Abstract

Rearranged IGH genes were detected by Southern blotting in 22% of 118 cases of T-cell acute lymphoblastic leukemia (ALL) and involved monoallelic and biallelic rearrangements in 69% (18/26) and 31% (8/26) of these cases, respectively. IGH gene rearrangements were found in 19% (13/69) of CD3 T-ALL and in 50% of TCRγδ+ T-ALL (12/24), whereas only a single TCRβ+ T-ALL (1/25) displayed a monoallelicIGH gene rearrangement. The association with the T-cell receptor (TCR) phenotype was further supported by the striking relationship between IGH and TCR delta (TCRD) gene rearrangements, ie, 32% of T-ALL (23/72) with monoallelic or biallelicTCRD gene rearrangements had IGH gene rearrangements, whereas only 1 of 26 T-ALL with biallelic TCRD gene deletions contained a monoallelic IGH gene rearrangement. Heteroduplex polymerase chain reaction (PCR) analysis with Vh and Dh family-specific primers in combination with a Jhconsensus primer showed a total of 39 clonal products, representing 7 (18%) Vh-(Dh-)Jh joinings and 32 (82%) Dh-Jh rearrangements. Whereas the usage of Vh gene segments was seemingly random, preferential usage of Dh6-19 (45%) and Dh7-27 (21%) gene segments was observed. Although the Jh4 and Jh6 gene segments were used most frequently (33% and 21%, respectively), a significant proportion of joinings (28%) used the most upstream Jh1 and Jh2 gene segments, which are rarely used in precursor-B-ALL and normal B cells (1% to 4%). In conclusion, the high frequency of incomplete Dh-Jh rearrangements, the frequent usage of the more downstream Dh6-19 and Dh7-27 gene segments, and the most upstream Jh1 and Jh2 gene segments suggests a predominance of immature IGH rearrangements in immature (non-TCRβ+) T-ALL as a result of continuing V(D)J recombinase activity. More mature β-lineage T-ALL with biallelic TCRD gene deletions apparently have switched off their recombination machinery and are less prone to cross-lineageIGH gene rearrangements. The combined results indicate thatIGH gene rearrangements in T-ALL are postoncogenic processes, which are absent in T-ALL with deleted TCRD genes and completed TCR alpha (TCRA) gene rearrangements.

WHEN REARRANGED Ig and T-cell receptor (TCR) genes were found to be useful clonal leukemia-specific markers, they were initially considered to be lineage-specific.1,2However, the recognition of abnormal TCR gene rearrangements in precursor-B-acute lymphoblastic leukemia (ALL) and in some mature B-cell malignancies together with the finding of rearranged Ig heavy chain (IGH) genes in some T-ALL raised the question of lineage infidelity or promiscuity.2,3 TCR gene rearrangements in precursor-B-ALL were observed in 60% to 80% of patients, indicating that these recombinations should rather be regarded as an ubiquitously occurring (cross-lineage) phenomenon in this type of B-cell malignancy.4-7 In a recent study on 202 precursor-B-ALL patients, we even found cross-lineage TCR gene rearrangements in 93% of the patients.8 The occurrence of cross-lineage rearranged TCR genes is related to the maturation stage, being significantly lower in immature CD10 precursor-B-ALL as compared with CD10+ precursor-B-ALL.8,9Analogous to the hierarchical order during early T-cell development, rearrangements and/or deletions in the TCR delta (TCRD) locus occur most frequently (89% of patients), followed by TCR gamma (TCRG) (59%) and TCR beta (TCRB) (35%) gene rearrangements.4-6,8 Furthermore, most TCRB gene rearrangements are restricted to the Jβ2 locus, the majority ofTCRG gene rearrangements involve the Jγ1 gene segments, and a striking predominance of incomplete Vδ2-Dδ3 and Dδ2-Dδ3 rearrangements in the TCRD locus is observed.4-11 

In contrast to the high frequency of cross-lineage TCR gene recombinations in precursor-B-ALL, IGH gene rearrangements in T-ALL are relatively rare. In a meta-analysis of previously reported small patient groups, the prevalence of rearranged IGH genes was estimated at 10% to 15% of lymphoblastic T-cell malignancies.11 All early studies were exclusively based on Southern blotting (SB), and at that time, the configuration ofIGH diversity (D) regions was not completely known. Therefore, it was not possible to reliably discern between incomplete Dh-Jh and complete Vh-(Dh-)Jh gene rearrangements and to identify cross-lineage IGH gene rearrangement patterns, which are characteristic for T-ALL.11,12 The only consistent finding was that a significant proportion of IGH rearrangements in human leukemic T cells involved the Dh7-27 (DQ52) gene segment, which is located immediately upstream of the Jhregion (Fig 1).13,14 

Fig. 1.

Schematic representation of the human IGH locus on chromosome 14q32.3. The IGH gene complex consists of numerous (>120) V gene segments, 27 D gene segments, 6 functional J gene segments, and C gene segments for the constant domains of the various IgH classes and subclasses, most of which are preceded by switch sequences (s).23,28,52,53 Pseudogenes are represented as open bars. The 27 Dh gene segments are grouped in 7 families based on sequence homology. Members of the same Dh family are depicted with the same shading pattern.

Fig. 1.

Schematic representation of the human IGH locus on chromosome 14q32.3. The IGH gene complex consists of numerous (>120) V gene segments, 27 D gene segments, 6 functional J gene segments, and C gene segments for the constant domains of the various IgH classes and subclasses, most of which are preceded by switch sequences (s).23,28,52,53 Pseudogenes are represented as open bars. The 27 Dh gene segments are grouped in 7 families based on sequence homology. Members of the same Dh family are depicted with the same shading pattern.

To study cross-lineage IGH gene rearrangements in T-ALL in detail, we analyzed a large group of 118 T-ALL patients by Southern blotting to determine the precise incidence of rearranged IGHgenes. Heteroduplex polymerase chain reaction (PCR) analysis and subsequent sequencing were applied to identify the rearrangedIGH gene segments as well as the junctional regions of the rearrangements. In addition to Vh family-specific primers and a Jh consensus primer, we designed a new set of Dhfamily-specific primers to detect and identify all complete Vh-Jh and incomplete Dh-Jh gene rearrangements.

MATERIALS AND METHODS

Cell samples.

