Abstract

Although acute lymphoblastic leukemia (ALL) is the most common childhood cancer, factors governing susceptibility to this disease have not yet been identified. As such, ALL offers a useful opportunity to examine the glutathione S-transferase and cytochrome P450 genes in determining susceptibility to pediatric cancers. Both enzymes are involved in carcinogen metabolism and have been shown to influence the risk a variety of solid tumors in adults. To determine whether these genes played a similar role in childhood leukemogenesis, we compared the allele frequencies of 177 childhood ALL patients and 304 controls for the CYP1A1, CYP2D6, GSTM1, and GSTT1 genes. We chose the French population of Quebec as our study population because of its relative genetic homogeneity. The GSTM1 null and CYP1A1*2A genotypes were both found to be significant predictors of ALL risk (odds ratio [OR] = 1.8). Those possessing both genotypes were at an even greater risk of developing the disease (OR = 3.3). None of the other alleles tested for proved to be significant indicators of ALL risk. Unexpectedly, girls carrying the CYP1A1∗4 were significantly underrepresented in the ALL group (OR = 0.2), suggesting that a gender-specific protective role exists for this allele. These results suggest that the risk of ALL may indeed be associated with xenobiotics-metabolism, and thus with environmental exposures. Our findings may also explain, in part, why ALL is more prevalent among males than females.

ACUTE LYMPHOBLASTIC leukemia (ALL) is the most frequent cancer found among children. ALL is a heterogeneous disease characterized by the predominance of lymphoblasts or immature hematopoietic precursors, in which malignant cells express diverse phenotypes and respond variably to chemotherapy. Despite much investigation, little is known about leukemogenesis, particularly with respect to issues such as the role of inherited genetic susceptibility and environmental factors, although the clinical, pathological, and immunophenotypic features of the disease are well documented.1 To date, epidemiological studies have failed to find any reproducible, significant associations between ALL and either genetic or environmental factors.2-4 

It has been suggested that individuals possessing a modified ability to metabolize carcinogens are at increased risk of cancer.5Thus, polymorphisms in genes encoding carcinogen-metabolizing enzymes may have relevance in determining susceptibility to cancer—individuals carrying the more active form of an enzyme involved in the activation of carcinogens, or less efficient alleles of detoxifying enzymes, will be at greater risk of cancer. For this reason, two families of genes have attracted interest: phase I cytochromes P-450 (CYPs) and phase II glutathione-S-transferases (GSTs).

Genetic variants have been described in whites in both the CYP1A16-8 and CYP2D69 genes. Furthermore, a significant number of individuals lacking GSTM1 and GSTT1 activity display homozygous deletion (null allele) at the corresponding gene locus.10,11 Several studies have reported associations between these variants and altered risk of a variety of cancers, including those of the lung, bladder, gastrointestinal tract, skin, cervix, and breast.12-16 The prevalence of each polymorphism varies greatly among different ethnic groups, as well as within the white population.17,18 Because such variation can influence the power and interpretation of epidemiological data, it would seem that the study of a more homogeneous patient population is needed. We propose that the Canadian population originating from the Province of Quebec (∼80% of French origin), well known for the presence of founder effect,19 constitutes an ideal genetic model for carrying out such epidemiological studies.

In this study, we used a polymerase chain reaction (PCR)-based genotyping approach to examine the relationship between genetic polymorphisms in GSTM1, GSTT1, CYP1A1, and CYP2D6, and susceptibility to childhood ALL in the French-Canadian population. We report the analysis of these loci in 177 ALL patients and in 304 controls.

MATERIALS AND METHODS

Subjects

Childhood ALL patients (n = 177) were diagnosed in the Division of Hematology-Oncology of Ste-Justine Hospital, Montréal, between August 1988 and September 1997. The criteria for inclusion in this group were: (1) Complete clinical history; (2) whites of French-Canadian origin residing in the Province of Quebec as judged by their names, languages, and places of birth; (3) availability of biological material. The recruited patients comprised 110 males and 67 females between the ages of 1 and 21 years (mean age, 8 ± 4.9). The distribution of ALL subtypes as determined by immunophenotyping was as follows: 137 pre-B ALL, 20 T-cell ALL, and 20 with undetermined lineage. A general population control group composed of 144 males and 160 females was randomly selected from a large DNA institutional bank. The criteria for inclusion in the control group were: (1) anonymous, healthy, and unrelated individuals recruited from the population served by Ste-Justine Hospital; (2) whites of French-Canadian origin residing in the Province of Quebec as judged by their language and place of birth. The research protocol was approved by the Institutional Review Board (Hospital Ste-Justine, University of Montréal) and informed consent was obtained from all participating individuals and/or their parents involved in the study.

Genotyping

DNA isolation.

DNA was isolated from either buccal epithelial cells, peripheral blood, or bone marrow in remission, as described by Baccichet et al.20 

GSTM1 polymorphism.

