Abstract

A Rhesus D (RhD) red blood cell phenotype with a weak expression of the D antigen occurs in 0.2% to 1% of whites and is called weak D, formerly Du. Red blood cells of weak D phenotype have a much reduced number of presumably complete D antigens that were repeatedly reported to carry the amino acid sequence of the regular RhD protein. The molecular cause of weak D was unknown. To evaluate the molecular cause of weak D, we devised a method to sequence all 10RHD exons. Among weak D samples, we found a total of 16 different molecular weak D types plus two alleles characteristic of partial D. The amino acid substitutions of weak D types were located in intracellular and transmembraneous protein segments and clustered in four regions of the protein (amino acid positions 2 to 13, around 149, 179 to 225, and 267 to 397). Based on sequencing, polymerase chain reaction-restriction fragment length polymorphism and polymerase chain reaction using sequence-specific priming, none of 161 weak D samples investigated showed a normal RHD exon sequence. We concluded, that in contrast to the current published dogma most, if not all, weak D phenotypes carry altered RhD proteins, suggesting a causal relationship. Our results showed means to specifically detect and to classify weak D. The genotyping of weak D may guide Rhesus negative transfusion policy for such molecular weak D types that were prone to develop anti-D.

THE RHESUS D (RhD) antigen (ISBT 004.001; RH1) carried by the RhD protein is the most important blood group antigen determined by a protein. It is still the leading cause of hemolytic disease of the newborn.1 About 0.2% to 1% of whites have red blood cells with a reduced expression of the D antigen (weak D, formerly Du).2-4 A small fraction of weak D samples are explained by qualitatively altered RhD proteins, called partial D,5 and frequently caused byRHD/RHCE hybrid alleles, a flurry of which was recently published (reviewed in Huang6). Another fraction is caused by the suppressive effects of Cde haplotypes in trans position.7 These weak D likely possess the normalRHD allele, because the carriers’ parents and children often express a normal RhD antigen density. Such weak D show only a minor reduction of RhD antigen expression, were loosely called high grade Du, and often typed today as normal RhD, because of the increased sensitivity of monoclonal anti-D.8 

The majority of weak D phenotypes is caused by genotype(s) located either at the Rhesus genes’ locus itself or in its proximity, because the weak D expression is inherited along with the RhD phenotype.2 Besides the mere quantitative reduction, no qualitative differences could be discerned in the RhD antigen of this group. Two recent studies addressed the molecular cause of the prevalent weak D phenotypes. Both groups, Rouillac et al9and Beckers et al,10 performed reverse-transcriptase-polymerase chain reaction (RT-PCR) and claimed unanimously that their sequencing of RHD cDNA in weak D samples showed a normal RHD coding sequence. However, no definite molecular cause of the weak D expression was established and the proposed mechanisms differed. Using semiquantitative RT-PCR, Rouillac et al9 reported reduced steady-state levels of RHDtranscripts and claimed that their observations provided direct evidence of a quantitative difference in RhD between normal and weak D red blood cells. In contrast, Beckers et al10,11 found no differences in the amounts of RHD transcripts, further excluded an excess of splice variants,10,12 and concluded that weak D is not caused by regulatory defects of the transcription process.

Screening of random weak D samples by PCR for RHD specific polymorphisms confirmed PCR amplification patterns representative for a normal RHD allele.13,14 However, evidence was accumulating that the underlying molecular basis can be heterogeneous,13 and some weak D may carry structurally abnormal RHD alleles. In four of 44 English weak D, noRHD specific intron 4 PCR amplicons13 were detected, and in one of 90 Northern German weak D, no RHDspecific exon 5 PCR amplicons14 were detected. In a similar more extensive molecular screen by PCR-SSP,15 we found about 2.5% structural abnormalities in more than 600 weak D samples (Gassner et al, manuscript submitted).

These observations prompted us to search for further allelic variation among weak D samples by sequencing. In contrast to the commonly accepted knowledge,6,13,16-19 we found that all weak D samples tested had mutations in RHD exon sequences.

MATERIALS AND METHODS

Blood samples.

EDTA- or citrate-anticoagulated blood samples were collected from white blood donors and characterized as weak D during donor typing in accordance with published standards (Du-test)20as described.3 The donors were not known to be related. D category VI samples were excluded from this study.

Sequencing of the 10 RHD exons from genomic DNA.

DNA was prepared as described previously.15 Nucleotide sequencing was performed with a DNA sequencing unit (Prism dye terminator cycle-sequencing kit with AmpliTaq FS DNA polymerase; ABI 373A, Applied Biosystems, Weiterstadt, Germany). Nucleotide sequencing of genomic DNA stretches representative for all 10 RHD exons and parts of the promoter was accomplished using primers (Table 1) and amplification procedures (Table 2) that obviated the need for subcloning steps.

Table 1.