Peripheral blood (PB) or bone marrow (BM) samples from 118 T-ALL patients (84 children and 34 adults) were obtained at initial diagnosis.7,15 Mononuclear cells (MNC) were isolated from PB or BM samples by Ficoll-Paque centrifugation (density, 1.077 g/mL; Pharmacia, Uppsala, Sweden) and subjected to detailed immunophenotyping according to standard protocols.16,17 To analyze sufficient numbers of CD3+ T-ALL (especially TCRγδ+T-ALL), we selected T-ALL cell samples based on their CD3/TCR immunophenotype, resulting in 69 CD3 T-ALL (58% of the total series), 25 TCRαβ+ T-ALL (21%), and 24 TCRγδ+ T-ALL (20%). In an entirely random series of T-ALL, this immunophenotype distribution would approximately be 70%, 20%, and 10%, respectively.18 Although in 2 CD3+ T-ALL cases no information about TCR protein expression was available, they were included into the TCRγδ+ T-ALL group based on the Southern blot finding of biallelic TCRD rearrangements in both cases.

Southern blot analysis.

DNA was isolated from fresh or frozen MNC fractions as described previously.2 Fifteen micrograms of DNA was digested with the appropriate restriction enzymes (Pharmacia), size-separated in 0.7% agarose gels, and transferred to Nytran-13N nylon membranes (Schleicher and Schuell, Dassel, Germany), as described.2,19,IGH gene configuration was analyzed in the 118 T-ALL patients with the IGHJ6 probe (DAKO Corp, Carpinteria, CA) in Bgl II, BamHI/HindIII,EcoRI, and/or HindIII digests.20 The configuration of the TCRD genes was analyzed in 101 of 118 patients with the TCRDV2, TCRDD2, TCRDJ1, TCRDJ2, TCRDJ3, TCRDRE, and TCRAPJ probes (DAKO Corp) in Bgl II, EcoRI, andHindIII digests.15 

Primer design and heteroduplex PCR analysis.

PCR was essentially performed as described previously.7,19In each 50 μL PCR reaction, 50 ng DNA sample, 6.3 pmol of the 5′ and 3′ oligonucleotide primers, and 0.5 U AmpliTaq Gold polymerase (PE Biosystems, Foster City, CA) were used. The sequences of the oligonucleotides used for amplification of complete Vh-Jh gene rearrangements (6 IGH framework-1 Vh-family specific primers, and 1 Jh consensus primer) were published before.21,22 Based on recently published data of germline DNA D-region sequences of the human IGHlocus23 (EMBL accession no. X97051; for the detailed organization of the IGH D-region, see Fig 1), 7 family-specific Dh primers were designed using OLIGO 6.0 software (Dr W. Rychlik, Molecular Biology Insights, Inc, Plymouth, MN) applying previously described guidelines (Table1).24 Oligonucleotide primers of 22 to 24 bp were positioned at least 50 bp upstream of the involved recombination signal sequence (RSS). Secondary structures such as primer dimers and hairpins were avoided, and the melting temperature (Tm) was 68°C ± 3°C. All primers were synthesized on an ABI 392 DNA synthesizer (PE Biosystems) using the solid-phase phosphotriester method.

Table 1.

Forward Primers Developed for PCR and Sequence Analysis of Incomplete Dh-Jh Gene Rearrangements

Primer Code Size of Primer (bp) Position in bp*Sequence (5′ → 3′)
Dh1  22  −79 A(C/T)CCAGGAGGCCCCAGAGC(A/T)CA  
Dh2  24 −187  CAGCACTGGGCTCAGAGTCCTCTC  
Dh3  24 −109  CCTCCTC(A/C)GGTCAGCCC(C/T)GGACAT  
Dh24  −129  CCCAGGACGCAGCACC(A/G)CTGTCAA  
Dh23  −245  ACCCAGCCTCCTGCTGACCAGAG  
Dh22  −144  CAGGCCCCCCA(A/G)AACCAG(T/G)G(A/T)T 
Dh7  24  −181 GGGCTGGGGTCTCCCACGTGTTTT 
Primer Code Size of Primer (bp) Position in bp*Sequence (5′ → 3′)
Dh1  22  −79 A(C/T)CCAGGAGGCCCCAGAGC(A/T)CA  
Dh2  24 −187  CAGCACTGGGCTCAGAGTCCTCTC  
Dh3  24 −109  CCTCCTC(A/C)GGTCAGCCC(C/T)GGACAT  
Dh24  −129  CCCAGGACGCAGCACC(A/G)CTGTCAA  
Dh23  −245  ACCCAGCCTCCTGCTGACCAGAG  
Dh22  −144  CAGGCCCCCCA(A/G)AACCAG(T/G)G(A/T)T 
Dh7  24  −181 GGGCTGGGGTCTCCCACGTGTTTT 
*

The position of the 5′ end of the primer is indicated upstream (−) relative to the 3′ RSS of the involved Dh gene segment.

PCR conditions were initial denaturation for 3 minutes at 92°C, followed by 35 cycles of 45 seconds at 92°C, 90 seconds at 60°C, and 2 minutes at 72°C using a Perkin-Elmer 480 thermal cycler (PE Biosystems). After the last cycle, an additional extension step of 10 minutes at 72°C was performed. Appropriate positive and negative controls were included in all experiments.24 

Heteroduplex analysis of PCR products included denaturation at 94°C for 5 minutes after the final cycle of amplification and subsequent renaturation at 4°C for 60 minutes to induce duplex formation.25 Afterwards, the duplexes were immediately loaded on 6% nondenaturing polyacrylamide gels in 0.5× Tris-boric acid-EDTA (TBE) buffer, run at room temperature, and visualized by ethidium bromide staining.25 A 100-bp DNA ladder (Promega Corp, Madison, WI) was used as size marker.

Sequence analysis of IGH gene rearrangements.

PCR products found to be clonal by heteroduplex analysis were directly sequenced except for cases in which heteroduplex PCR analysis showed more than two clonal bands, ie, either two homoduplexes, or an additional upper band resulting from extension to downstream Jh segments, or a Dh7-27-Jh1 germline band accompanying a Dh7-27-Jh rearrangement. In such cases, homoduplexes were excised from the polyacrylamide gel and eluted as described before.26,27 The eluted PCR products were either directly sequenced or subjected to second-step PCR with the same primer pair to increase the amount of template for sequence analysis. Sequencing was performed using the dye-terminator cycle sequencing kit with AmpliTaq DNA polymerase FS on an ABI 377 sequencer (PE Biosystems). Briefly, 50 to 200 ng of PCR product and 3.2 pmol primer were used in a 15 μL reaction volume. The cycling protocol was 96°C for 30 seconds, followed by 60°C for 4 minutes for a total of 25 cycles. Each PCR product was sequenced in two directions.