The polymorphic deletion of the GSTM1 gene was genotyped using the multiplex PCR approach described by Zhong et al.12 The PCR primers used were as follows: P1, 5′ CGCCATCTTGTGCTACATTGCCCG; P2, 5′ ATCTTCTCCTCTTCTGTCTC; and P3, 5′ TTCTGGATTGTAGCAGATCA. P1 and P3 amplify a 230-bp product that is specific to GSTM1, whereas P1 and P2 anneal to GSTM1 and GSTM4 genes, yielding a 157-bp fragment that serves as an internal control. PCR was performed in 20 μL containing 20 ng of genomic DNA, 0.5 μmol/L of each primer, 200 μmol/L of each dNTPs, 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 1.5 mmol/L MgCl2, and 0.5 U of ampliTaq DNA polymerase (Hoffman-LaRoche, Branchburg, NJ). After denaturation for 4 minutes at 94°C, the PCR was performed for 35 cycles of 30 seconds at 94°C, 1 minute at 58°C, and 1 minute at 72°C. The last elongation step was extended to 7 minutes. Negative and positive control samples were included in each amplification series. The presence of one or both GSTM1 allele, identified by a 230-bp fragment, or its complete deletion (null genotype), was analyzed by electrophoresis on a 1.2% agarose gel. The absence of amplifiable GSTM1 (in the presence of the GSTM4 coamplified control) indicates a null genotype.

GSTT1 polymorphism.

The polymorphic deletion of the GSTT1 gene was determined by a modification of the PCR protocol described by Katoh et al.21 The amplification reaction was performed in 20 μL containing 20 ng of genomic DNA, 0.5 μmol/L of each primer, 200 μmol/L of each dNTPs, 2.0 mmol/L MgCl2, 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, and 0.5 U ampliTaq DNA polymerase (Hoffman-LaRoche). The primers used to amplify GSTT1 were F46, 5′ GCCCTGGCTAGTTGCTGAAG and R137, 5′ GCATCTGATTTGGGGACCACA. A 268-bp fragment in the exon 1 of β-globin gene was coamplified with the primers BgloF, 5′ CAACTTCATCCACGTTCACC and BgloR, 5′ GAAGAGCCAAGGACAGGTAC as a control. The PCR was performed for 35 cycles of 15 seconds at 94°C, 30 seconds at 59°C, and 45 seconds at 72°C. The last elongation step was extended to 7 minutes. Negative and positive control samples were included in each amplification series. The presence of one or two GSTT1 alleles, identified by a 112-bp fragment, or its complete deletion (null genotype), was shown by electrophoresis on a 1.5% agarose gel. GSTT1 genotypes were scored only if the PCR signal corresponding to the β-globin internal control was evident.

CYP1A1 polymorphisms.

CYP1A1 mutations T6235C (m1), A4889G (m2), and C4887A (m4) were characterized by the PCR-RFLP approach of Cascorbi et al.8A DNA fragment of 899 bp was amplified in 20 μL containing 20 ng of genomic DNA, 0.5 μmol/L of primers M3F (5′ GGCTGAGCAATCTGACCCTA) and P80 (5′ TAGGAGTCTTGTCTCATGCCT), 200 μmol/L dNTPs, 10 mmol/L Tris-HCl (pH 8.3), 2.5 mmol/L MgCl2, 50 mmol/L KCl, and 0.5 U AmpliTaq DNA polymerase (Hoffman-LaRoche). PCR was performed for 35 cycles of 30 seconds at 94°C, 1 minute at 63°C, and 1 minute at 72°C. The PCR product (5 to 10 μL) was digested with Msp1 (3 U, 37°C), resulting in smaller fragments (693 and 206 bp) in case of the mutation, and subjected to electrophoresis on a 1.5% agarose gel. Mutations m2 and m4 were detected by amplifying a 204-bp fragment with primers M2F (5′ CTGTCTCCCTCTGGTTACAGGAAGC) and M2R (5′ TTCCACCCGTTGCAGCAGGATAGCC) as described above, followed by digestion with BsrDI (1 U, 65°C) and BsaI (2 U, 55°C), respectively. Both restriction sites were lost in the case of mutation and the resulting restricted fragments were evaluated on a 2.0% agarose gel. These mutations were then used to define three distinct alleles, CYP1A1*2A (presence of m1 only), *2B (both m1 and m2), and *4 (m4 only).

CYP2D6 polymorphisms.

The mutant CYP2D6*4 (G-to-A transition at position 1934) and CYP2D6*3 (a 1-bp deletion in position 2637) alleles were detected by PCR amplification using exon3/intron4 primers (forward, 5′ GCCTTCGCCAACCACTCCG; reverse, 5′ AAATCCTGCTCTTCCGAGGC) followed byBstNI digestion (3 U at 60°C), and primers to exon 5/intron 5 (forward, 5′ GATGAGCTGCTAACTGAGCCC; reverse, 5′ CCGAGAGCATACTCGGGAC), followed by HpaII digestion (3 U, 37°C), respectively.22 PCR was performed for 35 cycles of 30 seconds at 94°C, 45 seconds at 56°C (*3) or 60°C (*4), and 45 seconds at 72°C in 20 μL containing 20 ng of genomic DNA, 1.0 μmol/L of each primer, 200 μmol/L dNTPs, 10 mmol/L Tris-HCl (pH 8.3), 1.5 mmol/L MgCl2, 50 mmol/L KCl, and 0.5 U AmpliTaq DNA polymerase (Hoffman-LaRoche). The PCR product (10 μL) was digested with the corresponding restriction enzyme and subjected to electrophoresis on a 2.0% agarose gel.