Primers Used

Name Nucleotide Sequence Genomic Region Position*Orientation RHD-Specific
ra21 gtgccacttgacttgggact  Intron 2  2,823 to 2,842  Sense No  
rb7  atctctccaagcagacccagcaagc  Exon 7 1,022 to 998  Antisense  No  
rb11 tacctttgaattaagcacttcacag  Intron 4  161 to 185  Sense Yes  
rb12  tcctgaacctgctctgtgaagtgc  Intron 4 198 to 175  Antisense  Yes  
rb13 ctagagccaaacccacatctcctt  Promoter  −675 to −652 Sense  No  
rb15  ttattggctacttggtgcc  Intron 5 −612 to −630  Antisense  No  
rb20d tcctggctctccctctct  Intron 2  −25 to −8  Sense Yes  
rb21  aggtccctcctccagcac  Intron 3  28 to 11 Antisense  No  
rb21d  cccaggtccctcctcccagcac  Intron 3 32 to 11  Antisense  No  
rb22  gggagattttttcagccag Intron 4  82 to 64  Antisense  No  
rb24 agacctttggagcaggagtg  Intron 4  −53 to −34  Sense No  
rb25  agcagggaggatgttacag  Intron 5 −111 to −93  Sense  No  
rb26 aggggtgggtagggaatatg  Intron 6  −62 to −43  Sense No  
rb44  gcttgaaatagaagggaaatgggagg  Intron 7  ≈3,000  Antisense  No  
rb46 tggcaagaacctggaccttgacttt  Intron 3  −1,279 to −1,255 Sense  No  
rb52  ccaggttgttaagcattgctgtacc  Intron 7 ≈−3,300  Sense  Yes  
re01 atagagaggccagcacaa  Promoter  −149 to −132  Sense Yes  
re02  tgtaactatgaggagtcag  Promoter −572 to −554  Sense  Yes  
re11d agaagatgggggaatctttttcct  Intron 1  129 to 106 Antisense  No  
re12d  attagccgggcacggtggca  Intron 1 −1,188 to −1,168  Sense  Yes  
re13 actctaatttcataccaccc  Intron 1  −72 to −53  Sense No  
re23  aaaggatgcaggaggaatgtaggc  Intron 2 251 to 227  Antisense  No  
re31  tgatgaccatcctcaggt Exon 3  472 to 455  Antisense  Yes  
re617 tctcagctcactgcaacctc  Intron 6  1,998 to 2,017  Sense No  
re621  catccccctttggtggcc  Intron 6 −102 to −85  Sense  Yes  
re71 acccagcaagctgaagttgtagcc  Exon 7  1,008 to 985 Antisense  Yes  
re73  cctttttgtccctgatgacc  Intron 7 −67 to −48  Sense  No  
re74 tatccatgaggtgctgggaac  Intron 7    ≈−200  Sense No  
re75  aaggtaggggctggacag  Intron 7    ≈120  Antisense  Yes  
re82 aaaaatcctgtgctccaaac  Intron 8     ≈−45  Sense Yes  
re83  gagattaaaaatcctgtgctcca  Intron 8    ≈−50  Sense  No  
re91 caagagatcaagccaaaatcagt  Intron 9     ≈−40  Sense  No  
re93  cacccgcatgtcagactatttggc  Intron 9    ≈300  Antisense  No  
rf51 caaaaacccattcttcccg  Intron 5  −332 to −314  Sense No  
rg62  tgtattccaggcagaaggc  Intron 6 1,736 to 1,755  Sense  No  
rh5  gcacagagacggacacag 5′ UTR −19 to −2  Sense  No  
rh7 acgtacaaatgcaggcaac  3′ UTR  1,330 to 1,313  Antisense No  
rr1  tgttggagagaggggtgatg  5′ UTR  −60 to −41 Sense  No  
rr3  cagtctgttgtttaccagatg  3′ UTR 1,512 to 1,492  Antisense  Yes  
rr4 agcttactggatgaccacca  3′ UTR  1,541 to 1,522  Antisense Yes 
Name Nucleotide Sequence Genomic Region Position*Orientation RHD-Specific
ra21 gtgccacttgacttgggact  Intron 2  2,823 to 2,842  Sense No  
rb7  atctctccaagcagacccagcaagc  Exon 7 1,022 to 998  Antisense  No  
rb11 tacctttgaattaagcacttcacag  Intron 4  161 to 185  Sense Yes  
rb12  tcctgaacctgctctgtgaagtgc  Intron 4 198 to 175  Antisense  Yes  
rb13 ctagagccaaacccacatctcctt  Promoter  −675 to −652 Sense  No  
rb15  ttattggctacttggtgcc  Intron 5 −612 to −630  Antisense  No  
rb20d tcctggctctccctctct  Intron 2  −25 to −8  Sense Yes  
rb21  aggtccctcctccagcac  Intron 3  28 to 11 Antisense  No  
rb21d  cccaggtccctcctcccagcac  Intron 3 32 to 11  Antisense  No  
rb22  gggagattttttcagccag Intron 4  82 to 64  Antisense  No  
rb24 agacctttggagcaggagtg  Intron 4  −53 to −34  Sense No  
rb25  agcagggaggatgttacag  Intron 5 −111 to −93  Sense  No  
rb26 aggggtgggtagggaatatg  Intron 6  −62 to −43  Sense No  
rb44  gcttgaaatagaagggaaatgggagg  Intron 7  ≈3,000  Antisense  No  
rb46 tggcaagaacctggaccttgacttt  Intron 3  −1,279 to −1,255 Sense  No  
rb52  ccaggttgttaagcattgctgtacc  Intron 7 ≈−3,300  Sense  Yes  
re01 atagagaggccagcacaa  Promoter  −149 to −132  Sense Yes  
re02  tgtaactatgaggagtcag  Promoter −572 to −554  Sense  Yes  
re11d agaagatgggggaatctttttcct  Intron 1  129 to 106 Antisense  No  
re12d  attagccgggcacggtggca  Intron 1 −1,188 to −1,168  Sense  Yes  
re13 actctaatttcataccaccc  Intron 1  −72 to −53  Sense No  
re23  aaaggatgcaggaggaatgtaggc  Intron 2 251 to 227  Antisense  No  
re31  tgatgaccatcctcaggt Exon 3  472 to 455  Antisense  Yes  
re617 tctcagctcactgcaacctc  Intron 6  1,998 to 2,017  Sense No  
re621  catccccctttggtggcc  Intron 6 −102 to −85  Sense  Yes  
re71 acccagcaagctgaagttgtagcc  Exon 7  1,008 to 985 Antisense  Yes  
re73  cctttttgtccctgatgacc  Intron 7 −67 to −48  Sense  No  
re74 tatccatgaggtgctgggaac  Intron 7    ≈−200  Sense No  
re75  aaggtaggggctggacag  Intron 7    ≈120  Antisense  Yes  
re82 aaaaatcctgtgctccaaac  Intron 8     ≈−45  Sense Yes  
re83  gagattaaaaatcctgtgctcca  Intron 8    ≈−50  Sense  No  
re91 caagagatcaagccaaaatcagt  Intron 9     ≈−40  Sense  No  
re93  cacccgcatgtcagactatttggc  Intron 9    ≈300  Antisense  No  
rf51 caaaaacccattcttcccg  Intron 5  −332 to −314  Sense No  
rg62  tgtattccaggcagaaggc  Intron 6 1,736 to 1,755  Sense  No  
rh5  gcacagagacggacacag 5′ UTR −19 to −2  Sense  No  
rh7 acgtacaaatgcaggcaac  3′ UTR  1,330 to 1,313  Antisense No  
rr1  tgttggagagaggggtgatg  5′ UTR  −60 to −41 Sense  No  
rr3  cagtctgttgtttaccagatg  3′ UTR 1,512 to 1,492  Antisense  Yes  
rr4 agcttactggatgaccacca  3′ UTR  1,541 to 1,522  Antisense Yes 
*

The positions of the synthetic oligonucleotides are indicated relative to their distances from the first nucleotide position of the start codon ATG for all primers in the promoter and in the exons, or relative to their adjacent exon/intron boundaries for all other primers. Primers ra2160 and rh561 were reported previously.

5′ UTR: 5′ untranslated region of exon 1; 3′ UTR: 3′ untranslated region of exon 10.

Table 2.

Sequencing Method for all 10 RHD Exons From Genomic DNA

RHD Exon PCR PrimersRHD-Specific*PCR ConditionsSequencing Primers RHD-Specific*
SenseAntisense Extension Annealing
Exon 1  rb13  rb11d No  10 min  60°C  re01  Yes  
Exon 2  re12d re23  Yes   3 min  65°C  re13  No  
Exon 3 ra21  rb21  No  10 min  60°C  re31 and rb20d Yes  
Exon 4  rb46  rb12  Yes  10 min  60°C rb22  No  
Exon 5  rb11  rh2  Yes  10 min 60°C  rb24  No  
Exon 6  rf51  re71  Yes 10 min  60°C  rb25  No  
Exon 7  re617  rb44 No  10 min  60°C  re621 and re75  Yes  
Exon 8 rb52  rb93  Yes  10 min  60°C  re73  No 
Exon 9  rb52  rb93  Yes  10 min  60°C re82/re83  Yes/no  
Exon 10  re91  rr4  Yes 10 min  60°C  rr3/rh7  Yes/no 
RHD Exon PCR PrimersRHD-Specific*PCR ConditionsSequencing Primers RHD-Specific*
SenseAntisense Extension Annealing
Exon 1  rb13  rb11d No  10 min  60°C  re01  Yes  
Exon 2  re12d re23  Yes   3 min  65°C  re13  No  
Exon 3 ra21  rb21  No  10 min  60°C  re31 and rb20d Yes  
Exon 4  rb46  rb12  Yes  10 min  60°C rb22  No  
Exon 5  rb11  rh2  Yes  10 min 60°C  rb24  No  
Exon 6  rf51  re71  Yes 10 min  60°C  rb25  No  
Exon 7  re617  rb44 No  10 min  60°C  re621 and re75  Yes  
Exon 8 rb52  rb93  Yes  10 min  60°C  re73  No 
Exon 9  rb52  rb93  Yes  10 min  60°C re82/re83  Yes/no  
Exon 10  re91  rr4  Yes 10 min  60°C  rr3/rh7  Yes/no 
*

To achieve RHD specificity for genomic nucleotide sequencing, the PCR primer pairs or the sequencing primer or both must not concurrently detect RHCE-derived nucleotide sequences. Primer sequences are given in Table 1.

