We have developed a multiplex reverse transcription-polymerase chain reaction (RT-PCR) reaction, which enables us to detect 29 translocations/chromosomal aberrations in patients with acute lymphoid leukemia (ALL) and acute myeloid leukemia (AML). Through the construction and optimization of specific primers for each translocation, we have been able to reduce the set-up to 8 parallel multiplex PCR reactions, thus greatly decreasing the amount of work and reagents. We show the value of our set-up in a retrospective analysis on cryopreserved material from 102 AML and 62 ALL patients. The multiplex RT-PCR detected a hybrid mRNA resulting from a structural chromosomal aberration in 45 of 102 (44%) of the AML and in 28 of 62 (45%) of the pediatric ALL cases. Importantly, in 33% of AML and in 47% of the ALL cases with cytogenetic data, submicroscopic chromosomal aberrations or masked translocations were shown that were not detected in the cytogenetic analysis either for structural reasons or because of an insufficient number of metaphases obtained. This multiplex RT-PCR system, which can handle up to 10 patients with a response time of 2 working days, is thus an important tool that complements cytogenetic analysis in the up-front screening of acute leukemia patients and should provide a rapid and efficient characterization of leukemia cells, even in situations with sparse patient material.

THE DIAGNOSIS OF acute leukemia is multidisciplinary, with histology, immunology, and cytogenetics as the most often used methodologies. Neither immunophenotyping nor histology provides tools for prognosticating patients, whereas cytogenetic evaluation has been shown to delineate patients with a defined prognosis.1 The value of cytogenetics as a prognostic tool in cancer is based on the existence of a number of balanced chromosomal translocations. At present, more than 50 different consistently occurring translocations have been described, many of which have been found to be specific for particular subtypes of leukemia or lymphoma (for a recent review, see Look2).

Molecular studies of these rearrangements have provided important insights into the mechanisms of tumorigenesis. Thus, many genes involved in translocations are transcription factors that appear to have a direct role in hematopoiesis. Translocations may alter the functions or activities of cellular proto-oncogenes located at or near the breakpoint by at least two mechanisms, either (1) by juxtaposition of a cellular proto-oncogene to the regulatory element of a tissue-specific gene, eg, Ig or T-cell receptor genes in leukemia, leading to inappropriate expression of the oncogene,3,4 or (2) by creating fusion genes coding for chimeric proteins with functional features different from the two parental proteins, eg, t(1;19)(q23;p13) and t(8;21)(q22;q22).5,6 

A translocational breakpoint gene may have several fusion partners, the most promiscuous example being the MLL gene (also calledALL1, HTRX1, and HRX) at chromosome band 11q23, for which more than 40 different fusion partners together with an internal duplication have been described.7-15 Thus, depending on the fusion partner, the MLL gene can contribute to the pathogenesis of lymphoid and myeloid malignancies. TheMLL/AF4 fusion gene, detected in t(4;11)(q21;q23) translocations, is observed in acute lymphoid leukemia (ALL) only,14,16-18 whereas the MLL/AF9 fusion gene detected in t(9;11)(p22;q23) translocations is found primarily in acute myeloid leukemia (AML) patients.14,19 The dupMLLhas been described in both ALL and AML patients.15,20,21 

Because cytogenetic analysis is time-consuming and yields sufficient metaphases only in 60% to 80% of the bone marrow samples, efforts to design polymerase chain reaction (PCR) reactions for translocations have been ongoing for some time.22,23 The availability of cDNA sequence information for an increasing number of fusion genes has resulted in PCR protocols for individual translocations. PCR analysis does not require much patient material, can be performed on resting cells, and is very sensitive in detecting rare abnormal cells. Thus, it should be of great potential benefit to bring the PCR methodology up-front in the diagnosis of acute leukemia. However, considering the great number of fusion genes and breakpoint variants presently characterized, more than 50 separate PCR reactions are needed for the screening of a patient with a standard procedure, which is at best labor-intensive and material-demanding and probably not practically feasible.

We describe here our efforts to establish a multiplex reverse transcription-PCR (RT-PCR) analysis system that facilitates the detection in 8 parallel PCR reactions of 29 translocations/chromosomal aberrations, including more than 80 mRNA breakpoint or splice variants.

MATERIALS AND METHODS

Patient samples and cell lines.