Statistical Analysis

The statistical significance of the differences between groups was calculated using the Fisher exact test (two-sided). Crude odds ratios (ORs) were calculated and are given within 95% confidence intervals (CI). Unconditional multivariate logistic analyses were performed separately for each locus. Age and gender were included as covariables, as were all genotypes studied and possible interactions. Individuals having the null genotype for GSTM1 and GSTT1, who were homozygous for CYP2D6 variant and/or carriers of at least one CYP1A1 mutant allele, were considered at risk. All analyses were performed using an SPSS statistical package (version 7.5) (SPSS Inc, Chicago, IL). The fraction of the disease attributable to a given genotype was estimated according to Coughlin et al.23 

RESULTS

DNA of a quality suitable for PCR was available from 177 whites of French-Canadian origin diagnosed with ALL and 304 healthy controls of a similar ethnic background. Some individuals were not successfully genotyped for all mutations tested, thus explaining the variations in the total number of samples listed in tables 1 to 5. Both pre-B and T-cell ALLs were considered part of the same group because no significant differences were observed in terms of the tested genotypes (data not shown). The frequency of CYP1A1 and CYP2D6 alleles, as well as the distribution of GSTM1, GSTT1, CYP1A1, and CYP2D6 genotypes in ALL patients and in controls are given in Tables 1 and2, respectively. The observed prevalence of these mutations is in accordance with data from other studies of groups of whites.9,24-26 

Table 1.

Frequency of CYP1A1 and CYP2D6 Alleles in ALL Patients and Controls

Locus  Allele  Cases Controls  
n No. (%)  n No.(%)  
CYP1A1  *2A  340  34 (10)  598  37 (6.2) 
 *2B  340  13 (3.8)  598  24 (4.0) 
 *4  354  12 (3.4)  590  30 (5.1) 
CYP2D6  *3  334  11 (3.3)  604  14 (2.3) 
 *4  352  71 (20.2)  604  104 (17.2) 
Locus  Allele  Cases Controls  
n No. (%)  n No.(%)  
CYP1A1  *2A  340  34 (10)  598  37 (6.2) 
 *2B  340  13 (3.8)  598  24 (4.0) 
 *4  354  12 (3.4)  590  30 (5.1) 
CYP2D6  *3  334  11 (3.3)  604  14 (2.3) 
 *4  352  71 (20.2)  604  104 (17.2) 

Total number of chromosomes analyzed.

Number of mutant alleles.

Table 2.

Distribution of CYP1A1, CYP2D6, GSTM1, and GSTT1 Genotypes in ALL Cases and Controls

Locus  Cases Controls  
Allele  Genotype n No.2-153(%)  n No.2-153 (%)  
CYP1A1*2A  −/−  170 137 (80.6)  299  264 (88.3)  
 −/+  32 (18.8)   33 (11.0)  
 +/+   1 (0.6)  2 (0.7)  
CYP1A1*2B  −/−  170  158 (92.9) 299  275 (92.0)  
 −/+   11 (6.5)  24 (8.0)  
 +/+   1 (0.6)   0 (0.0) 
CYP1A1*4  −/−  177  167 (94.4)  295 267 (90.5)  
 −/+   8 (4.5)   26 (8.8) 
 +/+   2 (1.1)   2 (0.7)  
CYP2D6*3  −/− 167  159 (95.2)  302  289 (95.7)  
 −/+  5 (3.0)   12 (4.0)  
 +/+   3 (1.8)  1 (0.3)  
CYP2D6*4  −/−  176  113 (64.2) 302  207 (68.5)  
 −/+   55 (31.3)  86 (28.5)  
 +/+   8 (4.5)   9 (3.0) 
CYP2D6  PM
 
165  11 (6.7)  299 11 (3.7)  
GSTM1  Present
 
174  61 (35.1) 304  148 (48.7)  
 Null
 
 113 (64.9)  156 (51.3)  
GSTT1  Present
 
176 148 (84.1)  274  227 (82.8)  
 Null
 
 28 (15.9)   47 (17.2) 
Locus  Cases Controls  
Allele  Genotype n No.2-153(%)  n No.2-153 (%)  
CYP1A1*2A  −/−  170 137 (80.6)  299  264 (88.3)  
 −/+  32 (18.8)   33 (11.0)  
 +/+   1 (0.6)  2 (0.7)  
CYP1A1*2B  −/−  170  158 (92.9) 299  275 (92.0)  
 −/+   11 (6.5)  24 (8.0)  
 +/+   1 (0.6)   0 (0.0) 
CYP1A1*4  −/−  177  167 (94.4)  295 267 (90.5)  
 −/+   8 (4.5)   26 (8.8) 
 +/+   2 (1.1)   2 (0.7)  
CYP2D6*3  −/− 167  159 (95.2)  302  289 (95.7)  
 −/+  5 (3.0)   12 (4.0)  
 +/+   3 (1.8)  1 (0.3)  
CYP2D6*4  −/−  176  113 (64.2) 302  207 (68.5)  
 −/+   55 (31.3)  86 (28.5)  
 +/+   8 (4.5)   9 (3.0) 
CYP2D6  PM
 
165  11 (6.7)  299 11 (3.7)  
GSTM1  Present
 
174  61 (35.1) 304  148 (48.7)  
 Null
 
 113 (64.9)  156 (51.3)  
GSTT1  Present
 
176 148 (84.1)  274  227 (82.8)  
 Null
 
 28 (15.9)   47 (17.2) 

−/−, absence of mutant allele; −/+, heterozygous; +/+, homozygous for mutant allele; PM, poor metabolizer, ie, homozygous and combined heterozygous for alleles *3 and *4; present, carrier of at least one wild-type allele; null, homozygous deletion.