Interpretation of sequence data.

Vh, Dh, and Jh segments were identified using DNAPLOT software (W. Müller, H-H. Althaus, University of Cologne, Cologne, Germany) by searching for homology with all known human germline Vh, Dh, and Jh sequences obtained from the VBASE directory of human Ig genes (http://www.mrc-cpe.cam.ac.uk/imt-doc/).28 For alignments of D segments in Vh-Dh-Jh or Dh-Dh-Jh rearrangements, it was necessary to have at least 10 consecutive matching nucleotides.23Palindromic (P-region) nucleotides (maximally 2) generated during the joining process were recognized as being palindromic to the juxtaposed nucleotides of an untrimmed rearranged gene segment.29Extensive N-regions (nucleotides that cannot be assigned to V, D, J gene segments, or P-regions) were analyzed in more detail by comparing them to the most recent update of GenBank using the BLAST sequence similarity-searching tool (National Center for Biotechnology Information; http://www.ncbi.nlm.nih.gov/BLAST/).30 

RESULTS

Southern blot analysis of IGH gene rearrangements in T-ALL.

IGH gene rearrangements were found in 22% (26/118) of T-ALL patients and were equally distributed between the different age groups, ie, 23% (19/84) of children and 21% (7/34) of adults. In the majority of cases, this concerned monoallelic rearrangements (69% [18/26]), and in 31% (8/26) biallelic rearrangements were observed. In 2 of these patients, SB analysis showed weak bands, most probably derived from subclones. Cross-lineage IGH gene rearrangements were found in 19% (13/69) of CD3 T-ALL and in 50% of TCRγδ+ T-ALL (12/24), whereas only a single TCRαβ+ T-ALL (4% [1/25]) displayed a rearrangedIGH gene on one allele.

IGH gene rearrangements coincide with TCRD gene rearrangements.

Because CD3 T-ALL theoretically represent precursor stages of both TCRαβ+ and TCRγδ+ T-ALL, we analyzed the configuration of the TCRD genes in 57 CD3 T-ALL cases and used it as an additional marker for further subdivision of this group.15,18 TheTCRD gene configuration of each allele can potentially pass three consecutive stages: germline, rearrangement, and deletion.15,18 Except for 1 case, all IGH gene rearrangements were found in patients with at least one TCRDgene rearrangement; in this single CD3 T-ALL, a monoallelic IGH gene rearrangement was observed in combination with deletion of both TCRD alleles.

Based on the above-described results, we analyzed the association of cross-lineage IGH gene rearrangements and TCRD gene configuration for 101 of the 118 T-ALLs. Rearrangements in the IGHlocus appeared to be almost exclusively associated with TCRDgene rearrangements. They were evenly distributed between cases with 1 rearranged and 1 germline TCRD allele (1 of 3 cases [33%]), cases with biallelic TCRD rearrangements (15 of 47 cases [32%]), and cases with 1 rearranged and 1 deleted TCRDallele (7 of 22 cases [32%]). Remarkably, only 1 of 26 cases with biallelically deleted TCRD genes (4%) displayed a cross-lineage IGH gene rearrangement.

Taking these data together, cross-lineage IGH gene rearrangements occurred in only 5% (2/38) of αβ-lineage T-ALL, ie, either TCRαβ+ T-ALL (n = 25) or CD3T-ALL with biallelic TCRD deletion (n = 13).

Complete Vh-(Dh-)Jh and incomplete Dh-Jh rearrangements.

Detailed PCR analysis of the IGH locus in the 26 patients with Southern blot documented IGH gene rearrangements was based on 13 primer combinations covering the vast majority of complete Vh-(Dh-)Jh joinings and potentially all incomplete Dh-Jh rearrangements. Heteroduplex PCR analysis showed a total of 39 clonal homoduplexes, reflecting 7 (18%) complete Vh-(Dh)-Jh joinings and 32 (82%) incomplete Dh-Jh rearrangements. Complete Vh-(Dh)-Jh rearrangements were found in 4 CD3 T-ALL and 2 TCRγδ+ T-ALL patients, with 1 TCRγδ+ T-ALL showing biallelic Vh-(Dh-)Jh joinings. Heteroduplex PCR analysis for incomplete Dh7-27-Jh rearrangements is shown in Fig 2.

Fig. 2.

Heteroduplex PCR analysis of Dh7-27-Jhcross-lineage rearrangements in T-ALL. Subsequent to agarose gel electrophoresis, samples containing PCR products were subjected to heteroduplex PCR analysis, separated in a 6% polyacrylamide gel, and visualized by ethidium bromide staining. Based on the size of clonal PCR products, Dh7-27-Jh rearrangements (∼250 bp) were identified in T-ALL patients T009, T038, T042, T062, T150, and T184 as well as in a T-cell prolymphocytic leukemia (T-PLL). In addition to homoduplexes resulting from Dh7-27-Jhrearrangement, the germline Dh7-27-Jh1 and Dh7-27-Jh2 homoduplexes were consistently present, except for cases with biallelic IGH rearrangements and a very high tumor load (ie, patient T150). To obtain a clonal sequence of Dh7-27-Jh rearrangements, homoduplexes of the correct size were excised from the polyacrylamide gel, eluted, and sequenced. ss, single-strand DNA.

Fig. 2.

Heteroduplex PCR analysis of Dh7-27-Jhcross-lineage rearrangements in T-ALL. Subsequent to agarose gel electrophoresis, samples containing PCR products were subjected to heteroduplex PCR analysis, separated in a 6% polyacrylamide gel, and visualized by ethidium bromide staining. Based on the size of clonal PCR products, Dh7-27-Jh rearrangements (∼250 bp) were identified in T-ALL patients T009, T038, T042, T062, T150, and T184 as well as in a T-cell prolymphocytic leukemia (T-PLL). In addition to homoduplexes resulting from Dh7-27-Jhrearrangement, the germline Dh7-27-Jh1 and Dh7-27-Jh2 homoduplexes were consistently present, except for cases with biallelic IGH rearrangements and a very high tumor load (ie, patient T150). To obtain a clonal sequence of Dh7-27-Jh rearrangements, homoduplexes of the correct size were excised from the polyacrylamide gel, eluted, and sequenced. ss, single-strand DNA.

Sequence analysis confirmed monoclonality in 7 complete Vh-(Dh-)Jh rearrangements, which involved 7 different gene segments from 4 families: Vh1-3, Vh1-69, Vh3-13, Vh3-23, Vh3-33, Vh4-4, and Vh6-1. None of the rearrangements was potentially functional. Six sequences were out-of-frame joinings, whereas the single rearrangement with an in-frame Vh-Jh contained a stop codon in the junctional region.