For the combined purpose of optimizing the PCR primers and obtaining unlimited amounts of material for positive controls for the multiplex assay, we used cell lines as the RNA source. For the t(1;19)(q23;p13), we used 697; for t(2;5)(p23;q35), Karpas-299; for t(4;11)(q21;q23), RS4;11 and MV-4-11; for t(6;11)(q27;q23), ML-2; for t(9;11)(p22;q23), Mono-Mac-6; for t(15;17)(q21;q22), NB4; for t(17;19)(q22;p13), HAL-01; and for TALD, RPMI8402. In addition, we used RNA from patients positive for dupMLL(11q23), inv(16)(p13q22), t(6;9)(p23;q34), t(8;21)(q22;q22), t(9;22)(q34;q11), t(10;11)(p12;q23), t(11;19)(q23;p13.3), and t(11;19)(q23;p13.1) that were identified during the study.

Leukemic cell samples from patients admitted to the Departments of Hematology and Pediatrics, Aarhus University Hospital (Aarhus, Denmark) were subjected to Isopaque-Ficoll sedimentation and the mononuclear cell suspensions used for routine immunophenotyping purposes. In cases in which more than 5 × 106 cells were available, these were cryopreserved in 10% fetal calf serum and 10% dimethyl sulfoxide according to standard techniques. All cell collection was performed according to protocols approved by the Local Ethical Committee for the County of Aarhus. Likewise, the Biobase containing cell material from the patients has been approved by the Danish Data Protection Agency (Registertilsynet).

The cell lines Karpas-299, ML-2, Mono-Mac-6, NB-4, 697, JOSK-M, JOSK-I, NALM-6, and RPMI8402 were obtained from DSM-Deutsche Sammlung von Mikroor ganismen und Zellkulturen (Braunschweig, Germany). The cell lines RS4;11 and MV-4-11 were obtained from the American Type Culture Collection (Manassas, VA). The cell line HAL-01 was kindly provided by Dr Kazuma Ohyashiki (Tokyo Medical College, Tokyo, Japan). All cell lines were cultured in RPMI-1640 medium supplemented with 10% fetal calf serum and antibiotics. The medium for the cell line Mono-Mac-6 was supplemented with 9 μg/mL bovine insulin. An overview of the characteristics of most of these lines can be found in Drexler et al.24 

Cytogenetic analysis.

Bone marrow cells were cultured at 37°C in an atmosphere of 5% CO2 in air for approximately 24 hours. After 3 to 5 hours, methotrexate (10−5 mol/L) was added, and 17 hours later the S-phase block was released with thymidine (10−3 mol/L). Colchicine was added 10 minutes before termination of the culture period.25 Cells were harvested with conventional methods and slides were prepared. The slides were aged by heating at 60°C for 17 hours before banding. Giemsa bands were produced with Wright's stain as described elsewhere.26 

RNA preparation.

Cells were thawed out and washed twice in phosphate-buffered saline. Total RNA was prepared either by the guanidinium thiocyanate-phenol chloroform method27 or by using a RNeasy Kit (Quiagen Gmbh, Hilden, Germany) according to the manufacturer's recommendations. The RNA solution was subsequently treated with 0.1 U/μL RNase-free DNase (Boehringer Mannheim, Mannheim, Germany) in 50 mmol/L Tris-HCl, pH 8.0, 10 mmol/L MgCl2 at 37°C for 30 minutes. After DNase treatment, EDTA (pH 8.0) was added to a final concentration of 10 mmol/L and the RNA solution was extracted once in phenol/chloroform 1:1. Sodium acetate was added to a final concentration of 200 mmol/L and RNA was precipitated with 1 vol of isopropanol. RNA was pelleted in an Eppendorf centrifuge at 13,000 rpm for 30 minutes, washed with 80% ethanol, and resuspended in 25 μL diethylpyrocarbonate ddH2O. Five microliters were withdrawn for quantification on a GeneQuant RNA/DNA calculator (Pharmacia Biotech, Sollentuna, Sweden). Subsequently, RNA was diluted to 0.1 μg/μL in DEP ddH2O and stored until use at −80°C in 10-μL aliquots.

The multiplex PCR setup.