Primers were used at a concentration of 1 nmol/L in the Expand High Fidelity PCR System (Boehringer Mannheim, Mannheim, Germany). In the exon 10 PCR, the concentration of MgCl2 was 2.0 nmol/L. Denaturation was 20 seconds at 92°C, annealing 30 seconds, elongation temperature 68°C. Elongation time was increased by 20 seconds for each cycle after the 10th cycle, except for the re12d/re23 primer pair.

Control of RHD specificity.

RHD exons 3 to 7 and 9 carry at least one RHD-specific nucleotide, which was used to verify the RHD origin of the sequences. For exon 1, characteristic nucleotides in the adjacent parts of intron 1 were used.21 For exon 8, the RHDspecificity of the PCR amplification was checked by RHDnonspecific sequencing of the informative exon 9, because exons 8 and 9 were amplified as a single PCR amplicon (Table 2). Exon 2 and 10 were amplified in an RHD- specific way (Table 2) based on publishedRHD-specific nucleotide sequences (EMBL nucleotide sequence data base accession numbers U66340 and U66341)22,23; no PCR amplicons were obtained in RhD controls (data not shown). All normal D and weak D samples showed a G at position 65424 and a C at position 1036,22 supporting the notion25 that the alternatively described C22 and T,24 respectively, were sequencing errors.

Detection of weak D specific mutations by PCR-restriction fragment length polymorphism (RFLP) and PCR using sequence-specific priming (PCR-SSP).

PCR-RFLP methods were developed to characterize distinct nucleotide substitutions detected in five RHD alleles: the C to G substitution at position 8 led to the loss of a Sac I restriction site in amplicons obtained with re01 and re11d (G to A at 29, loss of Msp I site, re01/re11d; C to A at 446, loss ofAlu I site, rb20d/rb21d; T to G at 809, loss of Alw44 I site, rf51/re71; G to C at 1154, introduction of Alu I site, re82/re93). Conditions for the rf51/re71 PCR reaction were as shown in Table 2. The rb20d/rb21d reaction was done with nonproofreading Taq-polymerase (Boehringer Mannheim, Mannheim, Germany or Qiagen, Hilden, Germany) with 20 seconds denaturation at 94°C, 30 seconds annealing at 60°C, and 30 seconds extension at 72°C. The other PCR reactions were performed with nonproofreading Taq-polymerase with 20 seconds denaturation at 94°C, 30 seconds annealing at 55°C, and 1 minute extension at 72°C.

Another four RHD alleles were detected by a standard RHPCR-SSP15: the RHD(T201R,F223V) andRHD(S182T,K198N,T201R) alleles lacked specific amplicons for RHD exon 4, the RHD(G307R) and RHD(A276P) alleles lacked those for RHD exon 6. For all other weak D types, the authenticity of the point mutations was checked by nucleotide sequencing of independent PCR amplicons.

Sequencing of the RHD promoter.

To check for mutations in the RHD promoter, we amplified a 675-bp region using primer pair rb13 and rb11d (Table 2). The promoter region was sequenced using primers re02 and re01 starting at nucleotide position −545 relative to the first nucleotide of the start codon.

Characterization of RHD allele polymorphisms in introns 3 and 6.

In RHD intron 3, there was a G/C polymorphism that determined aHae III-RFLP at position −371 relative to the intron 3/exon 4 junction. To check this polymorphism, we amplified the 3′ part of intron 3 using the RHD specific primer pair rb46 and rb12 and digested the PCR products with Hae III. InRHD intron 6, there was a variable length TATT tandem repeat starting 1,915 bp 3′ of exon 6. To examine this tandem repeat, we amplified the full-length intron 6 using the RHD-specific primer pair rf51 and re71 and used primer rg62 for sequencing. The haplotype association of the Hae III site was tested in 10 CCDee, 8 ccDEE, 10 ccDee (W16C+), and 10 ccDee (W16C) samples. The haplotype association of the TATT repeat was tested in 3 CCDee, 3 ccDEE, 1ccDEe, 2 ccDee (W16C+), and 2 ccDee (W16C) samples. In control samples, the presence and absence of the Hae III site was linked to 9 and 8 TATT repeats, respectively. The Hae III site was present in the 20 CDe haplotypes and 18 of 20 cDe haplotypes tested, but absent in 15 of 16 cDE haplotypes (CDe v cDE,P < .001; cDe v cDE, P < .001; CDev cDe, not significant; 2 × 2 contingency tables, Fisher’s exact test).

Sequencing of intron 5 and exons 6 to 9 in DIV type III.

In DIV type III exons 6 to 9 were amplified and sequenced using primers that were specific for RHCE andRHD. Therefore, primer re71 was substituted by primer rb7; primer re621 by rb26; and primer re52 by re74. To demonstrate anRHD-RHCE hybrid allele, we amplified intron 5 in aRHD-specific way using the exon 5 PCR reaction (Table 2) and sequenced the breakpoint region using primer rb15.

cDNA sequencing.

RNA was prepared and reverse-transcribed as published.21cDNA was amplified in a nested PCR reaction (High Fidelity PCR system, Boehringer Mannheim, Mannheim, Germany) with external primers RR1 and RR4 and internal primers Rh5 and RR3 and subcloned into pMos (pMos-T-kit; United States Biochemical, Cleveland, OH).

Expected proportion of silent mutations.

In the 416 codons of the RHD gene excluding the start codon, 2,766 missense and 919 silent mutations can occur yielding an expected proportion of 0.254 of silent mutations. A total of 782 of the missense mutations and 437 of the silent mutations are transitions resulting in an expected proportion of 0.36 of silent transitions. A total of 41 missense and 30 silent mutations are located in CpG doublets resulting in a proportion of silent mutations in CpG doublets of 0.42. Independent of any possible excess of transitions or mutations in CpG doublets, random nucleotide changes should therefore lead to a minimal frequency of silent mutations of 0.254. Nonsense mutations and mutations in the start codon were assumed to prevent RhD expression13 and are excluded from the calculations.

Population frequency and haplotype association of weak D types.

The phenotype frequencies of weak D types among weak D samples were calculated separately for each serologic (CcDEe) weak D phenotype and combined according to the frequencies of the serologic weak D phenotypes.3 ccDEE weak D samples were assumed to be cDE/cdE. Phenotype frequencies in the population were calculated from the population frequency of the weak D phenotype in Southwestern Germany.3 These data are minimal estimates, because some samples with only moderately weakened D expression may have been inadvertantly grouped to normal strength D. Haplotype frequencies were calculated using a haplotype frequency of 0.411 for RhD haplotypes3 assuming that all weak D samples were heterozygous. For weak D types 1 to 5, 9, 13, and 15, more than one proband was observed rendering the haplotype association trivial. Weak D type 11 was observed in a ccDee phenotype implying a cDe haplotype. Weak D types 6 to 8 and 12 were observed in single CcDee samples and assumed to be CDe/cde, which is correct in more than 96% of samples according to the haplotype frequencies in the population investigated.3 Weak D types 10, 14, and 16 were observed in single ccDEe samples and assumed to be cDE/cde, which is correct in more than 98% of samples.3 Hence, the probability that an cDE versus cDe misassignment corrupted the analysis of haplotype-specific polymorphisms was less than 0.05.

