Abstract

Patients with Omenn’s syndrome have a form of severe immune deficiency that is associated with pathological features of graft-versus-host disease, except for the lack of foreign engraftment. It has been hypothesized that the disease’s unique clinical features are mediated by an expanded population of autologous self-reactive T cells of limited clonality. In the current study, an investigation of the T-cell receptor (TCR) repertoire was undertaken to identify defects in T-cell rearrangement and development. The TCR repertoire in this group of patients was exquisitely restricted in the number of different TCR clonotypes, and some of these clonotypes seemed to have similar recognition motifs in the antigen-binding region, indicating antigen-driven proliferation of T lymphocytes. The TCRs from some patients lacked N- or P-nucleotide insertions and used proximal variable and joining gene segments, suggesting abnormal intrathymic T-cell development. Finally, abnormal assembly of gene segments and truncated rearrangements within nonproductive alleles suggested abnormalities in TCR rearrangement mechanisms. Overall, the findings suggest that inefficient and/or abnormal generation of TCRs may be a consistent feature of this disease.

OMENN’S SYNDROME was initially described in 1968 by Gilbert Omenn as an immunodeficiency disease with autoimmune features resembling graft-versus-host disease (GvHD).1 The origin of this disease seems to result from a variety of genetic and, perhaps, primary immunologic mechanisms that converge to result in a homogenous pathological picture of autologous GvHD in the context of an oligoclonal expansion of activated T cells. The original reports described the members of a single extended family, in which the inheritance pattern and consanguinity suggested an autosomal recessive inheritance of the disease.1-3 Since that time, cases with similar manifestations but different patterns of inheritance have been described.4-7 For example, a sibling of a patient with severe combined immune deficiency (SCID) developed Omenn’s syndrome, prompting the hypothesis that some patients with Omenn’s syndrome may represent a “leaky” form of SCID.5,8 Arguments that Omenn’s syndrome represents true GvHD in patients with SCID have been discounted by the lack of evidence for engrafted lymphocytes.9,10 Partial recombinase activating gene (RAG) defects have been recently described in many of these patients.11 Here we report, for the first time, an infant with the DiGeorge anomaly and chromosome 22q11 deletion who developed Omenn’s syndrome. Thus, both intrinsic defects in VDJ (variable, diversity, joining) recombination as well as defects in thymic development may lead to SCID with GvHD-like autoimmunity (Omenn’s syndrome).

The primary goal in our investigation was to seek evidence for common abnormalities in T-cell development, T-cell receptor (TCR) repertoire, and assembly of TCRs within these patients by examining the productive and nonproductive TCR transcripts in the circulating T-cell populations. The results showed that the TCR repertoires were not only exquisitely restricted in the number of different TCR clonotypes, but some of these clonotypes seemed to have similar recognition motifs in the antigen-binding region, indicating antigen-driven proliferation of T lymphocytes. Decreased N- and P-nucleotide insertions and usage of proximal gene segments found in some patients may be consistent with abnormal T-cell development. Abnormal assembly of gene elements and truncated rearrangements were found within nonproductive alleles indicative of abnormalities in TCR rearrangement mechanisms.

MATERIALS AND METHODS

Case Reports

A summary of clinical features and peripheral blood T-cell phenotypes is shown in Tables 1 and 2. Cases 3 through 7 have been previously described.7,12,13 

Table 1.

Clinical Characteristics

Cases
1 2 3 45 6 7
Age of onset (erythroderma)  2 mo  2 mo 2 wk  4 mo  4 mo  2 mo  2 wk  
Facial anomalies  −  −  +++  −  −  −  
Thymic abnormalities  +++  na* ++  +++  na  na  ++ 
Erythroderma/exfoliative dermatitis  ++  ++  +  +++ +  +  +  
Hepatomegaly  ++  ++  ++  ++  +++ ++  +  
Lymphadenopathy  ++  ++  ++  +++  +++ ++  +  
Diarrhea  ++  ++  ++  ++  ++  +++ ++  
Failure to thrive  +  ++  +  +++  ++  +++ +  
Pulmonary edema  ++  −  −  ++  −  − −  
Lymphocytosis  +  nl  nl  +++  nl  ++ +  
Eosinophilia  +  +  ++  ++  nl  +  
IgG  nl  dec  dec  dec  dec  dec  nl  
IgE na  inc  inc  na  inc  inc  inc 
Cases
1 2 3 45 6 7
Age of onset (erythroderma)  2 mo  2 mo 2 wk  4 mo  4 mo  2 mo  2 wk  
Facial anomalies  −  −  +++  −  −  −  
Thymic abnormalities  +++  na* ++  +++  na  na  ++ 
Erythroderma/exfoliative dermatitis  ++  ++  +  +++ +  +  +  
Hepatomegaly  ++  ++  ++  ++  +++ ++  +  
Lymphadenopathy  ++  ++  ++  +++  +++ ++  +  
Diarrhea  ++  ++  ++  ++  ++  +++ ++  
Failure to thrive  +  ++  +  +++  ++  +++ +  
Pulmonary edema  ++  −  −  ++  −  − −  
Lymphocytosis  +  nl  nl  +++  nl  ++ +  
Eosinophilia  +  +  ++  ++  nl  +  
IgG  nl  dec  dec  dec  dec  dec  nl  
IgE na  inc  inc  na  inc  inc  inc 

Abbreviations: na, not assessed; nl, normal; dec, decreased; inc, increased.

Table 2.

Peripheral Blood T-Cell Subsets (%)

CD3 CD4 CD8 CD4/8*TCRαβ+TCRγδ
Case 1  57  16  34  na  na  
Case 2  59  40  19  59  1.1  
Case 3  80  13  12  55  69  na 
Case 4  95  5  24  61  90  3    
Case 5 50  43  17  0  42  na  
Case 6  50  39 17  0  51  na  
Case 7  68  40  37  0  na 
CD3 CD4 CD8 CD4/8*TCRαβ+TCRγδ
Case 1  57  16  34  na  na  
Case 2  59  40  19  59  1.1  
Case 3  80  13  12  55  69  na 
Case 4  95  5  24  61  90  3    
Case 5 50  43  17  0  42  na  
Case 6  50  39 17  0  51  na  
Case 7  68  40  37  0  na 

Numbers represent the % of peripheral blood lymphocytes as gated on forward and side scatter.

Abbreviation: na, not assessed.

*

Calculated value.

Case 1.

A female infant was born with facial features consistent with the DiGeorge syndrome. She had hypocalcemia, absence of a thymic shadow on chest roentgenogram, severe lymphopenia, and absent responses to mitogens. She had no cardiac abnormalities. Fluorescent in situ hybridization analysis showed a deletion within the region of chromosome 22q11. At 2 months of age her lymphocyte numbers increased dramatically, and she developed erythroderma, hepatosplenomegaly, lymphadenopathy, chronic diarrhea, and respiratory distress. Maternal engraftment could not be detected by serological techniques in peripheral blood lymphocytes (PBLs) or by polymerase chain reaction (PCR) analysis of class II HLA alleles in B- and T-cell lines derived from the patient.

Case 2.

A female infant developed exfoliative dermatitis, failure to thrive, and chronic diarrhea at 1 month of age. She subsequently developed progressive lymphadenopathy and splenomegaly. Her laboratory evaluation at 6 weeks of age showed mild lymphopenia (absolute lymphocyte count, 1,100 to 1,500/μL), hypogammaglobulinemia (IgG 236 mg/dL, IgM 27 mg/dL, and IgA <7 mg/dL), and elevated IgE (2,617 U/mL). The phenotype of her peripheral blood T cells was normal and HLA typing showed no engraftment with maternal lymphocytes.