We have designed a multiplex RT-PCR strategy to detect the transcripts of chromosomal translocations/rearrangements found in leukemic patients. Taking advantage of the fact that a number of the genes involved in translocations can have different fusion partners, we combined such genes in the assay, thus reducing the number of primers. In 8 multiplex PCR reactions this assay tests for 29 translocations or chromosomal rearrangements that may result in the generation of more than 80 fusion gene variants because of heterogeneity of breakpoints and/or alternative splicing. The translocations and the resulting transcripts tested for in the multiplex PCR assay are shown in Table 1. Table 1 also includes a number MLL gene fusion variants (marked T), which in theory may be expected to occur, but have to our knowledge, not yet been described.

Table 1.

Chromosomal Alteration Included in the Multiplex RT-PCR Analysis

Chromosomal Alteration  Genes Involved  Fusion Gene* PCR Mix No. Size of PCR Fragment Positive Cell Line  Presence  Reference  
t(X;11)(q13q23) MLL (11q23)  MLLex6/AFX  R1C  488  T  
 AFX (Xq13)  MLLex7/AFX  R1C 235 (480)   T  
  MLLex8/AFX  R1C 449 (694)  Karpas-45§ ALL  7  
  MLLex9/AFX  R1C  596 (841)   
TAL1D  SIL (1p34)  SIL/TAL1 R3D  183 RPMI8402  T-ALL  32, 37  
 TAL1 (1p34) 
t(1;11)(q21;q23)  MLL (11q23)  MLLex6/AF1q R5E  300   AMMOL  13  
 AF1q (1q21) MLLex7/AF1q  R5E  187   
  MLLex8/AF1q  R5E  301 (546)   
  MLLex9/AF1q  R5E  448 (693)   
t(1;11)(p32;q23)  MLL (11q23)  MLLex6/AF-qp R2A  300   ALL  10  
 AF1p (1p32) MLLex7/AF-1p  R2A  187 (432)   
  MLLex8/AF-1p  R2A  301 (546)  T  
  MLLex9/AF-1p  R2A 448 (693)   T  
t(1;19)(q23;p13)  E2A(19p13)  E2A/PBX1 (1)  R3A  376  697  ALL 28, 38, 39  
 PBX1 (1q23)  E2A/PBX1 (1a) R3A  403   ALL  39  
t(2;5)(p23;q35)  NPM(5q35)  NPM/ALK R8D  302  Karpas-299  ALCL, T-/B-cell lymphomas  40, 41  
 ALK (2p23) 
t(3;5)(q25.1;q34)  NPM (5q35)  NPM/MLF1 R8F  289   MDS, AML  42  
 MLF1 (3q25.1) 
t(3;21)(q26;q22)  AML1 (21q22) AML1ex5/MDS1/(EVI1)  R4B  446  SKH1§ CML-BC, AML, MDS  43-45  
 MDS1 (3q26) 
 (EVI1) (3q26)  AML1ex6/MDS1/(EVI1R4B  638   CML-BC, AML, MDS  44, 45  
t(4;11)(q21;q23)  MLL (11q23)  MLLex6/AF4 (a:1414)  R5A  317   ALL  14, 16, 46  
 AF4(4q21)  MLLex7/AF4 (a:1414)  R5A 204 (449)  RS4; 11  ALL  14, 16, 46  
  MLLex8/AF4 (a:1414)  R5A 318 (563)   ALL  16, 17, 46  
  MLLex8/AF4 (a:1414)  R5A 465 (710)   T  
  MLLex6/AF4(b:1459)  R5A  272  MV-4-11  ALL  17, 46  
  MLLex7/AF4 (b:1459)  R5A 159 (404)   ALL  14, 17, 46  
