and plasma.
J Clin Invest
84
1989
787
38
Handgama
P
Rappolee
P
Werb
Z
Levin
J
Bainton
D
Platelet alpha granule fibrinogen, albumin, and immunoglobulin G are not synthesized by rat or mouse megakaryocytes.
J Clin Invest
86
1990
1364
39
Walsh
P
Albumin density gradient separation and washing of platelets and the study of platelet coagulant activities.
Br J Haematol
22
1972
205
40
Connellan
J
Muntz
R
Castaldi
P
Factor XI in the coagulant activity of platelets.
Haemostasis
6
1977
41
41
Schiffman
S
Rapaport
S
Chong
M
Platelets and initiation of intrinsic clotting.
Br J Haematol
24
1973
633
42
Schiffman
S
Rimon
A
Rapaport
S
Factor XI and platelets: Evidence that platelets contain only minimal factor XI activity and antigen.
Br J Haematol
35
1977
429
43
Osterud
B
Harper
E
Rapaport
S
Lavine
K
Evidence against collagen activation of platelet-associated factor XI as a mechanism for initiating intrinsic clotting.
Scand J Haematol
22
1979
205
44
Hu
C
Baglia
F
Mills
D
Konkle
B
Walsh
P
Tissue-specific expression of functional platelet factor XI is independent of plasma factor XI expression.
Blood
91
1998
3800
45
Meijers
J
Davie
E
Chung
D
Expression of human blood coagulation factor XI: Characterization of the defect in factor XI type III deficiency.
Blood
79
1992
1435