Case 3.

A female infant developed chronic diarrhea soon after birth and dermatitis at 1 month of age.7 A skin biopsy was believed to be consistent with GvHD and the patient was treated with prednisone and CsA with subsequent control of the dermatitis. She subsequently developed recurrent infections (otitis media, conjunctivitis, and bacterial and Candida sepsis), hepatomegaly, lymphadenopathy, eosinophilia, and hemolytic anemia. The family history was significant in that a female first cousin with SCID died after haploidentical T-cell–depleted bone marrow transplantation. Her laboratory evaluation showed normal serum IgG, absent IgA and IgE, and low IgM concentrations. Her PBLs ranged from 1,200 to 4,200/μL and did not respond to T- and B-cell mitogens. The patient’s T-cell phenotype was dominated by TCRαβ+ CD4CD8 T cells at the time specimens for this study were obtained. Restriction fragment length polymorphism analysis did not detect maternal engraftment.

Case 4.

This previously reported white male was characterized by severe craniofacial anomalies distinct from those described in the DiGeorge anomaly and consisted of malformed ears and external auditory canals, a fish-shaped mouth, and cleft palate.12,13 He had a massive expansion of TCRαβ CD4CD8 T cells in the peripheral blood, skin, and lymph nodes. He developed chronic sino-pulmonary infections, oral thrush, severe exfoliative dermatitis, pulmonary edema, chronic diarrhea, and massive lymphadenopathy and lymphocytosis. When the patient was placed on CsA, there was a dramatic improvement in the dermatitis, eosinophilia, and lymphocytosis. Karyotyping and lymphocyte typing failed to show engraftment of maternal lymphocytes.

Case 5.

The parents of this male infant were second cousins.7 He was born full term and remained healthy until 4 months of age when he first developed severe oral and perineal candidiasis followed by severe seborrheic dermatitis unresponsive to medical therapy. At 7 months of age he developed Pneumocystis carinii pneumonia (PCP). Laboratory testing showed absent IgG and IgA, depressed IgM, and an elevated IgE, which ranged from 482 to 6,140 IU/mL. Absolute numbers of lymphocytes ranged from 500 to 2,400/μL and eosinophils from 1,160 to 9,100/μL. Isohemagglutinins and titres to diphtheria and tetanus were negative; mitogens were profoundly depressed. Over the next several months the dermatitis progressed to alopecia, and the patient developed massive lymphadenopathy and hepatomegaly. When he was treated with CsA at 15 months of age there was remarkable improvement in skin manifestations, hair regrowth, and a significant reduction in lymph node and liver size.

Case 6.

A male infant experienced failure to thrive since birth and intermittent diarrhea.7 Dermatitis appeared at 2 months of age. Severe PCP and Candida pneumonia were treated during the first 6 months of life. Lymphadenopathy was prominent. IgG, A, and M were decreased, and IgE was elevated. Proliferation to standard mitogens was 5% to 15% of normal. Lymphocyte counts ranged from 1,580 to 6,200/μL. No maternal engraftment was detected. An older brother, who died of opportunistic infections, also had a clinical history consistent with Omenn’s syndrome.

Case 7.

This male infant developed jaundice at 1 week of age followed by chronic diarrhea.7 By 1 month of age he exhibited severe dermatitis and had failure to thrive. At 9 months of age chronic PCP was diagnosed. Absolute lymphocyte counts ranged from 1,500 to 5,000/μL, and eosinophilia was noted. IgG, A, and M were in the normal range, but IgE levels ranged as high as 10,000 IU/mL. Proliferation to mitogens was minimal, and isohemagglutinins and specific antibody titres were negative. The patient subsequently experienced multiple episodes of bacterial (gram negative and positive) sepsis.

Inverse PCR

To estimate the frequency of T-cell clones in the peripheral blood and determine the TCR sequences, inverse PCR was used as described.14 Briefly, total RNA was extracted from PBL using oligo dT-Sepharose chromatography (Pharmacia, Gaithersburg, MD) and cDNA synthesized using reverse transcriptase (GIBCO-BRL, Gaithersburg, MD) and oligo dT priming. Double-stranded cDNA was generated using RNase H, Escherichia coli. DNA polymerase I and DNA ligase were followed by T4 DNA polymerase for blunt ending. The cDNAs were then circularized with T4 DNA ligase and used as a template in the PCR using primers for either the α- or β-chain constant (C) region genes. In most cases, nested primers were used to reamplify products to increase quantity and specificity. The PCR primers used were as follows: Cα inverse, 5′ CCCTGCTATGCTGTGTGTCT 3′; Cα inverse nested primer, 5′ TCCTGCTGCCGATGCCTTCATT 3′; Cα forward, 5′ AGACCTCATGTCTAGCACAGT 3′; Cα forward nested primer, 5′ GCAGACAGACTTGTCACTGGATT 3′; Cβ inverse, 5′ TGCCACCATCCTCTATGAGATC 3′; Cβ inverse nested primer, 5′ GCCATGGTCAAGAGAAAGGAT 3′; Cβ forward, 5′ GCCTTTTCCCTGTGGGAGAT 3′; Cβ forward nested primer, 5′ AACACAGCGACCTCGGGTG 3′.

DNA Sequencing and Analysis

The amplified DNA was then inserted into a bacterial plasmid vector (PCr II; Invitrogen, San Diego, CA), cloned into E coli, and plated onto selective medium. Individual colonies were selected and sequenced using the dideoxy chain-termination method (Amersham, Arlington, Heights, IL). Sequences obtained were compared with a TCR database derived from the GenBank database (National Library of Medicine, Bethesda, MD). Sequence similarities and junctions were identified using a computer search program developed in this laboratory (TCR IDENTIFY program; Steven Jowers, Michael Kulvicki and Edward Brooks, unpublished observation, 1996), which uses algorithms available from Genetics Computer Group (Madison, WI) software package. Nomenclature for the TCR genomic sequences were according to Rowen et al,15 Slightom et al,16Koop et al,17 and Arden et al.18 Analyses of complementarity determining region-3 (CDR3) lengths were calculated as the number of amino acids between the terminal V-region cysteine and the J-region motif, GXG, minus four. Statistical analyses were performed on Quatro Pro software, version 6.0, (Corel Corp, Ottawa, Ontario, Canada).

T-Cell Clones

T-cells were obtained from peripheral blood and cultured in the presence of interleukin-2 (IL-2) and phytohemaglutinin (PHA) as described.19,20 Cultures were stimulated every 2 to 3 weeks with irradiated B-lymphoblastoid cells and PHA in IL-2 containing culture medium. After several months in culture, flow cytometry was performed using fluorescein and phycoerythrin-labeled monoclonal antibodies (Becton Dickinson, San Jose, CA) directed against the TCRαβ (WT31) CD4 (Leu3) and CD8 (Leu2a). Without subcloning, the dominant cells within the cultures were >98% TCRαβ CD4 CD8. To isolate mRNA as described above, 2 to 5 × 106 cells were used. Only one productive TCR was identified from the T-cell lines obtained from patients 1 and 4. In patient 4, two subclones were isolated that bore identical TCRs. The fact that only one T cell dominated each of the T-cell cultures was consistent with the oligoclonality in these patients.