RhD topology prediction.

The position of the transmembraneous helices was based on an analysis of RhD by the PredictProtein server prediction of transmembrane helices (http://www.embl-heidelberg.de/predictprotein/predictprotein.html,26helix 1 to 11) and TMpred (http://ulrec3.unil.ch/software/TMPRED_form.html,27 helix 12) with minor modifications localizing position 110 and 226 on the cell surface and 12 in the membrane in accordance with other published models.28,29 There is experimental evidence30,31 for intracellular positions of the amino and carboxytermini.

RESULTS

Coding sequence of RHD in weak D phenotypes.

A method for RHD-specific sequencing of the 10 RHDexons and their splice sites was developed. In a sequential analysis strategy, blood samples with weak expression of antigen D, including a random survey of 161 samples from blood donors in Southwestern Germany, were checked by this method, PCR-RFLP (Fig1), and RHD PCR-SSP.15 We found 18 RHDalleles with distinct nucleotide changes coding for amino acid substitutions (Table 3). One allele lackedRHD exons 6 to 9 concordant with a RHD-CE-D hybrid allele dubbed hereby DIV type III. Another allele was DHMi.32 Of the remaining 16 alleles, 14 showed single, but distinct previously unknown missense mutations. None of the encoded variant amino acids occurred at the corresponding positions in the RhCE proteins. Two alleles exhibited multiple nucleotide changes typical for the RHCE gene, which were interspersed byRHD-specific sequences.

Fig. 1.

Detection of weak D types by PCR-RFLP. Four weak D types harbored point mutations that obliterated restriction sites: weak D type 1 lacks an Alw44 I site (A); weak D type 3, a SacI site (C); weak D type 5, an Alu I site (D); and weak D type 6, a Msp I site (E). In a fifth weak D type, a point mutation introduced a restriction site: weak D type 2 gained an Alu I site (B). On the left side of the gels, 100 bp ladders are shown; the position of the 500 bp and 100 bp fragments are indicated on the right side of the panels. For the PCR reaction of (A), the largest restriction fragment approximation 3,000 bp is not shown.

Fig. 1.

Detection of weak D types by PCR-RFLP. Four weak D types harbored point mutations that obliterated restriction sites: weak D type 1 lacks an Alw44 I site (A); weak D type 3, a SacI site (C); weak D type 5, an Alu I site (D); and weak D type 6, a Msp I site (E). In a fifth weak D type, a point mutation introduced a restriction site: weak D type 2 gained an Alu I site (B). On the left side of the gels, 100 bp ladders are shown; the position of the 500 bp and 100 bp fragments are indicated on the right side of the panels. For the PCR reaction of (A), the largest restriction fragment approximation 3,000 bp is not shown.

Table 3.

Proposed Nomenclature, Molecular Basis and Minimal Population Frequencies of RHD Alleles Coding for Weak D Phenotypes

Trivial Name Molecular Basis (allele) Nucleotide Change Protein SequenceExon Membrane Localization3-150CpG3-151Population Study
No.3-152% of Weak DPhenotype Frequency (%) Haplotype Frequency
Weak D type 1  RHD (V270G)  T → G at 809  Val to Gly at 270  6  TM  No  95  70.29  0.2964  1:277 
Weak D type 2  RHD (G385A)  G → C at 1154  Gly to Ala at 385  9  TM  No  43  18.01  0.0759 1:1,082  
Weak D type 3  RHD (S3C)  C → G at 8 Ser to Cys at 3  1  IC  No  7  5.19  0.0219 1:3,759  
Weak D type 4  RHD (T201R, F223V) C → G at 602, T → G at 667, G → A at 819 Thr to Arg at 201 Phe to Val at 223 no change  4 5 6  IC TM —  NA3-153 NA Yes  6  1.30  0.0055  1:14,925  
Weak D type 5 RHD (A149D)  C → A at 446  Ala to Asp at 149 3  TM  No  2  0.84  0.0035  1:23,256  
Weak D type 6  RHD (R10Q)  G → A at 29  Arg to Gln at 10 1  IC  Yes  1  0.74  0.0031  1:26,316  
Weak D type 7  RHD (G339E)  G → A at 1016  Gly to Glu at 339  7  TM  No  1  0.74  0.0031  1:26,316  
Weak D type 8  RHD (G307R)  G → A at 919  Gly to Arg at 307  6  IC  Yes  1  0.74  0.0031  1:26,316 
Weak D type 9  RHD (A294P)  G → C at 880  Ala to Pro at 294  6  TM  No  1  0.42  0.0017 1:47,619  
Weak D type 10  RHD (W393R)  T → C at 1177  Trp to Arg at 393  9  IC  No  1  0.42 0.0017  1:47,619  
Weak D type 11  RHD (M295I) G → T at 885  Met to Ile at 295  6  TM  No  0.22  0.0009  1:90,909  
Weak D type 12  RHD(G277E)  G → A at 830  Gly to Glu at 277  6  TM  No 0  <2.223-155 
Weak D type 13  RHD (A276P) G → C at 826  Ala to Pro at 276  6  TM  No  <2.223-155 
Weak D type 14  RHD (S182T, K198N, T201R)  T → A at 544, A → T at 594, C → G at 602 Ser to Thr at 182 Lys to Asn at 198 Thr to Arg at 201  4 4 4  TM IC IC  NA NA NA  0  <2.223-155 
Weak D type 15  RHD (G282D) G → A at 845  Gly to Asp at 282  6  TM  No  <1.263-155 
Weak D type 16  RHD (W220R)  T → C at 658  Trp to Arg at 220  5  TM  No  0  <1.263-155 
DIV type III3-154 RHD-CE(6-9)-D  multiple multiple  6 to 9  EF/TM/IC  NA  1  0.60  0.0025 1:32,448  
DHMi  RHD (T283I)  C → T at 848 Thr to Ile at 283  6  EF  No  1  0.42  0.0017 1:47,619 
Trivial Name Molecular Basis (allele) Nucleotide Change Protein SequenceExon Membrane Localization3-150CpG3-151Population Study
No.3-152% of Weak DPhenotype Frequency (%) Haplotype Frequency
Weak D type 1  RHD (V270G)  T → G at 809  Val to Gly at 270  6  TM  No  95  70.29  0.2964  1:277 
Weak D type 2  RHD (G385A)  G → C at 1154  Gly to Ala at 385  9  TM  No  43  18.01  0.0759 1:1,082  
Weak D type 3  RHD (S3C)  C → G at 8 Ser to Cys at 3  1  IC  No  7  5.19  0.0219 1:3,759  
Weak D type 4  RHD (T201R, F223V) C → G at 602, T → G at 667, G → A at 819 Thr to Arg at 201 Phe to Val at 223 no change  4 5 6  IC TM —  NA3-153 NA Yes  6  1.30  0.0055  1:14,925  
Weak D type 5 RHD (A149D)  C → A at 446  Ala to Asp at 149 3  TM  No  2  0.84  0.0035  1:23,256  
Weak D type 6  RHD (R10Q)  G → A at 29  Arg to Gln at 10 1  IC  Yes  1  0.74  0.0031  1:26,316  
Weak D type 7  RHD (G339E)  G → A at 1016  Gly to Glu at 339  7  TM  No  1  0.74  0.0031  1:26,316  
Weak D type 8  RHD (G307R)  G → A at 919  Gly to Arg at 307  6  IC  Yes  1  0.74  0.0031  1:26,316 
Weak D type 9  RHD (A294P)  G → C at 880  Ala to Pro at 294  6  TM  No  1  0.42  0.0017 1:47,619  
Weak D type 10  RHD (W393R)  T → C at 1177  Trp to Arg at 393  9  IC  No  1  0.42 0.0017  1:47,619  
Weak D type 11  RHD (M295I) G → T at 885  Met to Ile at 295  6  TM  No  0.22  0.0009  1:90,909  
Weak D type 12  RHD(G277E)  G → A at 830  Gly to Glu at 277  6  TM  No 0  <2.223-155 
Weak D type 13  RHD (A276P) G → C at 826  Ala to Pro at 276  6  TM  No  <2.223-155 
Weak D type 14  RHD (S182T, K198N, T201R)  T → A at 544, A → T at 594, C → G at 602 Ser to Thr at 182 Lys to Asn at 198 Thr to Arg at 201  4 4 4  TM IC IC  NA NA NA  0  <2.223-155 
Weak D type 15  RHD (G282D) G → A at 845  Gly to Asp at 282  6  TM  No  <1.263-155 
Weak D type 16  RHD (W220R)  T → C at 658  Trp to Arg at 220  5  TM  No  0  <1.263-155 
DIV type III3-154 RHD-CE(6-9)-D  multiple multiple  6 to 9  EF/TM/IC  NA  1  0.60  0.0025 1:32,448  
DHMi  RHD (T283I)  C → T at 848 Thr to Ile at 283  6  EF  No  1  0.42  0.0017 1:47,619 
F3-150