Total number of individuals tested.

F2-153

Number of individuals with a given genotype.

The incidence of GSTM1 null and CYP1A1*2A genotypes were significantly increased in ALL cases as compared with controls (Tables 1 and3). Among ALL patients, 64.9% were homozygous for the GSTM1 null genotype, compared with 51.3% of controls, and CYP1A1*2A individuals account for 19.4% of ALL cases, compared with 11.7% of controls (Table 2). Consequently, there was an 80% increase in the risk of ALL associated with the GSTM1 null genotype (OR = 1.8; 95% CI, 1.2-2.6) and CYP1A1*2A allele (OR = 1.8; 95% CI, 1.1-3.1) (Table 3). These data indicate that the absence of the GSTM1 gene and the presence of the CYP1A1*2A allele are associated with an increased risk of ALL in this group of patients. An increase in the frequency of CYP2D6 poor metabolizer was observed in children with ALL compared with controls (Table 2), but the difference was not statistically significant (Table 3). None of the other variants studied proved to be significant predictors of ALL risk (Table 3).

Table 3.

Relationship Between CYP1A1, CYP2D6, GSTM1, and GSTT1 Genotypes and Risk of Childhood ALL

Gene  Genotype  OR  95% CI  P 
CYP1A13-151 *2A  1.8  1.1-3.1  .033-155 
 *2B  0.9  0.4-1.8 .90  
 *4  0.6  0.3-1.2  .16  
CYP2D63-152 *5.5  0.6-53.4  .13  
 *4  1.6  0.6-4.1  .40 
 PM  1.8  0.8-4.4  .17  
GSTM13-153 Null  1.8 1.2-2.6  .0043-155 
GSTT13-153 Null  0.9  0.5-1.5 .80 
Gene  Genotype  OR  95% CI  P 
CYP1A13-151 *2A  1.8  1.1-3.1  .033-155 
 *2B  0.9  0.4-1.8 .90  
 *4  0.6  0.3-1.2  .16  
CYP2D63-152 *5.5  0.6-53.4  .13  
 *4  1.6  0.6-4.1  .40 
 PM  1.8  0.8-4.4  .17  
GSTM13-153 Null  1.8 1.2-2.6  .0043-155 
GSTT13-153 Null  0.9  0.5-1.5 .80 

Abbreviations: OR, crude odds ratio; CI, confidence interval.

F3-151

Heterozygous and homozygous mutant combined.

F3-152

Homozygous mutant only; PM, poor metabolizer, ie, homozygous and combined heterozygous for mutant alleles.

F3-153

Null, homozygous deletion.

F3-155

The use of the Bonferroni correction (k = 8) for multiple testing did not change the interpretation of the result for GSTM1 null genotype.

A multivariate analysis using unconditional logistic regression was performed to determine which of the variables (gender, age, GSTM1, GSTT1, CYP1A1, and CYP2D6) continued to show significant differences between cases and controls in the presence of the others. Multivariate OR for GSTM1 and CYP1A1*2A were 1.8 (95% CI = 1.2-2.8) and 2.1 (95% CI = 1.2-3.8), respectively. Because GSTM1 is involved in the detoxification of compounds activated by CYP1A1, and both of these enzymes were shown to act independently as ALL risk factors (Table 3), we investigated whether this risk was further increased when both genotypes were combined. When individuals without either of the risk-elevating genotypes were considered as the reference group (ie, those with GSTM1 present and without the CYP1A1*2A allele), we found an increased risk of ALL (OR = 3.3, 95% CI = 1.6-6.9) in children carrying both genotypes at risk (Table 4). The proportion of the disease attributable to CYP1A1*2A and GSTM1 null genotypes alone was estimated to 3% and 19%, respectively, whereas the combined CYP1A1 and GSTM1 risk-elevating genotypes contributed for 8%.

Table 4.

Combined Effects of GSTM1 Null Genotype and CYP1A1*2A Allele in Childhood ALL Risk

Genotype at Risk  GSTM1  CYP1A1*2A  Cases (n = 166)  Controls (n = 299)  OR (95% CI)  
None Present  −/−  49  126  1.0 (referent)  
One Null  −/−  84  138  1.6 (1.0-2.4)  
 Present +/+, −/+  12  19  1.6 (0.7-3.6)  
Two  Null +/+, −/+  21  16  3.3 (1.6-6.9)4-151 
Genotype at Risk  GSTM1  CYP1A1*2A  Cases (n = 166)  Controls (n = 299)  OR (95% CI)  
None Present  −/−  49  126  1.0 (referent)  
One Null  −/−  84  138  1.6 (1.0-2.4)  
 Present +/+, −/+  12  19  1.6 (0.7-3.6)  
Two  Null +/+, −/+  21  16  3.3 (1.6-6.9)4-151 

Abbreviations: OR, crude odds ratio; CI, confidence interval.

F4-151

P = .002.