RESULTS AND DISCUSSION

TCRα and β sequences were obtained from peripheral blood samples from each of the patients described. The results of those analyses are shown in Tables3through 8. Because of the ability of this technique to amplify any mRNA transcript containing the target C region sequences, both productively and nonproductively rearranged TCR alleles were identified and analyzed. All germline VDJ genes were identical to previously described genes, although previously unrecognized polymorphisms could not be excluded. Abnormal recombinations within homologous regions of different V and J genes, previously reported in certain PCR techniques, were not observed.21,22 

Table 3.

Productive Sequences: TCRβ

Clone No. No. of Unique mRNA Transcripts IdentifiedNDN CDR3 Length3-151
Case 1  
 1  3  3.13-150 . . .  CASSL TGG TEAFFG  . . .  1.1  8  
 2  14.1  . . .  C  MGL  QFFG  . . .  2.1  
 3  1  14.13-150 . . .  CASSL  QG TEAFFG  . . .  1.1  7  
 4  1  5.13-150 . . . CASSL  AGSQRRA  SYEQYFG  . . .  2.73-150 13 
 5  1  5.13-150 . . .  CASSL  AR NTEAFFG  . . .  1.13-150 8  
 6  1  5.13-150 . . . CASSL  HRGGK  NQPQHFG  . . .  1.5  11 
 7  1  ?  . . .  CASS  QGLGKG EAFFG  . . .  1.1  9  
 c  —  17.1  . . .  CASS  PGQGFG  YNEGFFG  . . .  2.1  
 
Case 2  
  1  4  12.23-150 . . .  CAISES KDRGS  ETQYFG  . . .  2.5  11  
  2 1  8.1  . . .  CAS  TMDRV  NQPQHFG  . . .  1.5  9  
  3  1  13.3  . . .  CAS IMDVF  TEAFFG  . . .  1.1  8  
  4 1  8.13-150 . . .  CASSL  TAQL  QYFG  . . .  2.4 7  
  5  1  6.5  . . .  CASS  YGQR  EQYFG . . .  2.7  7  
  6  1  13.6  . . .  CASS LDKAG  TEAFFG  . . .  1.1  9  
  7  1  13.63-150 . . .  CASSY  VGL  NTEAFFG  . . .  1.13-150 9  
  8  1  2.1   . .  CSA  PRVG GELFFG  . . .  2.2  7  
  9  1  21.43-150 . . . CASSL  RIT  NTGEIFFG  . . .  2.23-150 10  
 10  22.1  . . .  CAS  TRLTTT  NEQFFG  . . .  2.1 9  
 
Case 3  
 1  14  15.13-150 . . .  CATSDL GG NQPQHFG  . . .  1.5  9  
 2  11.1  . . .  CASS  ITGD  TEAFFG  . . . 1.1  8  
 3  3  3.13-150 . . .  CASSL GG YGYTFG  . . .  1.2  7  
 
Case 4 
 1  5  3.1  . . .  CASS  WDN  YEQYFG  . . . 2.7  7  
 2  1  3.13-150 . . .  CASSL  ---  STDTQYFG  . . .  2.33-150 7  
 3  1  6.7  . . . CASS  LRTSRRV  EQYFG  . . .  2.7  11  
 4  5.1  . . .  CASS  PSGGL  NQPQHFG  . . . 1.5  10  
 c  —  3.1  . . .  CASS RG TEAFFG  . . .  1.1  7  
 
Case 5 
 1  1  6.5  . . .  CASS  PGTNTEAFFG  . . .  1.13-150 9  
 
Case 6  
 1  6.43-150 . . .  CASSL  GLGPH  EQYFG  . . . 2.7  9  
 
Case 7  
 —  none  
Clone No. No. of Unique mRNA Transcripts IdentifiedNDN CDR3 Length3-151
Case 1  
 1  3  3.13-150 . . .  CASSL TGG TEAFFG  . . .  1.1  8  
 2  14.1  . . .  C  MGL  QFFG  . . .  2.1  
 3  1  14.13-150 . . .  CASSL  QG TEAFFG  . . .  1.1  7  
 4  1  5.13-150 . . . CASSL  AGSQRRA  SYEQYFG  . . .  2.73-150 13 
 5  1  5.13-150 . . .  CASSL  AR NTEAFFG  . . .  1.13-150 8  
 6  1  5.13-150 . . . CASSL  HRGGK  NQPQHFG  . . .  1.5  11 
 7  1  ?  . . .  CASS  QGLGKG EAFFG  . . .  1.1  9  
 c  —  17.1  . . .  CASS  PGQGFG  YNEGFFG  . . .  2.1  
 
Case 2  
  1  4  12.23-150 . . .  CAISES KDRGS  ETQYFG  . . .  2.5  11  
  2 1  8.1  . . .  CAS  TMDRV  NQPQHFG  . . .  1.5  9  
  3  1  13.3  . . .  CAS IMDVF  TEAFFG  . . .  1.1  8  
  4 1  8.13-150 . . .  CASSL  TAQL  QYFG  . . .  2.4 7  
  5  1  6.5  . . .  CASS  YGQR  EQYFG . . .  2.7  7  
  6  1  13.6  . . .  CASS LDKAG  TEAFFG  . . .  1.1  9  
  7  1  13.63-150 . . .  CASSY  VGL  NTEAFFG  . . .  1.13-150 9  
  8  1  2.1   . .  CSA  PRVG GELFFG  . . .  2.2  7  
  9  1  21.43-150 . . . CASSL  RIT  NTGEIFFG  . . .  2.23-150 10  
 10  22.1  . . .  CAS  TRLTTT  NEQFFG  . . .  2.1 9  
 
Case 3  
 1  14  15.13-150 . . .  CATSDL GG NQPQHFG  . . .  1.5  9  
 2  11.1  . . .  CASS  ITGD  TEAFFG  . . . 1.1  8  
 3  3  3.13-150 . . .  CASSL GG YGYTFG  . . .  1.2  7  
 
Case 4 
 1  5  3.1  . . .  CASS  WDN  YEQYFG  . . . 2.7  7  
 2  1  3.13-150 . . .  CASSL  ---  STDTQYFG  . . .  2.33-150 7  
 3  1  6.7  . . . CASS  LRTSRRV  EQYFG  . . .  2.7  11  
 4  5.1  . . .  CASS  PSGGL  NQPQHFG  . . . 1.5  10  
 c  —  3.1  . . .  CASS RG TEAFFG  . . .  1.1  7  
 
Case 5 
 1  1  6.5  . . .  CASS  PGTNTEAFFG  . . .  1.13-150 9  
 
Case 6  
 1  6.43-150 . . .  CASSL  GLGPH  EQYFG  . . . 2.7  9  
 
Case 7  
 —  none  

Abbreviations: ---, absence of any D- or N-region–encoded sequences; _, germline D-region–encoded amino acids; c, the TCR was derived from a T-cell clone.

F3-150

Indicates usage of full-length germline-encoded sequences.

F3-151

Range, 7 to 13; mean, 8.62; median, 9; variance, 2.5; skew, 0.83; kurtosis, 0.55.

Table 4.