IC, intracellular; TM, transmembraneous; EF, exofacial.

F3-151

Mutation occurring in CpG doublet.

F3-152

Number of samples (no.) observed among 161 random blood samples with weak antigen D expression. Types 12 to 16 were detected in additional weak D samples.

F3-153

Not applicable, substitution(s) probably derived from gene conversion.

F3-155

Upper limit of 95% confidence interval (Poisson distribution).

F3-154

In the D IV type III allele, the presence of aRHCE-RHD hybrid was proven by RHD-specific sequencing of the 5′ breakpoint region. This breakpoint was located in intron 5 between −993 bp and −814 bp relative to the first nucleotide of exon 6 (range of 180 bp; Genbank accession numbers Z97333 andZ97364).

Distribution of weak D alleles in whites.

A set of 161 samples with weak expression of antigen D was gathered from random blood donors in Southwestern Germany. D category VI samples, but no other partial D, were excluded by serologic methods. Two samples represented known partial D (DHMi32 and D category IV33). Without any exception, all samples could be assigned to distinct RHD alleles with aberrant RHD exon sequences (Table 3). We propose that the new molecular weak D types should be referred to by trivial names, eg, weak D type 1, or by their molecular structures, eg, RHD(V270G). The weak D type 1 was the most frequent known RHD allele (f = 1:277) with aberrant coding sequence, exceeding even the DVII allele frequency.34 

Amino acid substitutions in weak D alleles are clustered.

The amino acid substitutions observed in weak D types with single missense mutations were not evenly distributed in the RhD protein (Fig 2). The majority of substitutions occurred in the region of amino acid positions 267 to 397. Single and multiple amino acid substitutions in smaller portions of the RhD protein around positions 2 to 13, 149, and 179 to 225 (weak D type 4 and 14) were also found in weak D alleles. According to the current RhD loop model, the involved amino acids were positioned in the transmembraneous and intracellular protein segments (Fig 3).

Fig. 2.

Schematic representation of the amino acid variations observed in weak D types with single missense mutations. The affected amino acids of the prevalent normal RhD protein and their positions are shown on top. Their substitutions occurring in the weak D types are shown below the bar. The distribution of the variant positions deviated from the uniform distribution (P < .05, Kolmogoroff-Smirnov-test).

Fig. 2.

Schematic representation of the amino acid variations observed in weak D types with single missense mutations. The affected amino acids of the prevalent normal RhD protein and their positions are shown on top. Their substitutions occurring in the weak D types are shown below the bar. The distribution of the variant positions deviated from the uniform distribution (P < .05, Kolmogoroff-Smirnov-test).

Fig. 3.

Localization of the amino acid substitutions of the weak D types. A predicted topology of the RhD protein with respect to the plane of the red blood cells’ membrane is presented. Amino acid substitutions are shown for single events (black circles) and multiple events (gray circles). The amino acid substitutions of all weak D types were located in intracellular and transmembraneous protein segments.

Fig. 3.

Localization of the amino acid substitutions of the weak D types. A predicted topology of the RhD protein with respect to the plane of the red blood cells’ membrane is presented. Amino acid substitutions are shown for single events (black circles) and multiple events (gray circles). The amino acid substitutions of all weak D types were located in intracellular and transmembraneous protein segments.

Normal RhD phenotype controls and RHD promoter.

RHD specific sequencing of the 10 RHD exons predicted regular RhD protein sequences in six control samples with a normal antigen D expression; 545 bp 5′ of the start codon comprising part of the RHD promoter were sequenced in one sample of each weak D type, DHMi, and DIV type III. No deviation from the normal RHD promoter sequence35 was found.

Statistical evidence that missense mutations can cause weak D phenotypes.

The frequency of altered RhD proteins in weak D (159 of 159) and normal D samples (0 of 6) was statistically significantly different (P< .0001, 2 × 2 contingency table, Fisher’s exact test). A normal RhD coding sequence in the weak D phenotype was expected to occur in less than 1.9% (upper limit of 95% confidence interval, Poisson distribution). These amino acid substitutions are unlikely to reflect random nucleotide changes, because a random mechanism would lead to a frequency of silent mutations of at least 0.254, while we observed only one silent mutation among a total of 18 mutations in weak D alleles (P = .037, binomial distribution).

Haplotype-specific RHD polymorphisms.

In intron 3 and intron 6, we detected polymorphic RHD sequences that differed between the prevalent RHD alleles of the CDe and cDE haplotypes (Table 4). Weak D alleles were identical to the prevalent alleles of the same RHhaplotype in regard to these polymorphisms, with the single exception of weak D type 4 displaying a unique intron 6 repeat sequence. The conservation of these haplotype-specific RHD polymorphisms suggested that weak D alleles evolved independently.

Table 4.