Dh6-19 and Dh7-27 are preferentially used in IGH gene rearrangements in T-ALL.

Sequence analysis of the junctional regions of complete Vh-(Dh-)Jh recombinations allowed identification of a D segment in 5 of 7 joinings. Moreover, 1 incomplete rearrangement was of the Dh-Dh-Jhtype. The frequencies of different Dh family members found among the 38 identified Dh sequences in the complete and incomplete cross-lineage IGH gene rearrangements are summarized in Table 2. Usage of the Dh6 family was most prominent (47%), with the Dh6-19 gene segment being preferentially used (45% of all identified Dhsequences; Table 3). The second most frequently used Dh segment was Dh7-27 (21%). Seven rearrangements (18%) contained Dh segments of the Dh1 family, whereas 5 other rearrangements used various segments of the remaining 4 Dh families (Table 2). Taken together, only 5 of the 38 rearranged Dh segments belonged to the most upstream part of the Dh region, whereas all other 33 Dh gene segments (87%) belonged to the most downstream part of the Dh region (Table 2). No relationship between age and Dh gene segment usage was observed.

Table 2.

Usage of Different Dh Families in (In)complete Cross-Lineage IGH Gene Rearrangements in T-ALL

New Family Name*Old Family Name*No. (frequency) of Rearrangements Segments Used
DhDM  7 (18%)  Dh1-7: 2 
   Dh1-20: 2 
   Dh1-26: 3  
Dh2  DLR 1 (3%)  Dh2-2: 1  
Dh3  DXP 1 (3%)  Dh3-22: 1  
Dh4  DA 2 (5%)  Dh4-4: 1 
   Dh4-23: 1  
Dh5  DK 1 (3%)  Dh5-18: 1  
Dh6  DN 18 (47%)  Dh6-6: 1 
   Dh6-19: 17  
Dh7  DQ52 8 (21%)  Dh7-27: 8 
New Family Name*Old Family Name*No. (frequency) of Rearrangements Segments Used
DhDM  7 (18%)  Dh1-7: 2 
   Dh1-20: 2 
   Dh1-26: 3  
Dh2  DLR 1 (3%)  Dh2-2: 1  
Dh3  DXP 1 (3%)  Dh3-22: 1  
Dh4  DA 2 (5%)  Dh4-4: 1 
   Dh4-23: 1  
Dh5  DK 1 (3%)  Dh5-18: 1  
Dh6  DN 18 (47%)  Dh6-6: 1 
   Dh6-19: 17  
Dh7  DQ52 8 (21%)  Dh7-27: 8 
*

The new nomenclature is derived from Corbett et al,23whereas the old nomenclature is according to Ichihara et al.51 

Table 3.

Junctional Region Sequences of Oligoclonal IGHGene Rearrangements in a T-ALL Patient (T061) Illustrating the Ongoing Recombination Process

No. Upstream Vh Segment N- and P-Nucleotides3-150Dh6-19 N- and P-Nucleotides3-150Jh Gene Segments
1.  —    GGGTATAGCAGTGGCTGGT  (−2)  TTTTCTTCTA (−6)  Jh6c  
2.  Vh1-03 (0) TAGT  (−2)  GTATAGCAGTGGCTGGT  (−2)  TTTTCTTCTA  (−6)  Jh6c  
3. Vh3-33 (−1)  TAAGGGTGTGATGTGTTTTGTGGA  (−11) TGGCTGGTAC  (0)  GAGGCTGGCAGGGGGA  (−14) Jh6b 
No. Upstream Vh Segment N- and P-Nucleotides3-150Dh6-19 N- and P-Nucleotides3-150Jh Gene Segments
1.  —    GGGTATAGCAGTGGCTGGT  (−2)  TTTTCTTCTA (−6)  Jh6c  
2.  Vh1-03 (0) TAGT  (−2)  GTATAGCAGTGGCTGGT  (−2)  TTTTCTTCTA  (−6)  Jh6c  
3. Vh3-33 (−1)  TAAGGGTGTGATGTGTTTTGTGGA  (−11) TGGCTGGTAC  (0)  GAGGCTGGCAGGGGGA  (−14) Jh6b 
F3-150

Underlined nucleotides represent P-nucleotides.

The sizes of the Dh-Jh junctional regions ranged from 0 to maximally 32 nucleotides, with an average of 7.6 nucleotides. Three of 37 Dh-Jh junctions (8%) did not have any randomly inserted N-region nucleotides. P-nucleotides, indicating the absence of deletion, were present in 7 Dh-Jh joinings (19%).

Usage of Jh gene segments in cross-lineage IGH gene rearrangements.

The frequencies of different Jh gene segments in IGHgene rearrangements in T-ALL are summarized in Table 4. The Jh4 gene segment was found most frequently in approximately one third of joinings, followed by Jh6 in 20% of cases. The remaining 4 Jh segments were almost equally used, each comprising 10% to 15% of the rearrangements.

Table 4.

Usage of Different Jh Gene Segments in Incomplete and Complete Cross-Lineage IGH Gene Rearrangements in T-ALL as Compared With Precursor-B-ALL, Human BM Precursor-B Cells, and PB B Lymphocytes

Jh Segment T-ALL (n = 39)PrecursorB-ALL Human BM Precursor-B Cells Human PB B Lymphocytes
Jh1  13% (5)  2%  0% 1%  
Jh2  15% (6)  2%  4%  0% 
Jh3  10% (4)  11%  14%  9% 
Jh4  33% (13)  32%  32%  53% 
Jh5  8% (3)  22%  17%  15% 
Jh6  21% (8)  32%  33%  22% 
Jh Segment T-ALL (n = 39)PrecursorB-ALL Human BM Precursor-B Cells Human PB B Lymphocytes
Jh1  13% (5)  2%  0% 1%  
Jh2  15% (6)  2%  4%  0% 
Jh3  10% (4)  11%  14%  9% 
Jh4  33% (13)  32%  32%  53% 
Jh5  8% (3)  22%  17%  15% 
Jh6  21% (8)  32%  33%  22% 

The B-lineage data were obtained in comparable PCR-based studies by Steenbergen et al37 for precursor-B-ALL, by Raaphorst et al36 for human BM precursor-B cells, and by Yamada et al35 for human blood B lymphocytes.

Oligoclonality in cross-lineage IGH gene rearrangements in T-ALL.