Productive Sequences: TCR

Clone No. No. of Unique mRNA Transcripts IdentifiedN CDR3 Length4-151
Case 1 
 1  1  14.1  . . .  CS  FMN  TGANSKLTFG  . . .  564-150 9  
 2  1  23.1  . . .  CA  VL GGSNYKLTFG  . . .  54  7  
 
Case 2  
 1  22.1  . . .  C  GTEIQ  AAGNKLTFG  . . .  17  
 2  3  4.2  . . .  CI  ARD  TGNQFYFG  . . . 49  7  
 3  2  6.1  . . .  CA  MRELGLD DYKLSFG  . . .  20  10  
 4  1  11.1  . . . CA  VP  GSGNTGKLIFG  . . .  37  9  
 5  2.8  . . .  CV  IPY  TGGFKTIFG  . . .  9  
 
Case 3  
 1  1  12.1  . . .  CA  LKE GYQKVTFG  . . .  13  7  
 2  8  20.1  . . . CA  VRG  RDDKIIFG  . . .  30  7  
 3  14.1  . . .  CA  FMRP  GGGADGLTFG  . . .  45 10  
 4  3  28.1  . . .  CA  V  DRGSTLGRLYFG . . .  18  9  
 5  2  17.2  . . .  CA  AS NSGGSNYKLTFG  . . .  544-150 10  
 6  1  2.5 . . .  C  VV  NTGNQFYFG  . . .  494-150 
 
Case 4  
 1  2  23.1  . . .  CA  VS GNQFYFG  . . .  49  5  
 2  1  3.1  . . . CA  TIEVLG  YQLTFG  . . .  28  8  
 3  6.1  . . .  CA  MRQA  SGGYQKVTFG  . . .  13 10  
 4  1  18.2  . . .  CA  LPLP  SGGYNKLIFG . . .  4  10  
 5  2  3.1  . . .  CA  TAV FSGGYNKLIFG  . . .  44-150 10  
 6  2  5.1 . . .  CA  LD  TGGFKTIFG  . . .  9  
 
Case 5  
 1  7  3.1  . . .  CA  TC SNDYKLSFG  . . .  204-150 7  
 2  1  4.3 . . .  CI  VRVPS  DYKLSFG  . . .  20  8  
 3 1  13.1  . . .  CA  DRM  NSGGSNYKLTFG  . . . 544-150 11  
 4  1  21.1  . . .  CA  AIL SGTYKYIFG  . . .  40  8  
 5  2  17.2  . . . CA  ASA  GGGADGLTFG  . . .  45  9  
 6  19.1  . . .  CA  YYWD  GGSQGNLIFG  . . .  42 10  
 7  1  7.4  . . .  CA  VPLGT  TGKLIFG . . .  37  12  
 
Case 6  
 1  5  18.1  . . . CA  LRG  GSNYKLTFG  . . .  54  8  
 2  14.1  . . .  CA  YRSA  TGANSKLTFG  . . .  56 10  
 3  1  14.1  . . .  CA  YRSV  YNTDKLIFG . . .  34  9  
 4  1  2.8  . . .  CV  NTGGFKTIFG  . . .  9  7  
 5  1  12.1  . . . CA  VL  GGSNYKLTFG  . . .  54  8  
 
Case 7 
 1  3  23.1  . . .  CA  PD  NNDMRFG  . . . 43  5  
 2  1  14.1  . . .  CA  NTGNQFYFG  . . .  494-150 6  
 3  1  14.1 . . .  CA  YKNRR  NYGGSQGNLIFG  . . .  424-150 13  
 4  1  4.3  . . .  CI  LRDG  YSGAGSYQLTFG . . .  28  12  
 5  1  20.1  . . .  CA  VEG TTGTASKLTFG  . . .  44  10 
Clone No. No. of Unique mRNA Transcripts IdentifiedN CDR3 Length4-151
Case 1 
 1  1  14.1  . . .  CS  FMN  TGANSKLTFG  . . .  564-150 9  
 2  1  23.1  . . .  CA  VL GGSNYKLTFG  . . .  54  7  
 
Case 2  
 1  22.1  . . .  C  GTEIQ  AAGNKLTFG  . . .  17  
 2  3  4.2  . . .  CI  ARD  TGNQFYFG  . . . 49  7  
 3  2  6.1  . . .  CA  MRELGLD DYKLSFG  . . .  20  10  
 4  1  11.1  . . . CA  VP  GSGNTGKLIFG  . . .  37  9  
 5  2.8  . . .  CV  IPY  TGGFKTIFG  . . .  9  
 
Case 3  
 1  1  12.1  . . .  CA  LKE GYQKVTFG  . . .  13  7  
 2  8  20.1  . . . CA  VRG  RDDKIIFG  . . .  30  7  
 3  14.1  . . .  CA  FMRP  GGGADGLTFG  . . .  45 10  
 4  3  28.1  . . .  CA  V  DRGSTLGRLYFG . . .  18  9  
 5  2  17.2  . . .  CA  AS NSGGSNYKLTFG  . . .  544-150 10  
 6  1  2.5 . . .  C  VV  NTGNQFYFG  . . .  494-150 
 
Case 4  
 1  2  23.1  . . .  CA  VS GNQFYFG  . . .  49  5  
 2  1  3.1  . . . CA  TIEVLG  YQLTFG  . . .  28  8  
 3  6.1  . . .  CA  MRQA  SGGYQKVTFG  . . .  13 10  
 4  1  18.2  . . .  CA  LPLP  SGGYNKLIFG . . .  4  10  
 5  2  3.1  . . .  CA  TAV FSGGYNKLIFG  . . .  44-150 10  
 6  2  5.1 . . .  CA  LD  TGGFKTIFG  . . .  9  
 
Case 5  
 1  7  3.1  . . .  CA  TC SNDYKLSFG  . . .  204-150 7  
 2  1  4.3 . . .  CI  VRVPS  DYKLSFG  . . .  20  8  
 3 1  13.1  . . .  CA  DRM  NSGGSNYKLTFG  . . . 544-150 11  
 4  1  21.1  . . .  CA  AIL SGTYKYIFG  . . .  40  8  
 5  2  17.2  . . . CA  ASA  GGGADGLTFG  . . .  45  9  
 6  19.1  . . .  CA  YYWD  GGSQGNLIFG  . . .  42 10  
 7  1  7.4  . . .  CA  VPLGT  TGKLIFG . . .  37  12  
 
Case 6  
 1  5  18.1  . . . CA  LRG  GSNYKLTFG  . . .  54  8  
 2  14.1  . . .  CA  YRSA  TGANSKLTFG  . . .  56 10  
 3  1  14.1  . . .  CA  YRSV  YNTDKLIFG . . .  34  9  
 4  1  2.8  . . .  CV  NTGGFKTIFG  . . .  9  7  
 5  1  12.1  . . . CA  VL  GGSNYKLTFG  . . .  54  8  
 
Case 7 
 1  3  23.1  . . .  CA  PD  NNDMRFG  . . . 43  5  
 2  1  14.1  . . .  CA  NTGNQFYFG  . . .  494-150 6  
 3  1  14.1 . . .  CA  YKNRR  NYGGSQGNLIFG  . . .  424-150 13  
 4  1  4.3  . . .  CI  LRDG  YSGAGSYQLTFG . . .  28  12  
 5  1  20.1  . . .  CA  VEG TTGTASKLTFG  . . .  44  10 
F4-150

Indicates usage of full-length germline-encoded sequences.

F4-151

Range, 5 to 13; mean, 8.4; median, 9; variance, 2.7; skew, 0.13; kurtosis, −.21.

Table 5.