  MLLex8/AF4 (b:1459)  R5A 273 (518)   ALL  14, 17  
  MLLex9/AF4 (b:1459)  R5A 420 (665)   T  
  MLLex6/AF4(c:1546)  R5A  185   
  MLLex7/AF4 (c:1546)  R5A 72 (317)   ALL  17  
  MLLex8/AF4 (c:1546)  R5A 186 (431)   ALL  14, 17, 46  
  MLLex9/AF4 (c:1546)  R5A 333 (578)   T  
t(5;12)(q33;p13)  TEL(12p13)  TEL/PDGFR R6D  321   CMML, MDS  47  
 PDGFR (5q33)  
t(5;17)(q35;q22)  NPM(5q35)  NPM(S)/RAR R8E  105   APL 48  
 RAR (17q21)  NPM(L)/RAR R8E  234   APL  48  
t(6;9)(p23;q34)  DEK(6p23)  DEK/CAN R7A  320   AML  49  
 CAN (9q34)  
t(6;11)(q27;q23)  MLL (11q23) MLLex6/AF6 R1D  308  ML-2  AML, ALL¶ 8, 20  
 AF6 (6q27)  MLLex7/AF6 R1D  195 (440)   AML  20  
  MLLex8/AF6  R1D  309 (594)   
  MLLex9/AF6 R1D  456 (741)  T  
t(7;10)(q35;q24)  Activation of HOX11 R4D  212  RPMI8402  T-ALL 50, 51  
t(8;21)(q22;q22)  AML1 (21q22) AMLex5/ETO R4A  353  Kasumi-1§ AML 5, 45, 52  
 ETO (8q22)  
?t(9;9)  SET(9q34)  SET/CAN R7B  393   AUL  53  
 CAN (9q34)  
t(9;11)(p22;q23)  MLL (11q23) MLLex6/AF9 (A)  R5C  321   AML  14  
 AF9 (9p22)  MLLex7/AF9 (A)  R5C 208 (453)  Mono-Mac-6  AML  14  
  MLLex8/AF9 (A)  R5C 322 (567)  Mono-Mac-6  AML  14  
  MLLex9/AF9 (A)  R5C 469 (714)   T  
  MLLex6/AF9(B)  R5D  367   AML  19, 20  
  MLLex7/AF9 (B)  R5D 254 (499)   T  
  MLLex8/AF9(B)  R5D  368 (613)   
  MLLex9/AF9 (B)  R5D 515 (760)   T  
t(9;12)(q34;p13)  TEL(12p13)  TEL/ABL R6C  366   ALL  54  
 ABL (9q34) 
t(9;22)(q34;q11)  BCR (22q11) BCR/ABL e1a2  R6A  320   ALL  23, 55  
 ABL (9q34)  BCR/ABL b2a2  R6B  472  CML  23, 55  
  BCR/ABL b3a2  R6B  397  CML  23, 55  
t(10;11)(p12;q23)  MLL (11q23) MLLex5/AF10 (A;2222)  R2C  202   AML 56, 57  
 AF10 (10p12)  MLLex6/AF10(B:979)  R2D  270   AML  56, 57  
  MLLex7/AF10 (B:979)  R2D 157 (402)   AML  57  
  MLLex8/AF10 (B:979)  R2D 271 (516)   T  
  MLLex9/AF10(B:979)  R2D  418 (663)   
  MLLex6/AF10 (C:2110)  R2C  388  AML  56, 57  
  MLLex7/AF10 (C:2110) R2C  275 (520)   
  MLLex8/AF10 (C:2110)  R2C 389 (634)   T  
  MLLex9/AF10(C:2110)  R2C  536 (781)   
  MLLex6/AF10 (D:883)  R2D  366  AML  57  
  MLLex7/AF10 (D:883) R2D  253 (498)   AML  57  
  MLLex8/AF10 (D:883)  R2D 367 (612)   T  
  MLLex9/AF10(D:883)  R2D  514 (759)   
  MLLex6/AF10 (E:589)  R2E  267  AML  57  
  MLLex7/AF10 (E:589) R2E  154 (399)   
  MLLex8/AF10 (E:589)  R2E 268 (513)   T  
  MLLex9/AF10(E:589)  R2E  415 (660)   
  MLLex5/AF10 (F:1931)  R2C  493  AML¶  
t(10;14)(q24;q11) HOX11 (10q24)    Karpas-299  AML, ALL, CML¶   
dupMLL (11q23) MLL (11q23)  MLLex5/MLLex2  R2F 184   ALL¶  