SB analysis and heteroduplex PCR analysis showed fully concordant results in 20 of 26 cases with cross-lineage IGH gene rearrangements in T-ALL. In 1 case with a single rearranged band on SB, we were not able to amplify the clonal rearrangement with the applied primer sets. In the remaining 5 cases, the number of clonal PCR-detected homoduplexes was higher than the number of rearranged bands in SB, which may suggest the presence of minor subclones undetectable by SB. In 1 of these seemingly oligoclonal cases, the identified incomplete and complete rearrangements (1 and 2 in Table 3) shared the same Dh-Jh fragment, suggesting ongoing Vh to Dh-Jh joining. In 4 other patients, the detected rearrangements were not related in their used gene segments. This may reflect secondary Dh-Jh joining, with concomitant deletion of a pre-existing Dh-Jhrearrangement.

Based on the combined SB/PCR results, we found evidence for IGHoligoclonality at diagnosis in 27% (7/26) of T-ALL patients with this type of cross-lineage recombination. This includes the above-mentioned 5 cases with the higher number of PCR-detected homoduplexes than the number of rearranged bands in SB, and 2 additional PCR-positive cases with weak bands on SB analysis, apparently derived from subclones.20 

DISCUSSION

We investigated a large group of 118 T-ALL patients for the presence of cross-lineage IGH gene rearrangements. Based on SB analysis, we identified such rearrangements in 22% of T-ALL, which is slightly higher than previously reported.11,12 The vast majority (82%) of IGH gene rearrangements in T-ALL concerned incomplete Dh-Jh joinings. However, complete Vh-(Dh-)Jh recombinations were also documented in our group of T-ALL patients. The usage of Vhgene segments was seemingly random and not limited to the ones most proximal to the Jh cluster. Nevertheless, 6 of 7 involved Vh gene segments were derived from the proximal 3′ portion of the IGH locus, a pattern that is seen in first trimester fetal Vh-(Dh)-Jhrearrangements.31 None of the seven Vh-(Dh-)Jh rearrangements was potentially functional. To our knowledge, this is the first extensive evidence for the occurrence of clonal complete IGH gene rearrangements in T-ALL. They were previously reported in a single case of T-lymphoblastic non-Hodgkin’s lymphoma, which is the lymphomatous counterpart of T-ALL.32 

In both the Vh-(Dh-)Jh and Dh-Jh rearrangements, we found a strikingly preferential usage of the more downstream Dh gene segments (87% of identified Dh sequences), especially Dh6-19 (45%) and Dh7-27 (21%). The Dh6-19 gene segment is one of the gene segments that were recently discovered thanks to complete sequencing of the Dh region.23Retrospective analysis of nearly 900 IGH junctional regions of B-lineage cells showed Dh6-19 involvement in approximately 5% of the rearrangements, which is significantly higher than would be expected on a random basis.23 The same holds true for 8 other Dh segments, but 6 of them were not found in our T-ALL patients. The preferential usage of Dh6-19 could not be explained by a more optimal RSS at the 3′ end in comparison to other Dh segments, either. Further studies are needed to define whether this gene segment is also preferentially rearranged in precursor-B cells or whether this finding only relates to the cross-lineage phenomenon in T-ALL. In contrast to Dh6-19, earlier reports indicated that the Dh7-27 gene segment is involved in a significant proportion of IGH gene rearrangements in T-ALL.13,14 Interestingly, we also found this gene segment in a cross-lineage IGH gene rearrangement of a TCRαβ+ T-prolymphocytic leukemia (Fig 2). The Dh7-27 gene segment is also preferentially used by fetal B cells but is rarely observed in adult BM and PB.33-36 In the analysis of nearly 900 IGH junctional regions of B-lineage cells, Dh7-27 was found in only 0.5% of the rearrangements.23 Because Dh7-27 consists of only 11 nucleotides, it is more difficult to identify this gene segment in a junctional region after moderate trimming during V(D)J recombination, if stringent assignment criteria are used.

The analysis of Jh segment usage showed a more frequent use of Jh4 and Jh6 gene segments, which is also the case in normal and leukemic B-lineage cells (Table 4).35-37However, in our T-ALL group, a significant proportion of joinings involved the most upstream Jh1 and Jh2 gene segments (28%), which are rarely used by B lymphocytes (∼1%) and B-cell precursors (3% to 4%).35-37 In conclusion, the high frequency of incomplete Dh-Jh rearrangements together with the frequent usage of the more downstream Dhgene segments and the most upstream Jh1 and Jh2 gene segments suggest a predominance of the most immature IGHrearrangements in T-ALL. This particular Dh-Jhrearrangement pattern appears to be nonrandom and is not comparable with any known stage of B-cell ontogeny or B-cell differentiation.31 

Because the types of preferential IGH gene rearrangements have now been identified, it would be relatively easy to screen T-ALL patients for the presence of cross-lineage IGH gene rearrangements and apply them as PCR targets for monitoring of minimal residual disease (MRD) in T-ALL. Three primer combinations (Dh1, Dh6, and Dh7 in combination with a Jh consensus primer) can identify 85% of incomplete Dh-Jh rearrangements in T-ALL. However, we observed oligoclonality in the IGH locus in 27% of T-ALL patients with rearranged IGH genes. In 1 case, we found evidence for continuing Vh to Dh-Jh recombination, whereas Vh replacements have been described previously during disease progression of a T-lymphoblastic lymphoma.32Secondary rearrangements via continuing Vh to Dh-Jh joining, Vh gene replacements, and de novo IGH gene rearrangements have been reported for precursor-B-ALL.38-40 These processes may lead to the emergence of clones with secondary IGH rearrangements. In a previous study, we compared the IGH gene rearrangement patterns between diagnosis and relapse in 40 ALL patients and found that at least one major IGH rearrangement was stable in most cases.41 Therefore, cross-lineage IGH gene rearrangements might be useful as supplementary MRD target in addition to leukemia-specific TCRG and TCRD gene rearrangements and TAL1 gene deletions.24,42 