Shared CDR3 Motifs

Motif Case Clone CDR35-150
β1  2  SESKDRGSETQ  
 2  SLDKAGTE
 
α1  1  2  VLGGSNYKL 
 6  VLGGSNYKL 
 
α2  3  6  VNTGNQF 
 7  2  FNTGNQF 
 
α3  6  YRSATGANSKL 
 6  3  YRSVYNTDKL 
Motif Case Clone CDR35-150
β1  2  SESKDRGSETQ  
 2  SLDKAGTE
 
α1  1  2  VLGGSNYKL 
 6  VLGGSNYKL 
 
α2  3  6  VNTGNQF 
 7  2  FNTGNQF 
 
α3  6  YRSATGANSKL 
 6  3  YRSVYNTDKL 
F5-150

Amino acids shown in bold are identical; conservative differences are underlined. Gaps are introduced to maximize line-up of like amino acids. CDR3s were defined as those amino acids beginning at the third (second for α) amino acid 3′ of the terminal 3′ V-region cysteine and ending three nucleotides 5′ of the J-region motif GXG.

Table 6.

Nonproductive Sequences

TCRβ TCRα
Case 1  //BJ2S4/BC2  AV14S1#AJ55/AC 
 BC1  AV12S5#AJ54/AC  
 BD1 5′intron/BC1 AV2S5#AJ55/AC  
 //BJ2S5…BJ2S6/BC1  //AJ49/AC 
 BC1 exon 4/BC1 exon 1/BC1  AJ54-AJ53 intron/AC  
 
Case 2  BV2.1#BJ2.5/BC2  AV17S2#AJ3/AC  
 …BD1/BJ2S4/BC2 AV12S1#AJ49/AC  
 …BD1/BJ1S1/BC1  AV18S2#AJ32/AC 
 …BD1/BJ1S5/BC1  //AJ6/AC  
 …BD1/BJ1S6/BC1 //AJ30/AC  
 …BJ1S5/BC1  
 …BJ2S3/BC2 
 //BJ2S5/BC2  
 //BJ2S2/BC2  
 
Case 3  //BJ2S3/BC2 AV2S8#AJ49*/AC  
  //AJ45/AC  
  //AJ13/AC 
  //AJ11/5′ AC intron/AC  
 
Case 4  //BD1/BJ1S1/BC1 AV?#AJ3/AC  
 //BJ2S3/BC2  AV18S2#AJ18/AC 
 //BJ2S4/BC2  AV13S1#AJ29/AC  
 //BJ2S5/BC2 AV13.1#AJ55/AC  
 BC1 intron(exon1-2)/3′ intron/BC1 AV27.1#AJ3/AC  
 //BD2/BJ2S5…BJ2S6…BJ2S7/BC2 AV23.1#AJ29/AC  
 
Case 5  NONE  AV28.1#AJ49*/AC 
  AV12.1#AJ8/AC  
  AV16.1#AJ7/AC 
  AV6.1#AJ9/AC  
  AV7.4#AJ32/AC 
  AV17.1#AJ7/AC  
  //AJ30/AC  
  //AJ9/AC 
  //AC  
 
Case 6  …BJ1.5/BC1  //AJ48/signal seq. .AJ47/AC  
 …BJ1.6/BC1  …AJ42/AC 
  //AC  
 
Case 7  …BJ2.3/BC2  AV27.1#AJ58/AC 
 //BJ1.5/BC1  AV17.2#AJ47/AC  
  AV14.1#AJ50/AC 
  //AJ49/AC  
  //AJ43/AC 
  …AJ45/AC 
TCRβ TCRα
Case 1  //BJ2S4/BC2  AV14S1#AJ55/AC 
 BC1  AV12S5#AJ54/AC  
 BD1 5′intron/BC1 AV2S5#AJ55/AC  
 //BJ2S5…BJ2S6/BC1  //AJ49/AC 
 BC1 exon 4/BC1 exon 1/BC1  AJ54-AJ53 intron/AC  
 
Case 2  BV2.1#BJ2.5/BC2  AV17S2#AJ3/AC  
 …BD1/BJ2S4/BC2 AV12S1#AJ49/AC  
 …BD1/BJ1S1/BC1  AV18S2#AJ32/AC 
 …BD1/BJ1S5/BC1  //AJ6/AC  
 …BD1/BJ1S6/BC1 //AJ30/AC  
 …BJ1S5/BC1  
 …BJ2S3/BC2 
 //BJ2S5/BC2  
 //BJ2S2/BC2  
 
Case 3  //BJ2S3/BC2 AV2S8#AJ49*/AC  
  //AJ45/AC  
  //AJ13/AC 
  //AJ11/5′ AC intron/AC  
 
Case 4  //BD1/BJ1S1/BC1 AV?#AJ3/AC  
 //BJ2S3/BC2  AV18S2#AJ18/AC 
 //BJ2S4/BC2  AV13S1#AJ29/AC  
 //BJ2S5/BC2 AV13.1#AJ55/AC  
 BC1 intron(exon1-2)/3′ intron/BC1 AV27.1#AJ3/AC  
 //BD2/BJ2S5…BJ2S6…BJ2S7/BC2 AV23.1#AJ29/AC  
 
Case 5  NONE  AV28.1#AJ49*/AC 
  AV12.1#AJ8/AC  
  AV16.1#AJ7/AC 
  AV6.1#AJ9/AC  
  AV7.4#AJ32/AC 
  AV17.1#AJ7/AC  
  //AJ30/AC  
  //AJ9/AC 
  //AC  
 
Case 6  …BJ1.5/BC1  //AJ48/signal seq. .AJ47/AC  
 …BJ1.6/BC1  …AJ42/AC 
  //AC  
 
Case 7  …BJ2.3/BC2  AV27.1#AJ58/AC 
 //BJ1.5/BC1  AV17.2#AJ47/AC  
  AV14.1#AJ50/AC 
  //AJ49/AC  
  //AJ43/AC 
  …AJ45/AC 

# Indicates an out-of-frame rearrangement, / indicates a productively recombined or spiced site, // indicates a truncated or “broken” gene segment, … indicates continuation of 5′ germline sequence.

Table 7.

Abnormal TCR Sequences

graphic
 
graphic
 

The top two lines line of each group indicate the homologous genomic segment and sequence number, respectively, Koop et al,14 Rowen et al,15 and Slightom et al,16 and the third line indicates the actual sequence derived from the patients. Where present, the fourth, fifth, and sixth lines indicate putative splice sites within the 3′ gene segments. Shaded regions indicate homologous regions that may direct aberrant splicing.

Table 8.

Abnormal TCRβ Sequences

graphic
 
graphic
 

Analysis of Productive TCR Transcripts

All patients displayed an oligoclonal repertoire of productively rearranged TCRs. Both the α- and β-chain repertoires were limited to a few unique clones. This was indicated by the inability to clone large numbers of unique TCRs within the same patient, and the high frequency with which different cDNAs representing the same clonotype were sequenced. To ensure that repeated sequences were indeed derived from unique mRNA transcripts and not from the amplified products of the same mRNA transcript, the most 5′ end of the cloned VDJC template was sequenced. Because second-strand synthesis by DNA polymerase was primed on RNase-generated fragments of RNA, each amplified cDNA bore a novel 5′ start site caused by random nicking by RNase and subsequent digestion (blunt-ending) of the 5′ end by T4 DNA polymerase. Thus, it could be determined whether each sequence represented a unique mRNA species or simply the amplified products of the same mRNA. In some cases few or no unique mRNA transcripts were amplified (TCRα: case 1 [2 transcripts]; TCRβ: case 5 [1 transcript], case 6 [1 transcript], and case 7 [none]; and TCRα: case 1 [2 transcripts]) (Tables 3 and 4). However, in all patients, an adequate analysis of the complexity of the repertoire was obtained from the amplified sequences of either the α- or β-chains. Reproducibility of the technique was shown in one patient (case 4), in which two different aliquots of the same blood sample were analyzed in separate experiments that yielded nearly identical frequencies of the same TCR transcripts.