Stratified analysis showed the surprising result that girls carrying at least one CYP1A1*4 allele were significantly underrepresented in the ALL group (OR = 0.2; 95% CI, 0.05-0.9) suggesting a gender-specific protective role against ALL for this allele (Table5). No other significant synergistic or antagonist statistical interactions between any other combinations of the variables studied here were observed.

Table 5.

CYP1A1*4 Genotype and Gender-Related Risk of Childhood ALL

CYP1A1*4  Female Male  
Group  Genotype5-151 n5-152 No.5-153 (%) n5-152 No.5-153 (%)  
ALL cases  −/−  67  65 (97.0) 110  102 (92.7)  
 −/+   2 (3.0)   6 (5.5) 
 +/+   0 (0.0)   2 (1.8)  
Controls  −/− 156  135 (86.5)  139  132 (95.0)  
 −/+  19 (12.2)   7 (5.0)  
 +/+   2 (1.3)  0 (0.0) 
CYP1A1*4  Female Male  
Group  Genotype5-151 n5-152 No.5-153 (%) n5-152 No.5-153 (%)  
ALL cases  −/−  67  65 (97.0) 110  102 (92.7)  
 −/+   2 (3.0)   6 (5.5) 
 +/+   0 (0.0)   2 (1.8)  
Controls  −/− 156  135 (86.5)  139  132 (95.0)  
 −/+  19 (12.2)   7 (5.0)  
 +/+   2 (1.3)  0 (0.0) 

A crude OR = 0.2 (95% CI 0.05-0.9, P = .02) was estimated by combining females heterozygous and homozygous for mutant allele; the multivariate OR is 0.17 (95% CI 0.03-0.8,P = .03).

F5-151

−/−, Absence of mutant allele; −/+, heterozygous; +/+, homozygous for mutant allele.

F5-152

Total number of individuals tested.

F5-153

Number of individuals with a given genotype.

DISCUSSION

Little attention has been paid to the role of genetic susceptibility in the aetiology of childhood ALL. It is thought that genetic factors and environmental exposures predispose children to leukemogenesis. The fact that the etiology of sporadic cancers cannot be explained by allelic variability at a single locus is in part due to the complexity of xenobiotics metabolism in cancer. This study presents the first combined analysis of loci encoding both phase I and II xenobiotic-metabolizing enzymes in a pediatric cancer and, as such, it represents an important contribution.

We determined the frequencies of CYP1A1, CYP2D6, GSTM1, and GSTT1 gene polymorphisms in a particular white population of French-Canadian origin. This population is well known for the presence of founder effect indicating a relative genetic homogeneity due to particular demographic and historic characteristics.19 The overall frequencies of the tested genotypes in control subjects agreed with those reported in other studies.9,24-26 However, in the case of the CYP1A1*4 variant, there seems to be a difference between the frequency observed in French-Canadians (5.1%) and that found in other white populations (2% to 3%).8,26 We have shown that children carrying the GSTM1 null genotype are at increased risk of developing ALL (OR = 1.8). Glutathione S-transferases are involved in the metabolism of a wide range of xenobiotics, including environmental carcinogens, chemotherapeutic agents, and reactive oxygen species.27,28 Several epidemiologic studies have associated the null genotype of GSTM1 with a higher risk of cancer in adults11—this is probably related to an inability to metabolize tobacco-related carcinogens, such as benzo(a)pyrene.29 The only other study analyzing the GST genotypes in the context of ALL risk reported that the double-null genotype for GSTM1 and GSTT1 was significantly more frequent among blacks with childhood ALL, but failed to show that an increased risk was associated with this genotype in whites.30 This discrepancy may be the result of an ethnically heterogeneous population, as great variations in allele frequency are observed both among and within different ethnic groups.24,25 

Children carrying the CYP1A1*2A allele are also at greater risk of developing ALL (OR = 1.8). To our knowledge, this is the first report of an association between a CYP1A1 variant and the risk of childhood ALL. The CYP1A1*2A allele is associated with elevated enzymatic activity,8,17 supporting the hypothesis linking the risk of ALL with the inducibility of the xenobiotics-metabolizing enzyme CYP1A1.31 Consequently, carriers of variant alleles are expected to be at a greater risk when exposed to carcinogens such as PAH.6 Indeed, an association between the induction of placental CYP1A1 activity and PAH in cigarette smoke or cooked foods has been reported.32-35 We cannot rule out the possibility that CYP1A1*2A result is due to chance in the context of multiple testing. However, the influence of this genotype is more obvious when other variants participated in the effect.

The presence of both the CYP1A1*2A allele and the GSTM1 null-genotype confers an additional risk of ALL (OR = 3.3) on the carriers. Similar studies performed in adults with nonhematological neoplasias provide further evidence for an increase in the risk of cancer in patients carrying both CYP1A1- and GSTM1-risk alleles.36,37 This is supported biologically by a recent study showing that the combination of CYP1A1 and GSTM1 genotypes clearly affects the formation of DNA adducts in human white blood cells.38 Finally, our results suggest that allelism in CYP2D6 and GSTT1 genes do not play an important role in the aetiology of ALL. However, more data are needed to confirm these findings.