RHD Polymorphisms in Weak D Types of VariousRH Haplotypes

Haplotype Allele Hae III Site in Intron 3TATT-Repeat in Intron 6
CDe  Prevalent RHD Present  9  
CDe  Weak D type 1  Present 9  
CDe  Weak D type 3  Present  
CDe  Weak D type 6  Present  9  
CDe Weak D type 7  Present  9  
CDe Weak D type 8  Present  9  
CDe Weak D type 12  Present  9  
CDe Weak D type 13  Present  9  
CDe DIV type III  Present  4-150 
cDE  Prevalent RHD Absent  8  
cDE Weak D type 2  Absent  8  
cDE Weak D type 5  Absent  8  
cDE Weak D type 9  Absent  8  
cDE Weak D type 10  Absent  8  
cDE Weak D type 14  Absent  8  
cDE Weak D type 15  Absent  8  
cDE Weak D type 16  Absent  8  
cDE DHMi Absent  8  
cDe  Prevalent RHD Present  9  
cDe  Weak D type 4  Present 13   
cDe  Weak D type 11  Present 
Haplotype Allele Hae III Site in Intron 3TATT-Repeat in Intron 6
CDe  Prevalent RHD Present  9  
CDe  Weak D type 1  Present 9  
CDe  Weak D type 3  Present  
CDe  Weak D type 6  Present  9  
CDe Weak D type 7  Present  9  
CDe Weak D type 8  Present  9  
CDe Weak D type 12  Present  9  
CDe Weak D type 13  Present  9  
CDe DIV type III  Present  4-150 
cDE  Prevalent RHD Absent  8  
cDE Weak D type 2  Absent  8  
cDE Weak D type 5  Absent  8  
cDE Weak D type 9  Absent  8  
cDE Weak D type 10  Absent  8  
cDE Weak D type 14  Absent  8  
cDE Weak D type 15  Absent  8  
cDE Weak D type 16  Absent  8  
cDE DHMi Absent  8  
cDe  Prevalent RHD Present  9  
cDe  Weak D type 4  Present 13   
cDe  Weak D type 11  Present 
F4-150

Intron 6 derived from RHCE due to a gene conversion.

DISCUSSION

The weak D phenotype is represented by a group ofRHD+ genotypes that code in their vast majority for altered RhD proteins associated with a reduced RhD expression on the red blood cells’ surface. Our population-based study dismissed unequivocally the possibility of one distinct antigen Duand showed in contrast to previous conjectures, that weak D alleles do generally possess mutations in RHD exon sequences. We provided statistical evidence that the missense mutations observed in the alleles of all weak D types are the probable cause for the reduced antigen D expression.

We suggest a causal relation of missense mutations and reduced RhD protein integration: (1) weak D alleles evolved independently in the different haplotypes, each distinct event being associated with a change in the RhD protein sequence; (2) no sample occurred with a normal RHD sequence despite observation of 13 different alleles in 161 samples; (3) type and distribution of the observed nucleotide substitutions was not compatible with the null hypothesis of random changes; (4) missense mutations causing reduced RhD expression fit nicely into the current model of RhD membrane integration.

Rh proteins occur in a complex with the Rh50 protein, and the expression of the Rh/Rh50 complex depends on the presence of both intact Rh5036 and Rh37,38 proteins. Missense mutations in the Rh50 protein are known to cause reduced expression of the Rh complex.36,39 Amino acid substitutions in the RhD protein might hence affect the expression of the RhD/Rh50 complex. A formal experimental proof of causality would involve expression systems. The only currently available system40 has, so far, not been shown to predict expression in a quantitative way.

Based on the distribution and kind of amino acid substitutions, a general picture of the relationship of RhD structure and RhD expression arose: all amino acid substitutions in weak D were located in the intracellular or transmembraneous parts of the RhD protein. Known RhD alleles with exofacial substitutions32,41-43 were discovered by virtue of their partial D antigen, but may display discrete (DNU and DVII) to moderate (DII, DHR, and DHMi) reductions in RhD expression.43-45 Most substitutions reported in this study were nonconservative and the introduced amino acids, in particular proline, likely disrupted the secondary or tertiary structure. Two weak D alleles (type 2 and 11) were associated with conservative substitutions indicating that the involved amino acid regions at positions 295 and 385 may be particularly important for an optimal RhD membrane integration. In two alleles (type 4 and type 14), parts of exon 4 and 5 were substituted by the corresponding parts of the RHCE gene. Similar exchanges occurred in DVI type I and DVI type II that exhibited a considerably reduced RhD protein expression45 also. Previous paradoxical observations can be explained, if the N152T substitution in exon 3 is considered to facilitate the membrane integration: (1) DIIIa,46 differing from weak D type 4 by the N152T substitution only, has a normal RhD antigen density,45 and (2) DIIIc, DIVa, and DVI type III harboring the N152T substitution have enhanced antigen densities21,45 compared with their appropriate controls (normal RhD and DVI type II).

Our genomic sequencing method was optimized to detect missense mutations. The approach obviated the laborious need to obtain full-length cDNA and to differentiate missense mutations from misincorporated nucleotides introduced during PCR and subcloning steps. The demonstration of missense mutations by genomic RHDsequencing definitively refuted the current dogma9,10 of a normal RHD allele in weak D phenotypes. The possibility of additional aberrations, eg, multiple hybrid genes with complementaryRHD exon patterns, was formally excluded for the most frequent weak D type 1 representing about 0.3% of all RHD alleles by sequencing the full-length cDNA. Our results are incongruous with two earlier reports asserting normal RHD coding sequences in three weak D samples from France9 and in an unspecified number of weak D samples from the Netherlands.10 Possibly, these investigators missed the mutations because of technical problems of the traditional approach based on cDNA. Alternative explanations are very unlikely: (1) There might be regional variations in the causes of weak D, although other Rh alleles as frequent as the prevalent weak D alleles do not differ much in whites. (2) Both groups may have inadvertently investigated high grade Du that are due to a suppressive effect of Cde and expected to possess a normal coding sequence. We excluded the possibility that we investigated some rare, previously uncharacterized partial D instead of weak D, because the phenotypes described by us occurred with a cumulative frequency of 0.41% and, therefore, accounted for the majority of weak D phenotypes. Weak D type 4 was partially characterized by Legler et al.14 These investigators performed sevenRHD-specific PCR reactions that were not affected by most mutations in weak D types. Their approach was not designed to exclude the kind of genetic diversity that is actually present in our weak D phenotypes.

Our findings implied that there is no well-defined borderline between weak D and partial D that has an aberrant RHD coding sequence, lacks specific D epitopes, and may be associated with an allo–anti-D. The observation of anti-D production in Rhesus positive recipients is too rare, even for some D categories, to base a classification on this event. Serologic discrimination of qualitative and quantitative abnormalities is prone to mistakes in samples with strongly reduced D antigen densities. A normal exofacial Rh sequence may be accompanied by alloimmunization, as exemplified by the VS antigen of the RhCE protein caused by the transmembraneous L245V substitution.47 

Although multiple publication13,14,45,48-56 suggested a heterogeneity of weak D, a serologic classification of the majority of weak D phenotypes has not been successful. There was even no defined borderline between normal D and weak D.50,51,57,58 Our findings made the classification of weak D phenotypes feasible and their classification will allow us to correlate distinct alleles with clinical data. In the case that patients carrying certain molecular weak D types were prone to develop anti-D, our classification might guide a Rhesus negative transfusion policy. The availability of weak D samples that are characterized in regard to molecular structure and RhD antigen densities will promote the quality assurance of anti-D reagents. They should reliably type probands as RhD+, whose RhD proteins are not prone to frequent anti-D immunization.3 Therefore, the use of RhDred blood cell units for transfusions to weak D patients, which has been justified by a presumed potential for anti-D immunization, can finally be reduced to a minimum, which can be scientifically deduced.