In all cases, it can be concluded that there was an expansion of one or several T-cell clones (Tables 3 and 4). This finding is consistent with previous analyses of the TCR repertoire in Omenn’s syndrome by Southern blotting.6,13 Also of note was the preferential usage of certain V genes among the few TCRs expressed in given individuals. For example, in case 1, TCRBV5S1 was used in 3 clones and TCRBV14S1 in 2 of 6 clones. The only other receptor identified in case 1 used TCRBV3S1, which bears extensive sequence homology with TCRBV14. In case 2, TCRBV13 was used in 3 of 10 clones, and in case 4, TCRBV3S1 was used in 2 of 4 clones. The TCR Vα gene usage was less preferential, but some skewing was evident. TCRAV3S1 was used in 2 of 6 clones in case 4, and TCRAV14S1 was used in 2 of 5 clones in case 8 and in 2 of 5 clones in case 6.

It was important to examine the structure of the CDR3 of these TCRs, because this region possesses the highest degree of diversity, and, according to most models, encodes the TCR segment involved in antigen recognition.23-26 The length of the CDR3 may also provide information about the nature of the ligands or the rearrangement process.27,28 This analysis was undertaken for both the α and β CDR3s in this group of Omenn’s patients (Tables 3 and 4), and compared with previous analyses of large pools of TCRs from antigen-specific T cells or a randomly selected pool from normal humans.29,30 In the TCRα chains, the CDR3 lengths were slightly shorter than previous studies (mean, 8.4 v 9.2 [or 10.5]), had a slightly larger range (5 to 13 v 6 to 12), and had similar variance (2.7 v 2.8; skewing, 0.13 v 0.1; and kurtosis, 0.21 v −0.9). Within the TCRβ chains, one CDR3 (case 1, clone 2), which was only two amino acids in length, was excluded from the statistical analysis. The range of lengths was similar to previous reports (7 to 13 v 6 to 12), but the mean lengths were shorter (8.6 v 9.5), with slightly less variance (2.5 v 4), and similar kurtosis (0.55 v0.2).29,30 Based on the findings of a previous study, which found that the length of the CDR3s from thymic T cells, both selected and unselected, differed little from the mature, antigen-specific pool of TCRs, the shorter CDR3 lengths that we detected in the Omenn’s group were probably not the result of selection events.29 Rather, as discussed in more detail below, it is likely that the shorter CDR3 lengths resulted from fewer N or P nucleotide insertions or increased deletion of germline encoded segments within recombinatorial joints.

A few common amino acid motifs within the CDR3s were identified both within individual patients and among different patients (Table 5). For one motif (α1), identical amino acid sequences were observed in two clones. The common sequences encoded by this motif (α1) may have been attributable to identical germline J regions and the lack of N nucleotide insertions.

In three patients, TCRs were identified that predominantly used V and J gene segments that map to genomic regions in close proximity to each other. In cases 1, 3, and 4, TCRBV3S1, 14S1, 11S1, and 15S1, which are the second, third, four, and fifth, respectively, most 3′ V genes in the human TCRB locus on chromosome 7, accounted for the majority (8 of 13) of V genes used (Table 2).15 Some of these same receptors also rearranged to the most 5′ J-region locus (TCRBJ1). Finally, as indicated above, within some of those same TCR clones, no N or P nucleotides were detected so that the junctional regions were encoded solely by germline V-, D-, and J-region nucleotides (case 1, clones 1 and 3; case 3, clones 1 and 3; and case 4, clone 2). This is most pronounced in case 3, where a total of only three nongermline-encoded nucleotides were identified in the three TCRs. Those nucleotides, identified in clone 2, coded for an isoleucine. The apparent nongermline-encoded aspartic acid (D) within that joint was encoded by one germline D-region and two germline J-region nucleotides. Preferential usage of proximal TCRα J genes could be observed in case 1, within both the productive and the nonproductive transcripts (TCRAJ56, 53, and 49), but it could not be determined for the TCRAV locus because that locus has yet to be fully mapped.17However, these TCRs also had decreased numbers of junctional nucleotides in some clones.

Although the enzyme responsible for N nucleotide insertion, terminal deoxynucleotidyl transferase (TdT), seemed to be functional in all patients studied, as indicated by the presence of N nucleotides, it may not have been fully active. Alternatively, the atypical TCRs may have arisen before the full expression of TdT, reminiscent of “immature” TCRs detected in human fetal thymus.28,31Interestingly, the peripheral blood T cells in all three of these patients (cases 1, 3, and 4) with limited N nucleotide insertion were dominated by TCRα/β populations lacking CD4 and CD8. These TCRα/β “double negative” T cells normally comprise a minuscule population in the blood of healthy individuals (0.1% to 2%), but are increased in some autoimmune diseases.13,32-35 In normal humans, TCRα/β double-negative T cells represent populations with oligoclonal TCRs, some of which use similar proximal rearrangements and lack N nucleotides.20,36 Several reports have suggested that these cells may be extrathymically derived.37-42 

T-cell clones were generated from two patients and their TCRβ chains were identified (Table 3). The clones derived from the peripheral blood of patient 1 was TCRα/β double negative and used TCRBV17S1 and BJ2s1. TCRBV17S1 is highly homologous to BV14S1 and 3S1 and is also a somewhat proximal gene (seventh nonpseudo gene from the 3′ end of the TCRBV locus). A second TCRα/β double-negative clone was derived from patient 4, which bore TCRBV3s1 rearranged to J1s1, and a short germline-encoded junctional region. These features were in keeping with the abnormalites already described for the other circulating T cells in the patients. The functional activity of this clone has been previously examined and showed proinflammatory and cytotoxic activities that implicated the TCRα/β double-negative T cells in the disease pathogenesis.12,13,19 

Analysis of Nonproductive TCR Transcripts

The vast majority of nonproductive transcripts identified seemed to be the result of either normally occurring out-of-frame VDJ/C β-chain and VJ/C α-chain or truncated DJ/C or J/C transcripts (Table 6). However, several observations can be made with regard to the relative proportions of the different types of nonproductive transcripts. First, there seemed to be an abundance of TCRβ J/C as compared with DJ/C nonproductive transcripts. Normally, virtually all truncated β transcripts contain a D to J rearrangement, and thus the TCRβ J/C transcripts may represent unrearranged alleles.43 Also, most (13 of 18) truncated J/C transcripts lacked 5′ signal sequences and the most 5′ germline nucleotides. The altered 5′ ends, appearing as “broken” transcripts (designated as // in Table 6), could be caused by aborted rearrangements, or alternatively, could be attributable to technical loss during second-strand synthesis (see Materials and Methods). The former possibility is supported by the fact that in virtually all cases, only the most proximal 5′ nucleotides of the germline J segment exon were missing, which could represent exonucleolytic loss observed in normal rearrangement processing. Also supporting defective rearrangement mechanisms was an approximately twofold higher number of “broken” nonproductive transcripts within the TCRβ (13 of 32; 0.41 ratio) than in the TCRα (9 of 38; 0.24 ratio) sequences. The increased frequency of broken transcripts in TCRβ may be a result of twice the number of rearrangement events required at the TCRB locus (D to J plus V to D rearrangements in TCRB v only V to J during TCRA rearrangements). The abundance of TCRβ J/C transcripts could thus represent unrearranged alleles or aborted rearrangements. Either of these possibilities is consistent with disordered rearrangement mechanisms.