The scarcity of molecular epidemiology studies in childhood diseases makes it difficult to predict how these genotypes at risk will modify the host response to different exposures. Epidemiologic studies have led to the suggestion that in utero and postnatal exposures to various biological, physical, and chemical factors may be important determinants of childhood ALL.39-41 The apparent association of parental exposures to various chemicals31,42-46 suggests that variability at loci encoding xenobiotic-metabolizing enzymes could influence susceptibility to this disease. Infants and children may be at greater risk than adults from a variety of environmental toxicants, including polycyclic aromatic hydrocarbons (PAHs), nitrosamines, pesticides, tobacco smoke, and air pollution due to differential exposure and/or physiologic immaturity.41,47 Xenobiotics enter the placenta through maternal circulation,48 which possesses the ability to metabolize these compounds through processes similar to those seen in the liver.34,49 Therefore, alterations in placental metabolizing capabilities could potentially result in the exposure of the developing foetus to harmful electrophiles. As a target of damage from ubiquitous exposures to xenobiotics, a young child (or fetus) with either the null GSTM1 genotype and/or the CYP1A1*2A allele will be at greater risk of ALL. In this regard we found that 8% of the disease is attributable to combined CYP1A1 and GSTM1 genotypes at risk, whereas GSTM1 null and CYP1A1*2A genotypes alone contributed to 19% and 3%, respectively. These results suggest that the effect of CYP1A1*2A to ALL susceptibility depends on the presence of other genotypes at risk.

As stated earlier, the fact that CYP1A1*4 allele is underrepresented among ALL females suggested a gender-specific protective role for this allele. This finding could partly explain the higher prevalence of ALL in males.50-52 Unlike gender-related hormonal factors that play an obvious role in breast cancer, other sources of variation in cancer risk due to gender have received little attention. The gene product of CYP1A1*4 may be transcriptionally induced or regulated by certain endogenous steroids or other nongenetic factors in females or males. Studies on animals have shown that exogenous agents may permanently affect the expression patterns of specific cytochromes P450.53 Such imprinting of sex-specific cytochrome P450 forms is controlled by the levels and modes of excretion of androgens, estrogens, and growth hormone.54 Unfortunately, the biological significance of the *4 mutation due to C-to-A transversion at position 4887 in the heme-binding domain of exon 7 (threonine exchange to asparagine in codon 461) is still unknown.8However, we cannot exclude the role of an adjacent gene in linkage with CYP1A1 whose particular allele in association with *4 mutation could be responsible for the effect observed. Because the human fetus and embryo are exposed to numerous chemicals throughout gestation, it is theoretically possible that the imprinting of cytochrome P450 enzymes also occurs.

ACKNOWLEDGMENT

We are grateful to Dr Claire Infante-Rivard for helpful discussion on the epidemiology and biostatistics aspects of this work. We thank Hugues Sinnett for his excellent technical assistance. We are grateful to all patient and control subjects who participated in this study as well as the physicians and staff for their collaboration.

Supported by the Fondation Charles-Bruneau and Power Corporation Inc/Fondation Hôpital Ste-Justine. D.S. is a scholar of the Fonds de la Recherche en Santé du Québec.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