 MLL (11q23) MLLex6/MLLex2  R2F  258   AML, ALL 15, 20, 21  
  MLLex7/MLLex2  R2F 145 (390)   AML  21  
  MLLex8/MLLex2  R2F  259 (504)  AML  21  
  MLLex9/MLLex2  R2F 406 (651)   AML  21  
t(11;17)(q23;q21) PLZF (11q23)  PLZF/RAR (A:1365)  R8A  315  APL  58, 59  
 RARA (17q21)  PLZF/RAR(B:1452)  R8A  402   APL  59  
t(11;17)(q23;q21) MLL (11q23)  MLLex5/AF17  R2B  281  AML  11  
 AF17 (17q21)  
t(11;19)(q23;p13.1) MLL (11q23)  MLLex6/ELL R1E  330  T  
 ELL (19p13.1)  MLLex7/ELL R1E  217 (462)   AML  9, 60, 61  
  MLLex8/ELL R1E  301 (576)  T  
  MLLex9/ELL R1E 448 (723)   
  MLLex6/ELL-ins120  R1E  450   
  MLLex7/ELL-ins120  R1E 337 (582)   AML  60  
  MLLex8/ELL-ins120  R1E 451 (696)   AML  60  
  MLLex9/ELL-ins120  R1E 598 (845)   T  
t(11;19)(q23;p13.3)  MLL(11q23)  MLLex6/ENL (A:177)  R5B  186  ALL  14, 17  
 ENL (19p13.3) MLLex7/ENL (A:177)  R5B  73 (318) KOCL-44§ ALL  14, 17  
  MLLex8/ENL(A:177)  R5B  187 (432)  KOCL-44§ ALL  14, 17  
  MLLex9/ENL (A:177)  R5B 334 (579)   T  
t(12;21)(p13;q22)  TEL(12p13)  TEL/AML1 R3C  293   ALL  62  
 AML1 (21q22)  TEL/AML1 R3C  332  ALL  62-64  
t(15;17)(q21;q22)  PML (15q21) PMLex3/RARα ex2  R8C  393  NB4  APL 65-67  
 RAR (17q21)  S-form (=BCR3
  PMLex3/RARα ex2  R8C  338  NB4 APL  66  
  S-form splice variant 
  PMLex6/RARα ex2  R8B  427  NB4 APL  66, 67  
  L-form (=BCR1)  
  PMLa ex3 Δex5 + 6/  R8C  464  NB4  APL  67  
  RARα ex2,  
  L-form splice variant 
  PML ex6-(+/−)ins-  R8B  +/−427  APL  66  
  RAR ex2  
  V-form (=BCR2)  
inv(16)(p13q22)  CBF (16q22) CBF/MYH11 (A)  R1A  270  ME-1§ AML  68  
 MYH11 (16p13)  CBF/MYH11 (B)  R1B  483  AML  68  
  CBF/MYH11 (C)  R1B  663  AML  68  
  CBF/MYH11 (D)  R1A  337  AML  68  
  CBF/MYH11 (E)  R1A  544  AML  68  
  CBF/MYH11 (F)  R1B  174  AML  68  
  CBF/MYH11 (G)  R1B  241  AML  68  
  CBF/MYH11 (H)  R1B  348  AML  68  
t(16;21)(p11;q22)  TLS (16p11) TLS/ERG (a)  R4C  318  UTP-L12§ AML  69  
 ERG (21q22)  TLS/ERG (b)  R4C  274 UTP-L12§ AML  69  
  TLS/ERG (c)  R4C 239  UTP-L12§ AML, ALL  69  
  TLS/ERG(d)  R4C  344   ALL¶  
  TLS/ERG (e) R4C  413   ALL¶  
t(17;19)(q22;p13)  E2A(19p13)  E2Aex13/HLFex4 (I)  R3B  390 HAL-01  ALL  70-72  
 HLF (17q22) E2Aex13insHLFex4 (I)  R3B  417   ALL 72  
  E2Aex12/HLFex4 (II)  R3B  207  ALL  72  
Chromosomal Alteration  Genes Involved  Fusion Gene* PCR Mix No. Size of PCR Fragment Positive Cell Line  Presence  Reference  
t(X;11)(q13q23) MLL (11q23)  MLLex6/AFX  R1C  488  T  
 AFX (Xq13)  MLLex7/AFX  R1C 235 (480)   T  
  MLLex8/AFX  R1C 449 (694)  Karpas-45§ ALL  7  