Cross-lineage IGH gene rearrangements occurred most frequently in TCRγδ+ T-ALL (50% of patients) and in 20% of CD3 T-ALL, but we found them in a single case of TCRαβ+ T-ALL (4%). Moreover, there was a striking association between the presence of rearranged TCRD genes and the occurrence of IGH recombination. A similar association was previously found for cross-lineage gene rearrangements in acute myeloid leukemia, suggesting that TCRD and IGHgenes are concomitantly accessible for V(D)J recombinase in early hematopoietic precursors.43 Furthermore, in the genotypically most mature T-ALL subgroup with biallelic TCRDgene deletions, an IGH gene rearrangement was observed in only 1 of 26 cases. Because IGH gene rearrangements are also rare in mature T-cell malignancies (∼5%),11 this suggests that the IGH locus may be accessible to V(D)J recombinase activity only in cells at earlier stages of T-cell differentiation. In this context, TCRγδ+ T-ALL should be regarded as cells that branched off T-cell development at an early stage of completion ofTCRD and TCRG gene rearrangement processes, when the recombinase activity is still retained.18 

Incomplete Dh-Jh rearrangements are one of the earliest events during normal B-cell development and are already found in CD34+/CD19/CD10+precursor cells.44,45 Most of the more mature CD34+/CD19+/CD10+ B-lineage precursors contain at least 1 Dh-Jh rearranged allele and frequently also complete Vh-(Dh-)Jhrearrangements.45,46 One could therefore speculate that cross-lineage IGH gene rearrangements in T-ALL might reflect malignant transformation of a thymocyte derived from a CD34+/CD19/CD10+ precursor cell with rearranged IGH genes. This idea may be supported by a murine model, in which IGH rearrangements were only found at an intermediate stage of thymocyte development.47Nevertheless, this phenomenon was not observed in normal human thymocytes.44 Furthermore, the absence of D-J-Cμ transcripts in fetal human thymocytes depleted of CD34+- and/or CD19+-bearing cells suggest that Dh-Jh rearrangements in humans may be restricted to normal B-lineage differentiation.44,48 It has also been suggested that IGH gene rearrangements in T-cell precursors may be an aberrant event directing cells into apoptotic pathway, unless they become immortalized by malignant transformation.3 An alternative explanation could be that cross-lineage IGH gene rearrangements in T-ALL are postoncogenic events resulting from the ongoing activity of the common B- and T-cell V(D)J recombinase system on accessible gene loci.3,49,50 We favor the last hypothesis, because this would explain the virtual absence ofIGH gene rearrangements in normal thymocytes and mature T-cell malignancies on the one hand and the presence of IGHoligoclonality and secondary Vh-(Dh-)Jh rearrangements in T-ALL on the other hand.41 The virtual absence of IGHgene rearrangements in αβ-lineage T-ALL with biallelic TCRDgene deletions suggests that the recombination system is not active in this more mature type of T-ALL. Apparently, the recombinational activity is switched off as soon as the rearrangement and deletion processes in the TCRA/TCRD locus are completed.

ACKNOWLEDGMENT

The authors thank Drs K. Hählen, I.M. Appel, R.M. Egeler, F.G.A.J. Hakvoort-Cammel, W.J.D. Hofhuis, G.E. van Zanen, B. Löwenberg, P. Sonneveld, G. J. Ossenkoppele, G.J. Schuurhuis, G. Verhoef, Ph. Vandekerckhove, M. Stul, E.J. Petersen, A.W. Dekker, D. Campana, J.C. Kluin-Nelemans, W-D. Ludwig, and C.E. van der Schoot and the Dutch Childhood Leukemia Study Group (DCLSG) for kindly providing T-ALL cell samples. Board members of the DCLSG are I.M. Appel, H. van den Berg, J.P.M. Bökkerink, M.C.A. Bruin, J.J. Groot-Loonen, S.S.N. de Graaf, K. Hählen, P.M. Hoogerbrugge, W.A. Kamps, F.A.E. Nabben, J.A. Rammeloo, T. Revesz, A.Y.N. Schouten-van Meeteren, A.J.P. Veerman, M. van Weel-Sipman, and R.S. Weening. We are grateful to Prof Dr R. Benner, Prof Dr D. Sońta-Jakimczyk, and Dr H Hooijkaas for their continuous support and to Dr E. Moreau and I.L.M. Wolvers-Tettero for technical assistance, T.M. van Os for preparation of the figures, and A.D. Korpershoek for secretarial support.

Supported by the Dutch Cancer Foundation (Nederlandse Kankerbestrijding/ Koningin Wilhelmina Fonds), Grant No. EUR 94-852.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