REFERENCES

REFERENCES
1
Champlin
R
Gale
RP
Acute lymphoblastic leukaemia: recent advances in biology and therapy.
Blood
73
1989
2051
2
Linet
MS
The Leukemias: Epidemiologic Aspects.
1985
Oxford University Press
New York, NY
3
Pendergrass
TW
Epidemiology of acute lymphoblastic leukaemia.
Semin Oncol
12
1985
80
4
Greaves
MF
Speculations on the cause of childhood acute lymphoblastic leukaemia.
Leukaemia
2
1988
120
5
Perera
FP
Molecular epidemiology: Insights into cancer susceptibility, risk assessment, and prevention.
J Natl Cancer Inst
88
1996
496
6
Kawajiri
K
Nakachi
K
Imai
K
Yoshii
A
Shinoda
N
Watanabe
J
Identification of genetically high risk individuals to lung cancer by DNA polymorphisms of the cytochrome P450IAI gene.
FEBS Lett
263
1990
131
7
Hayashi
SI
Watanabe
J
Nakachi
K
Kawajiri
K
Genetic linkage of lung cancer-associated Msp1 polymorphism with amino acid replacement in the heme binding region of the human cytochrome P4501A1 gene.
J Biochem
110
1991
407
8
Cascorbi
I
Brockmöller
J
Roots
I
A C4887A polymorphism in exon 7 of human CYP1A1: Population frequency, mutation linkages, and impact on lung cancer susceptibility.
Cancer Res
56
1996
4965
9
Sachse
C
Brockmöller
J
Bauer
S
Roots
I
Cytochrome P450 2D6 variants in a caucasian population: Allele frequencies and phenotypic consequences.
Am J Hum Genet
60
1997
284
10
Chenevix-Trench
G
Young
J
Coggan
M
Board
P
Glutathione S-transferase M1 and T1 polymorphisms: Susceptibility to colon cancer and age onset.
Carcinogenesis
16
1993
1655
11
Rebbeck
TR
Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility.
Cancer Epidemiol Biomarkers Prev
6
1997
733
12
Zhong
S
Wyllie
AH
Barnes
D
Wolf
CR
Spurr
NK
Relationship between the GSTM1 genetic polymorphism and susceptibility to bladder, breast and colon cancer.
Carcinogenesis
14
1993
1821
13
Alexandrie
AK
Sundberg
MI
Seidegard
J
Tornling
G
Rannug
A
Genetic susceptibility to lung cancer with special emphasis on CYP1A1 and GSTM1: A study on host factors in relation to age at onset, gender, and histological cancer types.
Carcinogenesis
15
1994
1785
14
Rebbeck
T
Rosvold
EA
Duggan
DJ
Zhang
J
Buetow
KH
Genetics of CYP1A1: Coamplification of specific alleles by polymerase chain reaction and association with breast cancer.
Cancer Epidemiol Biomarkers Prev
3
1994
511
15
Warwick
A
Sarhanis
P
Redman
CWE
Pemble
S
Taylor
JB
Ketterer
B
Jones
P
Alldersea
J
Gilford
J
Yengi
L
Fryer
A
Strange
RC
Theta class Glutathione S-transferase GSTT1 genotypes and susceptibility to cervical neoplasia: Interactions with GSTM1, CYP2D6 and smoking.
Carcinogenesis
15
1994
2841
16
Heagerty
A
Smith
A
English
J
Lear
J
Perkins
W
Bowers
B
Jones
P
Gilford
J
Alldersea
J
Fryer
A
Strange
RC
Susceptibility to multiple cutaneous basal cell carcinomas: Significant interactions between glutathione S-transferase GSTM1 genotypes, skin type and male gender.
Br J Cancer
73
1993
44
17
Cosma
G
Crofts
F
Currie
D
Wirgin
I
Toniolo
P
Garte
SJ
Racial differences in restriction fragment length polymorphisms and messenger RNA inducibility of the human CYP1A1 gene.
Cancer Epidemiol Biomarkers Prev
2
1993
53
18
Taioli
E
Crofts
F
Trachman
J
Demopoulos
R
Toniolo
P
Garte
SJ
Racial differences in CYP1A1 genotype and function.
Toxicol Let
77
1995
357
19
Labuda
D
Zietkiewicz
E
Labuda
M
The genetic clock and the age of the founder effect in growing populations: A lesson from French Canadians and Ashkenazim.
Am J Hum Genet
61
1997
768
20
Baccichet
A
Qualman
SK
Sinnett
D
Allelic loss in childhood acute lymphoblastic leukaemia.
Leuk Res
21
1997
817
21
Katoh
T
Nagata
N
Kuroda
Y
Itoh
H
Kawahara
A
Kuroki
N
Ookuma
R
Bell
DA
Glutathione S-transferase M1 (GSTM1) and T1 (GSTT1) genetic polymorphism and susceptibility to gastric and colorectal adenocarcinoma.
Carcinogenesis
9
1996
1855
22
Smith
CAD
Gough
AC
Leigh
PN
Summers
BA
Harding
AE
Maraganore
DM
Sturman
SG
Schapira
AH
Williams
AC
Spurr
NK
Wolf
CR
Debrisoquine hydroxylase gene polymorphism and susceptibility to Parkinson’s disease.
Lancet
339
1992
1375
23
Coughlin
SS
Benichou
J
Weed
DL
Attributable size estimation in case-control studies.
Epidemiol Rev
16
1994
61
24
Lin
HJ
Han
C-Y
Bernstein
DA
Hsiao
W
Lin
BK
Hardy
S
Ethnic distribution of the glutathione Mu 1-1 (GSTM1) null genotype in 1473 individuals and application to bladder cancer susceptibility.
Carcinogenesis
15
1994
1077
25
Nelson
HH
Wiencke
JK
Christiani
DC
Cheng
TJ
Zuo
Z-F
Schwartz
BS
Lee
B-K
Spitz
MR
Wand
M
Xu
X
Kelsey
KT
Ethnic differences in the prevalence of the homozygous deleted genotype of glutathione S-transferase theta.
Carcinogenesis
16
1995
1243
26
Mrozkiewicz
PM
Cascorbi
I
Brockmöller
J
Roots
I
CYP1A1 mutations 4887A, 4889G, 5639C and 6235C in the Polish population and their allelic linkage, determined by peptide nucleic acid-mediated PCR clamping.
Pharmacogenetics
7
1997
303
27
Hallier
E
Schroder
KR
Asmuth
K
Dommermuth
A
Aust
B
Goergens