A second observation was that few out-of-frame rearrangements were detected at the TCRB locus. Because mechanisms of allelic exclusion normally operate to inhibit V to D rearrangements after a productive TCRβ chain is translated, this should result in a consistent ratio of out-of-frame to truncated alleles in the surviving T-cell pool. Mathematically, 2 of 3 of nonproductive transcripts should be out-of-frame and 1 of 3 truncated (DJC).43 However, in the presence of disordered or impaired rearrangement mechanisms, the out-of-frame rearrangements would become progressively diminished in proportion (E.G.B., unpublished observation, 1998). The TCRα transcripts would be affected much less because of lack of strict allelic exclusion. Thus, the decreased ratio of out-of-frame to truncated rearrangements within the TCRβ sequences, with relative preservation within the TCRα sequences, would also be consistent with disordered rearrangement mechanisms.

One of the more interesting findings in several of the patients was the demonstration of abnormal nonproductive transcripts (Tables 6, 7, and8). These included abnormal insertions of J genes into intronic sequences, inclusion of several contiguous J-region introns and exons within otherwise normally rearranged genes, and disordered splicing of C-region exons and introns. In some cases alternative mRNA splicing mechanisms may have created abnormalities, although none of the atypical transcripts identified were similar to those previously reported.44-46 The inability to detect more illegitimate or abnormally rearranged transcripts may be caused by the targeting of those cells for apoptosis because of persistent double-strand breaks or nonviable translocations.

In summary, Omenn’s syndrome may arise from different primary defects, the common endpoint being SCID with clinical and pathological features of GvHD caused by an autologous source of T lymphocytes. The immunologic hallmark of this disease is the expansion of an oligoclonal population of T cells. The identification of two patients with congenital malformations consistent with embryological defects of the pharyngeal pouches, one with classic DiGeorge anomaly and Chromosome 22q11 deletion, suggests that primary thymic defects may be the underlying cause in some patients. Other patients with Omenn’s syndrome have also been reported to have dysplastic thymi, but whether this is primary or secondary to the disease is unknown.12,47,48 The disordered TCRs identified in the patients described here highlight the possibility that defects previously thought to affect only the development of sufficient numbers of T cells, such as the DiGeorge anomaly, may also produce a qualitative defect in the generation of normal TCRs. Previously, defects in antigen receptor rearrangement were thought to result solely from primary defects in those rearrangement mechanisms, such as those identified in murine SCID. The identification of partial RAG defects in Omenn’s patients confirms that primary defects in VDJ recombination causes the thymic dysplasia and abnormal T-cell development in many patients. One of the more intriguing findings in this study was that there were similar abnormalities in the TCRs from the patient with the DiGeorge anomaly. This may imply that intrinsic defects in thymic epithelium may induce abnormalities in TCR rearrangement. Thus, different etiologies may cause Omenn’s syndrome, and common endpoints seem to be the oligoclonal expansion of antigen-driven T cells that bear TCRs, which reflect abnormal development and abnormal TCR rearrangement and assembly. The pathological induction of a GvHD-like illness may require defective T-cell development coupled with other unknown environmental and/or host factors to produce Omenn’s syndrome.

ACKNOWLEDGMENT

We thank Smita Vaidya, PhD for HLA typing; Armond S. Goldman, MD for referral of Case 1; and Harout Dersimonian, PhD and Yasushi Uematsu, MD, PhD for their assistance and protocols in the inverse PCR technique.

Supported by a Clinical Investigator Award, National Institutes of Health K08 AI01064 to E.G.B.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