REFERENCES

REFERENCES
1
Tonegawa
S
Somatic generation of antibody diversity.
Nature
302
1983
575
2
Van Dongen
JJM
Wolvers-Tettero
ILM
Analysis of immunoglobulin and T cell receptor genes. Part I: Basic and technical aspects.
Clin Chim Acta
198
1991
1
3
Greaves
MF
Chan
LC
Furley
AJ
Watt
SM
Molgaard
HV
Lineage promiscuity in hemopoietic differentiation and leukemia.
Blood
67
1986
1
4
Dyer
MJ
T-cell receptor delta/alpha rearrangements in lymphoid neoplasms.
Blood
74
1989
1073
5
Felix
CA
Poplack
DG
Characterization of acute lymphoblastic leukemia of childhood by immunoglobulin and T-cell receptor gene patterns.
Leukemia
5
1991
1015
6
Hara
J
Benedict
SH
Champagne
E
Takihara
Y
Mak
TW
Minden
M
Gelfand
EW
T cell receptor delta gene rearrangements in acute lymphoblastic leukemia.
J Clin Invest
82
1988
1974
7
Szczepański
T
Langerak
AW
Wolvers-Tettero
ILM
Ossenkoppele
GJ
Verhoef
G
Stul
M
Petersen
EJ
de Bruijn
MAC
van’t Veer
MB
van Dongen
JJM
Immunoglobulin and T cell receptor gene rearrangement patterns in acute lymphoblastic leukemia are less mature in adults than in children: Implications for selection of PCR targets for detection of minimal residual disease.
Leukemia
12
1998
1081
8
Szczepański
T
Beishuizen
A
Pongers-Willemse
MJ
Hählen
K
van Wering
ER
Wijkhuijs
JM
Tibbe
GJM
De Bruijn
MAC
van Dongen
JJM
Cross-lineage T-cell receptor gene rearrangements occur in more than ninety percent of childhood precursor-B-acute lymphoblastic leukemias: Alternative PCR targets for detection of minimal residual disease.
Leukemia
13
1999
196
9
Nuss
R
Kitchingman
GR
Cross
A
Zipf
TF
Antoun
GR
Bernstein
I
Behm
F
Pullen
DJ
Crist
W
Mirro
J
Jr
Goorha
R
T cell receptor gene rearrangements in B-precursor acute lymphoblastic leukemia correlate with age and the stage of B cell differentiation.
Leukemia
2
1988
722
10
Biondi
A
Francia di Celle
P
Rossi
V
Casorati
G
Matullo
G
Giudici
G
Foa
R
Migone
N
High prevalence of T-cell receptor V delta 2-(D)-D delta 3 or D delta 1/2-D delta 3 rearrangements in B-precursor acute lymphoblastic leukemias.
Blood
75
1990
1834
11
Van Dongen
JJM
Wolvers-Tettero
ILM
Analysis of immunoglobulin and T cell receptor genes. Part II: Possibilities and limitations in the diagnosis and management of lymphoproliferative diseases and related disorders.
Clin Chim Acta
198
1991
93
12
Kitchingman
GR
Rovigatti
U
Mauer
AM
Melvin
S
Murphy
SB
Stass
S
Rearrangement of immunoglobulin heavy chain genes in T cell acute lymphoblastic leukemia.
Blood
65
1985
725
13
Mizutani
S
Ford
AM
Wiedemann
LM
Chan
LC
Furley
AJ
Greaves
MF
Molgaard
HV
Rearrangement of immunoglobulin heavy chain genes in human T leukaemic cells shows preferential utilization of the D segment (DQ52) nearest to the J region.
EMBO J
5
1986
3467
14
Ozaki
M
Asada
M
Tamura
C
Zhong
WK
Nakamura
K
Fujimoto
J
Miyashita
T
Kobayashi
N
Mizutani
S
Molecular analysis of 5′ J region of immunoglobulin heavy chain gene in human acute leukemias.
Leukemia
4
1990
415
15
Breit
TM
Wolvers-Tettero
ILM
Beishuizen
A
Verhoeven
M-AJ
van Wering
ER
van Dongen
JJM
Southern blot patterns, frequencies and junctional diversity of T-cell receptor δ gene rearrangements in acute lymphoblastic leukemia.
Blood
82
1993
3063
16
Van Dongen
JJ
Adriaansen
HJ
Hooijkaas
H
Immunophenotyping of leukaemias and non-Hodgkin’s lymphomas. Immunological markers and their CD codes.
Neth J Med
33
1988
298
17
Groeneveld
K
te Marvelde
JG
van den Beemd
MW
Hooijkaas
H
van Dongen
JJM
Flow cytometric detection of intracellular antigens for immunophenotyping of normal and malignant leukocytes.
Leukemia
10
1996
1383
18
Van Dongen
JJM
Comans-Bitter
WM
Wolvers-Tettero
ILM
Borst
J
Development of human T lymphocytes and their thymus-dependency.
Thymus
16
1990
207
19
Sambrook
J
Fritsch
EF
Maniatis
T
Molecular Cloning: A Laboratory Manual
ed 2
1989
Cold Spring Harbor Laboratory
Cold Spring Harbor, NY
20
Beishuizen
A
Verhoeven
MA
Mol
EJ
Breit
TM
Wolvers-Tettero
ILM
van Dongen
JJM
Detection of immunoglobulin heavy-chain gene rearrangements by Southern blot analysis: Recommendations for optimal results.
Leukemia
7
1993
2045
21
Aubin
J
Davi
F
Nguyen-Salomon
F
Leboeuf
D
Debert
C
Taher
M
Valensi
F
Canioni
D
Brousse
N
Varet
B
Flandrin
G
Macintyre
EA
Description of a novel FR1 IgH PCR strategy and its comparison with three other strategies for the detection of clonality in B cell malignancies.
Leukemia
9
1995
471
22
Küppers
R
Zhao
M
Rajewsky
K
Hansmann
ML
Detection of clonal B cell populations in paraffin-embedded tissues by polymerase chain reaction.
Am J Pathol
143
1993
230
23
Corbett
SJ
Tomlinson
IM
Sonnhammer
ELL
Buck
D
Winter
G
Sequence of the human immunoglobulin diversity (D) segment locus: A systematic analysis provides no evidence for the use of DIR segments, inverted D segments, “minor” D segments or D-D recombination.
J Mol Biol
270
1997
587
24
Pongers-Willemse
MJ
Seriu
T
Stolz
F
d’Aniello
E
Gameiro
P
Pisa
P
Gonzalez
M
Bartram
CR
Panzer-Grumayer
ER
Biondi
A
San Miguel
JF
van Dongen
JJM
Primers and protocols for standardized MRD detection in ALL using immunoglobulin and T cell receptor gene rearrangements and TAL1 deletions as PCR targets. Report of the BIOMED-1 Concerted Action: Investigation of minimal residual disease in acute leukemia.
Leukemia
13
1999
110
25
Langerak
AW
Szczepański
T
van der Burg
M
Wolvers-Tettero
ILM
van Dongen
JJM
Heteroduplex PCR analysis of rearranged T cell receptor genes for clonality assessment in suspect T cell proliferations.
Leukemia
11
1997
2192
26
Beishuizen
A
de Bruijn
MAC
Pongers-Willemse
MJ
Verhoeven
M-AJ
van Wering
ER
Hählen
K
Breit
TM
de Bruin-Versteeg
S
Hooijkaas
H
van Dongen
JJM
Heterogeneity in junctional regions of immunoglobulin kappa deleting element rearrangements in B cell leukemias: A new molecular target for detection of minimal residual disease.
Leukemia
11
1997
2200
27
Ghali
DW
Panzer
S
Fischer
S
Argyriou-Tirita
A
Haas
OA
Kovar
H