HW
Arch Toxicol
68
1994
423
28
Pemble
S
Schoeder
KR
Spencer
SR
Meyer
DJ
Hallier
E
Bolt
HM
Ketterer
B
Taylor
JB
Human glutathione S-transferase theta (GSTT1): cDNA cloning and the characterization of a genetic polymorphism.
Biochem J
300
1994
271
29
Awasthi
YC
Singh
SV
Ahmad
H
Moller
PC
Immunocytochemical evidence for the expression of GST1, GST2, and GST3 gene loci for glutathione S-transferase in human lung.
Lung
165
1987
323
30
Chen
CL
Liu
Q
Pui
CH
Rivera
GK
Sandlund
JT
Ribeiro
R
Evans
WE
Relling
MV
Higher frequency of glutathione S-transferase deletions in black children with acute lymphoblastic leukemia.
Blood
89
1997
1701
31
Blumer
JL
Dunn
R
Esterhay
MD
Yamashita
TS
Gross
S
Lymphocyte aromatic hydrocarbon responsiveness in acute leukemia of childhood.
Blood
58
1981
1081
32
Sesardic
D
Pasanen
M
Pelkonen
O
Boobis
AR
Differential expression and regulation of members of the cytochrome P450IA gene subfamily in human tissues.
Carcinogenesis
11
1990
1183
33
Manchester
DK
Jacoby
EH
Sensitivity of human placental monooxygenase activity to maternal smoking.
Clin Pharmacol Ther
30
1981
687
34
Pasanen
M
Pelkonen
O
Human placental xenobiotic and steroid biotransformations catalyzed by cytochrome P450, epoxide hydroxylase and glutathione S-transferase activities and their relationship to maternal cigarette smoking.
Drug Metab Rev
21
1989-1990
427
35
Whyatt
RM
Garte
SJ
Cosma
G
Bell
DA
Jedrychowski
W
Wahrendorf
J
Randall
MC
Cooper
TB
Ottman
R
Tang
D
Tasi
W-Y
Dickey
CP
Manchester
DK
Crofts
F
Perera
FP
CYP1A1 messenger RNA levels in placental tissue as a biomarker of environmental exposure.
Cancer Epidemiol Biomarkers Prev
4
1995
147
36
Hayashi
S
Watanabe
J
Kawajiri
K
High susceptibility to lung cancer analyzed in terms of combined genotypes of P450IAI and Mu-class glutathione S-transferase genes.
Jpn J Cancer Res
83
1992
866
37
Nakachi
K
Imai
K
Hayashi
S
Kawajiri
K
Polymorphisms of the CYP1A1 and glutathione S-transferase genes associated with susceptibility to lung cancer in relation to cigarette dose in a japanese population.
Cancer Res
53
1993
2994
38
Butkiewicz
D
Grzybowska
E
Hemminki
K
Ovrebo
S
Haugen
A
Motykiewicz
G
Chorazy
M
Modulation of DNA adduct levels in human mononuclear white blood cells and granulocytes by CYP1A1, CYP2D6 and GSTM1 genetic polymorphisms.
Mutat Res
415
1998
97
39
Neglia
JP
Robison
LL
Epidemiology of the childhood acute leukemias.
Pediatr Clin North Am
35
1988
675
40
Linet
MS
Devesa
SS
Descriptive epidemiology of childhood leukaemia.
Br J Cancer
63
1991
424
41
Whyatt
RM
Perera
FP
Application of biologic markers to studies of environmental risks in children and the developing fetus.
Environ Health Perspect
103
1995
105
42
Severson
RK
Buckley
JD
Woods
WG
Benjamin
D
Robison
LL
Cigarette smoking and alcohol consumption by parents of children with acute myeloid leukemia: An analysis within morphological subgroups—A report from the childrens cancer group.
Cancer Epidemiol Biomarkers Prev
2
1993
433
43
Lowengart
RA
Peters
JM
Cicioni
C
Buckley
J
Bernstein
L
Preston-Martin
S
Rappaport
E
Childhood leukemia and parents’ occupational and home exposures.
J Natl Cancer Inst
79
1987
39
44
Leiss
JK
Savitz
DA
Home pesticide use and childhood cancer: A case-control study.
Am J Public Health
85
1995
249
45
Daniels
JL
Olshan
AF
Savitz
DA
Pesticides and childhood cancers.
Environ Health Perspect
105
1997
1068
46
Buckley
JD
Buckley
CM
Ruccione
K
Sather
HN
Waskerwitz
MJ
Woods
WG
Robison
LL
Epidemiological characteristics of childhood acute lymphocytic leukemia. Analysis by immunophenotype. The childrens’ cancer group.
Leukemia
8
1994
856
47
Perera
FP
Environment and cancer: Who are susceptible?
Science
278
1997
1068
48
Hakkola
J
Pelkonen
O
Pasanen
M
Raunio
H
Xenobiotic-metabolizing cytochrome P450 enzymes in the human feto-placental unit: Role in intrauterine toxicity.
Crit Rev Toxicol
28
1998
35
49
Juchau
MR
Drug biotransformation in the placenta.
Pharcol Ther
8
1980
501
50
Hernandez
JA
Land
KJ
McKenna
RW
Leukemias, myeloma, and other lymphoreticular neoplasms.
Cancer
75
1995
381
(suppl)
51
Chessells
JM
Richards
SM
Bailey
CC
Lilleyman
JS
Eden
OB
Gender and treatment outcome in childhood lymphoblastic leukaemia: Report from the MRC UKALL trials.
Br J Haematol
89
1995
364
52
Sandler
DP
Ross
JA
Epidemiology of acute leukemia in children and adults.
Semin Oncol
24
1997
3
53
Fujita
I
Sindhu
RK
Kikkawa
Y
Hepatic cytochrome P450 enzyme imprinting in adult rat by neonatal benzo[a]pyrene administration.
Pediatr Res
37
1995
646
54
Zaphiropoulos
PG
Mode
A
Norstedt
G
Gustafsson
JA
Regulation of sexual differentiation in drug and steroid metabolism.
Trends Pharmacol Sci
10
1989
149

Author notes

Address reprint requests to Daniel Sinnett, PhD, Centre de Cancérologie Charles Bruneau, Hôpital Sainte-Justine, 3175 Côte Ste-Catherine, Montréal, Québec, H3T 1C5 Canada; e-mail: sinnettd@ere.umontreal.ca.