Some RHD alleles described in the present study were more prevalent than previously known RHD alleles. The potential for a broader relevance in research was opened, as it became feasible to determine in a massive way the frequencies of molecularly defined rare alleles in natural populations. Poisson-like allele distributions were predicted by mathematical models59 that could so far not be checked in any real population. We observed two alleles (type 4 and 14) with multiple nucleotide substitutions in the RHD gene that were characteristic for the RHCE gene, but may not be explained by a single gene conversion event. This observation pointed to more complicated mechanisms shaping the allele polymorphism of homologous genes, which are frequent throughout the genomes.

ACKNOWLEDGMENT

We thank Olga Zarupski and Katharina Schmid for expert technical assistance.

Supported by the DRK-Blutspendedienst Baden-Württemberg, Stuttgart, Germany.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

REFERENCES

REFERENCES
1
Mollison
PL
Engelfriet
CP
Contreras
M
Blood Transfusion in Clinical Medicine.
1993
Blackwell
New York, NY
2
Stratton
F
A new Rh allelomorph.
Nature
158
1946
25
3
Wagner
FF
Kasulke
D
Kerowgan
M
Flegel
WA
Frequencies of the blood groups ABO, Rhesus, D category VI, Kell, and of clinically relevant high-frequency antigens in South-Western Germany.
Infusionsther Transfusionsmed
22
1995
285
4
Mourant
AE
Kopec
AC
Domaniewska-Sobczak
K
The distribution of the human blood groups and other polymorphisms.
1976
Oxford
New York, NY
5
Salmon
C
Cartron
J-P
Rouger
P
The Human Blood Groups.
1984
Masson
New York, NY
6
Huang
CH
Molecular insights into the Rh protein family and associated antigens.
Curr Opin Hematol
4
1997
94
7
Ceppellini
R
Dunn
LC
Turry
M
An interaction between alleles at the Rh locus in man which weakens the reactivity of the Rho factor (Du).
Proc Natl Acad Sci USA
41
1955
283
8
Mollison
PL
Engelfriet
CP
Contreras
M
Blood Transfusion in Clinical Medicine.
1987
Blackwell
New York, NY
9
Rouillac
C
Gane
P
Cartron
J-P
Le Pennec
PY
Colin
Y
Molecular basis of the altered antigenic expression of RhD in weak D (Du) and RhC/e in RN phenotypes.
Blood
87
1996
4853
10
Beckers
EA
Faas
BHW
Ligthart
P
Overbeeke
MA
von dem Borne
AE
van der Schoot
CE
van Rhenen
DJ
Lower antigen site density and weak D immunogenicity cannot be explained by structural genomic abnormalities or regulatory defects of the RHD gene.
Transfusion
37
1997
616
11
Beckers
EAM
Faas
BHW
Overbeeke
MAM
von dem Borne
AEGK
van Rhenen
DJ
van der Schoot
CE
Molecular aspects of the weak-D phenotype.
Transfusion
35
1995
50S
12
Kajii
E
Umenishi
F
Omi
T
Ikemoto
S
Intricate combinatorial patterns of exon splicing generate multiple Rh-related isoforms in human erythroid cells.
Hum Genet
95
1995
657
13
Avent
ND
Martin
PG
Armstrong-Fisher
SS
Liu
W
Finning
KM
Maddocks
D
Urbaniak
SJ
Evidence of genetic diversity underlying Rh D negative, weak D (Du) and partial D phenotypes as determined by multiplex PCR analysis of the RHD gene.
Blood
89
1997
2568
14
Legler
TJ
Maas
JH
Blaschke
V
Malekan
M
Ohto
H
Lynen
R
Bustami
N
Schwartz
DW
Mayr
WR
Kohler
M
Panzer
S
RHD genotyping in weak D phenotypes by multiple polymerase chain reactions.
Transfusion
38
1998
434
15
Gassner
C
Schmarda
A
Kilga-Nogler
S
Jenny-Feldkircher
B
Rainer
E
Müller
TH
Wagner
FF
Flegel
WA
Schönitzer
D
RhesusD/CE typing by polymerase chain reaction using sequence-specific primers.
Transfusion
37
1997
1020
16
Issitt
PD
Telen
MJ
D, weak D (Du), and partial D: The molecular story unfolds.
Transfusion
36
1996
97
17
Roubinet
F
Apoil
PA
Blancher
A
Frequency of partial D phenotypes in the south western region of France.
Transfus Clin Biol
3
1996
247
18
Fukumori
Y
Hori
Y
Ohnoki
S
Nagao
N
Shibata
H
Okubo
Y
Yamaguchi
H
Further analysis of Del (D-elute) using polymerase chain reaction (PCR) with RHD gene-specific primers.
Transfus Med
7
1997
227
19
Aubin
JT
Le Van Kim
C
Mouro
I
Colin
Y
Bignozzi
C
Brossard
Y
Cartron
J-P
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Br J Haematol
98
1997
356
20
Wissenschaftlicher Beirat der Bundesärztekammer, Bundesgesundheitsamt
Richtlinien zur Blutgruppenbestimmung und Bluttransfusion.
1992
Deutscher Ärzte-Verlag
Köln
21
Wagner
FF
Gassner
C
Müller
TH
Schönitzer
D
Schunter
F
Flegel
WA
Three molecular structures cause Rhesus D category VI phenotypes with distinct immunohematologic features.
Blood
91
1998
2157
22
Le Van Kim
C
Mouro
I
Cherif-Zahar
B
Raynal
V
Cherrier
C
Cartron
J-P
Colin
Y
Molecular cloning and primary structure of the human blood group RhD polypeptide.
Proc Natl Acad Sci USA
89
1992
10925
23
Kemp
TJ
Poulter
M
Carritt
B
A recombination hot spot in the Rh genes revealed by analysis of unrelated donors with the rare D—phenotype.
Am J Hum Genet
59
1996
1066
24
Arce
MA
Thompson
ES
Wagner
S
Coyne
KE
Ferdman
BA
Lublin
DM
Molecular cloning of RhD cDNA derived from a gene present in RhD-positive, but not RhD-negative individuals.
Blood
82
1993
651
25
Cartron
J-P
Rh DNA — coordinator’s report.
Transfus Clin Biol
3
1996
491
26
Rost
B
Casadio
R
Fariselli
P
Sander
C
Transmembrane helices predicted at 95% accuracy.
Protein Sci
4
1995
521
27
Hofmann
K
Stoffel
W
TMbase — a database of membrane spanning proteins segments.
Biol Chem Hoppe Seyler
347
1993
166
28
Scott
ML
Voak
D
Jones
JW
Liu
W
Avent
ND
Hughes-Jones
N
Sonneborn
H-H
A model for RhD — the relationship of 30 serologically defined epitopes to predicted structure.
Biotest Bulletin
5
1997
459
29
Dahr
W
Schmitz
G
Ernst
M
Gielen
W
Sonneborn
H-H
Rh antigens and cysteine modification.
Biotest Bulletin
5
1997
451
30
Avent
ND
Butcher
SK
Liu
W
Mawby
WJ
Mallinson
G
Parsons
SF
Anstee
DJ
Tanner
MJA