REFERENCES

REFERENCES
1
Omenn
GS
Familial reticuloendotheliosis with eosinophilia.
N Engl J Med
273
1965
427
2
Omenn
GS
Familial reticuloendotheliosis with eosinophilia: A follow-up.
Birth Defects: Original Article Series
7
1971
196
3
Karol
RA
Eng
J
Cooper
JB
Dennison
DK
Sawyer
MK
Lawrence
EC
Marcus
DM
Shearer
WT
Imbalances in subsets of T lymphocytes in an inbred pedigree with Omenn’s syndrome.
Clin Immunol Immunopathol
27
1983
412
4
Schofer
O
Blaha
I
Mannhardt
W
Zepp
F
Stallmach
T
Spranger
J
Omenn phenotype with short-limbed dwarfism.
J Pediatr
118
1991
86
5
Cavazzana-Calvo
M
Le Deist
F
De Saint Basile
G
Papadopoulo
D
De Villartay
JP
Fischer
A
Increased radiosensitivity of granulocyte macrophage colony-forming units and skin fibroblasts in human autosomal recessive severe combined immunodeficiency.
J Clin Invest
91
1993
1214
6
de Saint-Basile
G
Le Deist
F
De Villartay
JP
Cerf-Bensussan
N
Journet
O
Brousse
N
Griscelli
C
Fischer
A
Restricted heterogeneity of T lymphocytes in combined immunodeficiency with hypereosinophilia (Omenn’s syndrome).
J Clin Invest
87
1991
1352
7
Loechelt
BJ
Shapiro
RS
Jyonouchi
H
Filipovich
AH
Mismatched bone marrow transplantation for Omenn syndrome: A variant of severe combined immunodeficiency.
Bone Marrow Transplant
16
1995
381
8
Bosma
GC
Fried
M
Custer
RP
Carroll
A
Gibson
DM
Bosma
MJ
Evidence of functional lymphocytes in some (Leaky) scid mice.
J Exp Med
167
1988
1016
9
Appleton
AL
Curtis
A
Wilkes
J
Cant
AJ
Differentiation of materno-fetal GVHD from Omenn’s syndrome in pre-BMT patients with severe combined immunodeficiency.
Bone Marrow Transplant
14
1994
157
10
Tachinami
T
Koizumi
S
Yachie
A
Yamagami
M
Yokoi
T
Ohno
I
Taniguchi
N
Takada
I
Kawashima
A
Okada
Y
Immune status in two brothers with Omenn’s syndrome: No discernible chimerism on FACS analysis using a monoclonal antibody specific for a maternally restricted HLA antigen.
Am J Pediatr Hematol-Oncol
12
1990
343
11
Villa
A
Santagata
S
Bozzi
F
Giliani
S
Frattini
A
Imberti
L
Gatta
L
Ochs
H
Schwartz
K
Notarangelo
L
Vezzoni
P
Spanopoulou
E
Partial V(D)J recombination activity leads to Omenn Syndrome.
Cell
93
1998
885
12
Brooks
EG
Wirt
DP
Klimpel
GR
Vaidya
S
Goldblum
RM
In vivo and in vitro suppression of T-cell receptor alpha/beta CD4-CD8- T lymphocytes by cyclosporine A.
Clin Immunol Immunopathol
67
1993
224
13
Wirt
DP
Brooks
EG
Vaidya
S
Klimpel
GR
Waldmann
TA
Goldblum
RM
Novel T-lymphocyte population in combined immunodeficiency with features of graft-versus-host disease.
N Engl J Med
321
1989
370
14
Uematsu
Y
A novel and rapid cloning method for the T-cell receptor variable region sequences.
Immunogenetics
34
1991
174
15
Rowen
L
Koop
BF
Hood
L
The complete 685-kilobase DNA sequence of the human beta T cell receptor locus.
Science
272
1996
1755
16
Slightom
JL
Siemieniak
DR
Sieu
LC
Koop
BF
Hood
L
Nucleotide sequence analysis of 77.7 kb of the human V beta T-cell receptor gene locus: Direct primer-walking using cosmid template DNAs.
Genomics
20
1994
149
17
Koop
BF
Rowen
L
Wang
K
Kuo
CL
Seto
D
Lenstra
JA
Howard
S
Shan
W
Deshpande
P
Hood
L
The human T-cell receptor TCRAC/TCRDC (C alpha/C delta) region: Organization, sequence, and evolution of 97.6 kb of DNA.
Genomics
19
1994
478
18
Arden
B
Clark
SP
Kabelitz
D
Mak
TW
Human T-cell receptor variable gene segment families.
Immunogenetics
42
1995
455
19
Brooks
EG
Wirt
DP
Goldblum
RM
Vaidya
S
Asuncion
MT
Patterson
JC
Ware
CF
Klimpel
GR
Double-negative (CD4- CD8-) T cells with an alpha/beta T cell receptor. Non-MHC-restricted cytolytic activity and lymphokine production.
J Immunol
144
1990
4507
20
Brooks
EG
Balk
SP
Aupeix
K
Colonna
M
Strominger
JL
Groh Spies
V
Human T-cell receptor (TCR) alpha/beta + CD4-CD8- T cells express oligoclonal TCRs, share junctional motifs across TCR V beta-gene families, and phenotypically resemble memory T cells.
Proc Natl Acad Sci USA
90
1993
11787
21
Meyerhans
A
Vartanian
JP
Wain Hobson
S
DNA recombination during PCR.
Nucleic Acids Res
18
1990
1687
22
Shuldiner
AR
Nirula
A
Roth
J
Hybrid DNA artifact from PCR of closely related target sequences.
Nucleic Acids Res
17
1989
4409
23
Jorgensen
JL
Esser
U
de St Groth
BF
Reay
PA
Davis
MM
Mapping T-cell receptor-peptide contacts by variant peptide immunization of single-chain transgenics.
Nature
355
1992
224
24
Bjorkman
PJ
Davis
MM
Model for the interaction of T-cell receptors with peptide/MHC complexes.
Cold Spring Harbor Symposia on Quantitative Biology
54
1989
1365
25
Garcia
KC
Degano
M
Stanfield
RL
Brunmark
A
Jackson
MR
Peterson
PA
Teyton
L
Wilson
IA
An alpha beta T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex.
Science
274
1996
209
26
Garboczi
DN
Ghosh
P
Utz
U
Fan
QR
Biddison
WE
Wiley
DC
Structure of the complex between human T-cell receptor, viral peptide and HLA-A2.
Nature
384
1997
134
27
Kayser
C
Waase
I
Weyand
CM
Goronzy
JJ
T cell receptor germline gene segments and HLA haplotypes control the length of the CDR3 of human T cell receptor beta chains.
Cell Immunol
168
1996
235
28
George
JF
Jr
Schroeder
HW
Jr
Developmental regulation of D beta reading frame and junctional diversity in T cell receptor-beta transcripts from human thymus.
J Immunol
148
1992
1230
29
Rock
EP
Sibbald
PR
Davis
MM
Chien
YH
CDR3 length in antigen-specific immune receptors.
J Exp Med
179
1994
323
30
Moss
PA
Bell
JI
Sequence analysis of the human alpha beta T-cell receptor CDR3 region.
Immunogenetics
42
1995
10
31
Gilfillan
S
Dierich
A
Lemeur
M
Benoist
C
Mathis
D
Mice lacking TdT: Mature animals with an immature lymphocyte repertoire.
Science
261
1993
1175
32
Melamed
I
Cohen
A
Roifman
CM
Expansion of CD3+CD4-CD8- T cell population expressing high levels of IL-5 in Omenn’s syndrome.
Clin Exp Immunol
95
1994
14
33
Sneller
MC
Straus
SE
Jaffe
ES
Jaffe
JS
Fleisher
TA
Stetler Stevenson
M
Strober
W
A novel lymphoproliferative/autoimmune syndrome resembling murine lpr/gld disease.
J Clin Invest
90
1992
334
34
Shivakumar
S
Tsokos
GC
Datta
SK
T cell receptor alpha/beta expressing double-negative (CD4-/CD8-) and CD4+ T helper cells in humans augment the production of pathogenic anti-DNA autoantibodies associated with lupus nephritis.
J Immunol
143
1989
103
35
Kahaleh
B
Immunologic aspects of scleroderma.
Curr Opin Rheumatol
5
1993
760
36
Porcelli
S
Yockey
CE
Brenner
MB
Balk
SP
Analysis of T cell antigen receptor (TCR) expression by human peripheral blood CD4-8- alpha/beta T cells demonstrates preferential use of several V beta genes and an invariant TCR alpha chain.
J Exp Med
178
1993
1
37
Kubota
H
Minato
N
T cell development and selection in extrathymic environments.
Nippon Rinsho
52
1994
2799
38
Kubota
H
Okazaki
H
Onuma
M
Kano
S
Hattori
M
Minato
N
CD3+4-8- alpha beta T cell population with biased T cell receptor V gene usage. Presence in bone marrow and possible involvement of IL-3 for their extrathymic development.
J Immunol
149
1992
1143
39
Dejbakhsh-Jones
S
Jerabek
L
Weissman
IL
Strober
S
Extrathymic maturation of alpha beta T cells from hemopoietic stem cells.
J Immunol
155
1995
3338
40
Makino
Y
Koseki
H
Adachi
Y
Akasaka
T
Tsuchida
K
Taniguchi
M
Extrathymic differentiation of a T cell bearing invariant V alpha 14 J alpha 281 TCR.
Int Rev Immunol
11
1994
31
41
Adachi
Y
Koseki
H
Zijlstra
M
Taniguchi
M
Positive selection of invariant V alpha 14+ T cells by non-major histocompatibility complex-encoded class I-like molecules expressed on bone marrow-derived cells.
Proc Natl Acad Sci USA
92
1995
1200
42
Makino
Y
Yamagata
N
Sasho
T
Adachi
Y
Kanno
R
Koseki
H
Kanno
M
Taniguchi
M
Extrathymic development of V alpha 14-positive T cells.
J Exp Med
177
1993
1399
43
Malissen
M
Trucy
J
Jouvin Marche
E
Cazenave
PA
Scollay
R
Malissen
B
Regulation of TCR alpha and beta gene allelic exclusion during T-cell development.
Immunol Today
13
1992
315
44
Roman
S
Ferradini
L
Azogui
O
Faure
F
Hercend
T
Triebel
F
Alternatively spliced T cell receptor transcripts expressed in human T lymphocytes.
Mol Immunol
30
1993
423
45
Ferradini
L
Roman
S
Azogui
O
Genevee
C
Viel
S
Hercend
T
Triebel
F
The use of anchored polymerase chain reaction for the study of large numbers of human T-cell receptor transcripts.
Mol Immunol
30
1993
1143
46
Hue
I
Trucy
J
McCoy
C
Couez
D
Malissen
B
Malissen
M
A novel type of aberrant T cell receptor alpha-chain gene rearrangement. Implications for allelic exclusion and the V-J recombination process.
J Immunol
144
1990
4410
47
Miller
DR
Familial reticulendotheliosis: Concurrence of disease in five siblings.
Pediatrics
38
1966
986
48
Barth
RF
Vergara
GG
Khurana
SK
Lowman
JT
Beckwith
JB
Rapidly fatal familial histiocytosis associated with eosinophilia and primary immunological deficiency.
Lancet
2
1972
503

Author notes

Address reprint requests to Edward G. Brooks, MD, Child Health Research Center, University of Texas Medical Branch, 301 University Blvd, Galveston TX 77555-0366; e-mail: ebrooks@utmb.edu.