Gadner
H
Panzer-Grumayer
ER
Heterogeneity of the T-cell receptor delta gene indicating subclone formation in acute precursor B-cell leukemias.
Blood
85
1995
2795
28
Cook
GP
Tomlinson
IM
The human immunoglobulin VH repertoire.
Immunol Today
16
1995
237
29
Lafaille
JJ
DeCloux
A
Bonneville
M
Takagaki
Y
Tonegawa
S
Junctional sequences of T cell receptor gamma delta genes: Implications for gamma delta T cell lineages and for a novel intermediate of V-(D)-J joining.
Cell
59
1989
859
30
Altschul
SF
Madden
TL
Schaffer
AA
Zhang
J
Zhang
Z
Miller
W
Lipman
DJ
Gapped BLAST and PSI-BLAST: A new generation of protein database search programs.
Nucleic Acids Res
25
1997
3389
31
Schroeder
HW
Jr
Mortari
F
Shiokawa
S
Kirkham
PM
Elgavish
RA
Bertrand
FE
3rd
Developmental regulation of the human antibody repertoire.
Ann NY Acad Sci
764
1995
242
32
Rosenquist
R
Lindh
J
Roos
G
Holmberg
D
Immunoglobulin VH gene replacements in a T-cell lymphoblastic lymphoma.
Mol Immunol
34
1997
305
33
Schroeder
HW
Jr
Wang
JY
Preferential utilization of conserved immunoglobulin heavy chain variable gene segments during human fetal life.
Proc Natl Acad Sci USA
87
1990
6146
34
LeBien
TW
Elstrom
RL
Moseley
M
Kersey
JH
Griesinger
F
Analysis of immunoglobulin and T-cell receptor gene rearrangements in human fetal bone marrow B lineage cells.
Blood
76
1990
1196
35
Yamada
M
Wasserman
R
Reichard
BA
Shane
S
Caton
AJ
Rovera
G
Preferential utilization of specific immunoglobulin heavy chain diversity and joining segments in adult human peripheral blood B lymphocytes.
J Exp Med
173
1991
395
36
Raaphorst
FM
Raman
CS
Tami
J
Fischbach
M
Sanz
I
Human Ig heavy chain CDR3 regions in adult bone marrow pre-B cells display an adult phenotype of diversity: Evidence for structural selection of DH amino acid sequences.
Int Immunol
9
1997
1503
37
Steenbergen
EJ
Verhagen
OJ
van Leeuwen
EF
Behrendt
H
Merle
PA
Wester
MR
von dem Borne
AE
van der Schoot
CE
B precursor acute lymphoblastic leukemia third complementarity-determining regions predominantly represent an unbiased recombination repertoire: Leukemic transformation frequently occurs in fetal life.
Eur J Immunol
24
1994
900
38
Kitchingman
GR
Immunoglobulin heavy chain gene VH-D junctional diversity at diagnosis in patients with acute lymphoblastic leukemia.
Blood
81
1993
775
39
Choi
Y
Greenberg
SJ
Du
TL
Ward
PM
Overturf
PM
Brecher
ML
Ballow
M
Clonal evolution in B-lineage acute lymphoblastic leukemia by contemporaneous VH-VH gene replacements and VH-DJH gene rearrangements.
Blood
87
1996
2506
40
Steenbergen
EJ
Verhagen
OJ
van den Berg
H
van Leeuwen
EF
Behrendt
H
Slater
RR
von dem Borne
AE
van der Schoot
CE
Rearrangement status of the malignant cell determines type of secondary IgH rearrangement (V-replacement or V to DJ joining) in childhood B precursor acute lymphoblastic leukemia.
Leukemia
11
1997
1258
41
Beishuizen
A
Verhoeven
MA
van Wering
ER
Hählen
K
Hooijkaas
H
van Dongen
JJM
Analysis of Ig and T-cell receptor genes in 40 childhood acute lymphoblastic leukemias at diagnosis and subsequent relapse: Implications for the detection of minimal residual disease by polymerase chain reaction analysis.
Blood
83
1994
2238
42
Van Dongen
JJM
Seriu
T
Panzer-Grumayer
ER
Biondi
A
Pongers-Willemse
MJ
Corral
L
Stolz
F
Schrappe
M
Masera
G
Kamps
WA
Gadner
H
van Wering
ER
Ludwig
W-D
Basso
G
de Bruijn
MAC
Cazzaniga
G
Hettinger
K
van der Does-van den Berg
A
Hop
WCJ
Riehm
H
Bartram
CR
Prognostic value of minimal residual disease in acute lymphoblastic leukaemia in childhood.
Lancet
352
1998
1731
43
Adriaansen
HJ
Soeting
PW
Wolvers-Tettero
ILM
van Dongen
JJM
Immunoglobulin and T-cell receptor gene rearrangements in acute non-lymphocytic leukemias. Analysis of 54 cases and a review of the literature.
Leukemia
5
1991
744
44
Bertrand
FE
III
Billips
LG
Burrows
PD
Gartland
GL
Kubagawa
H
Schroeder
HW
Jr
Ig D(H) gene segment transcription and rearrangement before surface expression of the pan-B-cell marker CD19 in normal human bone marrow.
Blood
90
1997
736
45
Davi
F
Faili
A
Gritti
C
Blanc
C
Laurent
C
Sutton
L
Schmitt
C
Merle-Beral
H
Early onset of immunoglobulin heavy chain gene rearrangements in normal human bone marrow CD34+ cells.
Blood
90
1997
4014
46
Ghia
P
ten Boekel
E
Sanz
E
de la Hera
A
Rolink
A
Melchers
F
Ordering of human bone marrow B lymphocyte precursors by single-cell polymerase chain reaction analyses of the rearrangement status of the immunoglobulin H and L chain gene loci.
J Exp Med
184
1996
2217
47
Born
W
White
J
Kappler
J
Marrack
P
Rearrangement of IgH genes in normal thymocyte development.
J Immunol
140
1988
3228
48
Bertrand
FE
III
Billips
LG
Gartland
GL
Kubagawa
H
Schroeder
HW
Jr
The J chain gene is transcribed during B and T lymphopoiesis in humans.
J Immunol
156
1996
4240
49
Yancopoulos
GD
Blackwell
TK
Suh
H
Hood
L
Alt
FW
Introduced T cell receptor variable region gene segments recombine in pre-B cells: Evidence that B and T cells use a common recombinase.
Cell
44
1986
251
50
Breit
TM
Verschuren
MCM
Wolvers-Tettero
ILM
van Gastel-Mol
EJ
Hählen
K
van Dongen
JJM
Human T cell leukemias with continuous V(D)J recombinase activity for TCR-delta gene deletion.
J Immunol
159
1997
4341
51
Ichihara
Y
Matsuoka
H
Kurosawa
Y
Organization of human immunoglobulin heavy chain diversity gene loci.
EMBO J
7
1988
4141
52
Matsuda
F
Ishii
K
Bourvagnet
P
Kuma
K
Hayashida
H
Miyata
T
Honjo
T
The complete nucleotide sequence of the human immunoglobulin heavy chain variable region locus.
J Exp Med
188
1998
2151
53
Lefranc
MP
Giudicelli
V
Ginestoux
C
Bodmer
J
Müller
W
Bontrop
R
Lemaitre
M
Malik
A
Barbi
V
Chaume
D
IMGT, the international ImMunoGeneTics database.
Nucleic Acids Res
27
1999
209

Author notes

Address reprint requests to Jacques J.M. van Dongen, MD, PhD, Department of Immunology, Erasmus University Rotterdam, PO Box 1738, 3000 DR Rotterdam, The Netherlands; e-mail:vandongen@immu.fgg.eur.nl.