Localisation of the C-termini of the Rh polypeptides to the cytoplasmic face of the human erythrocyte membrane.
J Biol Chem
267
1992
15134
31
Hermand
P
Mouro
I
Huet
M
Bloy
C
Suyama
K
Goldstein
J
Cartron
J-P
Bailly
P
Immunochemical characterization of Rhesus proteins with antibodies raised against synthetic peptides.
Blood
82
1993
669
32
Liu
W
Jones
JW
Scott
ML
Voak
D
Avent
ND
Molecular analysis of two D-variants, DHMi and DHMii.
Transfus Med
6
1996
21
(suppl 2, abstr)
33
Lomas
C
Tippett
P
Thompson
KM
Melamed
MD
Hughes-Jones
NC
Demonstration of seven epitopes on the Rh antigen D using human monoclonal anti-D antibodies and red cells from D categories.
Vox Sang
57
1989
261
34
Wagner
FF
Hillesheim
B
Flegel
WA
D-Kategorie VII beruht einheitlich auf der Aminosäuresubstitution Leu(110)Pro.
Beitr Infusionsther Transfusionsmed
34
1997
220
35
Huang
CH
Alteration of RH gene structure and expression in human dCCee and DCW-red blood cells: Phenotypic homozygosity versus genotypic heterozygosity.
Blood
88
1996
2326
36
Cherif-Zahar
B
Raynal
V
Gane
P
Mattei
MG
Bailly
P
Gibbs
B
Colin
Y
Cartron
J-P
Candidate gene acting as a suppressor of the RH locus in most cases of Rh-deficiency.
Nat Genet
12
1996
168
37
Huang
CH
Chen
Y
Reid
ME
Seidl
C
Rhnull disease: The amorph type results from a novel double mutation in RhCe gene on D-negative background.
Blood
92
1998
664
38
Cherif-Zahar
B
Matassi
G
Raynal
V
Gane
P
Mempel
W
Perez
C
Cartron
JP
Molecular defects of the RHCE gene in Rh-deficient individuals of the amorph type.
Blood
92
1998
639
39
Huang
CH
The human Rh50 glycoprotein gene: Structural organization and associated splicing defect resulting in Rhnull disease.
J Biol Chem
273
1998
2207
40
Smythe
JS
Avent
ND
Judson
PA
Parsons
SF
Martin
PG
Anstee
DJ
Expression or RHD and RHCE gene products using retroviral transduction of K562 cells establishes the molecular basis of RH blood group antigens.
Blood
87
1996
2968
41
Avent
ND
Jones
JW
Liu
W
Scott
ML
Voak
D
Flegel
WA
Wagner
FF
Green
C
Molecular basis of the D variant phenotypes DNU and DII allows localization of critical amino acids required for expression of Rh D epitopes epD3, 4 and 9 to the sixth external domain of the Rh D protein.
Br J Haematol
97
1997
366
42
Rouillac
C
Le Van Kim
C
Beolet
M
Cartron
J-P
Colin
Y
Leu110Pro substitution in the RhD polypeptide is responsible for the DVII category blood group phenotype.
Am J Hematol
49
1995
87
43
Jones
JW
Finning
KM
Mattock
R
Voak
D
Scott
ML
Avent
ND
The serological profile and molecular basis of a new partial D phenotype, DHR.
Vox Sang
73
1997
252
44
Flegel
WA
Wagner
FF
RHD epitope density profiles of RHD variant red cells analyzed by flow cytometry.
Transfus Clin Biol
3
1996
429
45
Jones
JW
Lloyd-Evans
P
Kumpel
BM
Quantitation of Rh D antigen sites on weak D and D variant red cells by flow cytometry.
Vox Sang
71
1996
176
46
Huang
CH
Chen
Y
Reid
M
Human DIIIa erythrocytes: RhD protein is associated with multiple dispersed amino acid variations.
Am J Hematol
55
1997
139
47
Faas
BHW
Becker
EAM
Wildoer
P
Ligthart
PC
Overbeeke
MAM
Zondervan
HA
von dem Borne
AEGK
van der Schoot
CE
Molecular background of VS and weak C expression in blacks.
Transfusion
37
1997
38
48
Wagner
FF
Influence of Rh phenotype on the antigen density of C, c, and D: Flow cytometric study using a frozen standard red cell.
Transfusion
34
1994
671
49
Hasekura
H
Ota
M
Ito
S
Hasegawa
Y
Ichinose
A
Fukushima
H
Ogata
H
Flow cytometric studies of the D antigen of various Rh phenotypes with particular reference to Du and Del.
Transfusion
30
1990
236
50
Nicholson
G
Lawrence
A
Ala
FA
Bird
GWG
Semi-quantitative assay of D antigen site density by flow cytometric analysis.
Transfus Med
1
1991
87
51
Nelson
M
Barrow
LA
Popp
H
Gibson
J
Some observations on D antigen expression of D-positive and ‘weak D-positive’ red cells as assessed by flow cytometry.
Vox Sang
69
1995
152
52
Tazzari
PL
Bontadini
A
Belletti
D
Malferrari
F
Conte
R
Flow cytometry: A tool in immunohematology for D+W (Du) antigen evaluation?
Vox Sang
67
1994
382
53
Jones
J
Filbey
D
Selection of monoclonal antibodies for the identification of D variants: Ability to detect weak D and to split epD2, epD5 and epD6/7.
Vox Sang
70
1996
173
54
Szymanski
IO
Araszkiewicz
P
Quantitative studies on the D antigen of red cells with the Du phenotype.
Transfusion
29
1989
103
55
Sonneborn
H-H
Darda
C
Ernst
M
Flegel
WA
Helmbold
W
Kasulke
D
Kühnl
P
Mueller-Eckhardt
C
Northoff
H
Poschmann
A
Schönitzer
D
Schütt
K-H
Schunter
F
Results of the DGTI workshop on the evaluation of the reactivity of monoclonal anti-D.
Beitr Infusionsther Transfusionsmed
30
1992
382
56
Gorick
B
McDougall
DCJ
Ouwehand
WH
Overbeeke
MAM
Tippett
P
Hughes-Jones
NC
van Rhenen
DJ
Quantitation of D sites on selected ‘weak D’ and ‘partial D’ red cells.
Vox Sang
65
1993
136
57
Moore
BPL
Does knowledge of Du status serve a useful purpose?
Vox Sang
46S1
1984
95
58
Agre
PC
Davies
DM
Issitt
PD
Lamy
BM
Schmidt
PJ
Treacy
M
Vengelen-Tyler
V
A proposal to standardize terminology for weak D antigen (Letter).
Transfusion
32
1992
86
59
Joyce
P
Tavare
S
The distribution of rare alleles.
J Math Biol
33
1995
602
60
Poulter
M
Kemp
TJ
Carritt
B
DNA-based Rhesus typing: Simultaneous determination of RHC and RHD status using the polymerase chain reaction.
Vox Sang
7
1996
164
61
Mouro
I
Colin
Y
Cherif-Zahar
B
Cartron
J-P
Le Van Kim
C
Molecular genetic basis of the human Rhesus blood group system.
Nat Genet
5
1993
62

Author notes

Address reprint requests to Willy A. Flegel, Priv-Doz, MD, Abteilung Transfusionsmedizin, Universitätsklinikum Ulm, and DRK-Blutspendedienst Baden-Württemberg, Institut Ulm, Helmholtzstrasse 10, D-89081 Ulm, Germany; e-mail: waf@ucsd.edu.