  MLLex9/AFX  R1C  596 (841)   
TAL1D  SIL (1p34)  SIL/TAL1 R3D  183 RPMI8402  T-ALL  32, 37  
 TAL1 (1p34) 
t(1;11)(q21;q23)  MLL (11q23)  MLLex6/AF1q R5E  300   AMMOL  13  
 AF1q (1q21) MLLex7/AF1q  R5E  187   
  MLLex8/AF1q  R5E  301 (546)   
  MLLex9/AF1q  R5E  448 (693)   
t(1;11)(p32;q23)  MLL (11q23)  MLLex6/AF-qp R2A  300   ALL  10  
 AF1p (1p32) MLLex7/AF-1p  R2A  187 (432)   
  MLLex8/AF-1p  R2A  301 (546)  T  
  MLLex9/AF-1p  R2A 448 (693)   T  
t(1;19)(q23;p13)  E2A(19p13)  E2A/PBX1 (1)  R3A  376  697  ALL 28, 38, 39  
 PBX1 (1q23)  E2A/PBX1 (1a) R3A  403   ALL  39  
t(2;5)(p23;q35)  NPM(5q35)  NPM/ALK R8D  302  Karpas-299  ALCL, T-/B-cell lymphomas  40, 41  
 ALK (2p23) 
t(3;5)(q25.1;q34)  NPM (5q35)  NPM/MLF1 R8F  289   MDS, AML  42  
 MLF1 (3q25.1) 
t(3;21)(q26;q22)  AML1 (21q22) AML1ex5/MDS1/(EVI1)  R4B  446  SKH1§ CML-BC, AML, MDS  43-45  
 MDS1 (3q26) 
 (EVI1) (3q26)  AML1ex6/MDS1/(EVI1R4B  638   CML-BC, AML, MDS  44, 45  
t(4;11)(q21;q23)  MLL (11q23)  MLLex6/AF4 (a:1414)  R5A  317   ALL  14, 16, 46  
 AF4(4q21)  MLLex7/AF4 (a:1414)  R5A 204 (449)  RS4; 11  ALL  14, 16, 46  
  MLLex8/AF4 (a:1414)  R5A 318 (563)   ALL  16, 17, 46  
  MLLex8/AF4 (a:1414)  R5A 465 (710)   T  
  MLLex6/AF4(b:1459)  R5A  272  MV-4-11  ALL  17, 46  
  MLLex7/AF4 (b:1459)  R5A 159 (404)   ALL  14, 17, 46  
  MLLex8/AF4 (b:1459)  R5A 273 (518)   ALL  14, 17  
  MLLex9/AF4 (b:1459)  R5A 420 (665)   T  
  MLLex6/AF4(c:1546)  R5A  185   
  MLLex7/AF4 (c:1546)  R5A 72 (317)   ALL  17  
  MLLex8/AF4 (c:1546)  R5A 186 (431)   ALL  14, 17, 46  
  MLLex9/AF4 (c:1546)  R5A 333 (578)   T  
t(5;12)(q33;p13)  TEL(12p13)  TEL/PDGFR R6D  321   CMML, MDS  47  
 PDGFR (5q33)  
t(5;17)(q35;q22)  NPM(5q35)  NPM(S)/RAR R8E  105   APL 48  
 RAR (17q21)  NPM(L)/RAR R8E  234   APL  48  
t(6;9)(p23;q34)  DEK(6p23)  DEK/CAN R7A  320   AML  49  
 CAN (9q34)  
t(6;11)(q27;q23)  MLL (11q23) MLLex6/AF6 R1D  308  ML-2  AML, ALL¶ 8, 20  
 AF6 (6q27)  MLLex7/AF6 R1D  195 (440)   AML  20  
  MLLex8/AF6  R1D  309 (594)   
  MLLex9/AF6 R1D  456 (741)  T  
t(7;10)(q35;q24)  Activation of HOX11 R4D  212  RPMI8402  T-ALL 50, 51  
t(8;21)(q22;q22)  AML1 (21q22) AMLex5/ETO R4A  353  Kasumi-1§ AML 5, 45, 52  
 ETO (8q22)  
?t(9;9)  SET(9q34)  SET/CAN R7B  393   AUL  53  
 CAN (9q34)  
t(9;11)(p22;q23)  MLL (11q23) MLLex6/AF9 (A)  R5C  321   AML  14  
 AF9 (9p22)  MLLex7/AF9 (A)  R5C 208 (453)  Mono-Mac-6  AML  14  
  MLLex8/AF9 (A)  R5C 322 (567)  Mono-Mac-6  AML  14  
  MLLex9/AF9 (A)  R5C 469 (714)   T  
  MLLex6/AF9(B)  R5D  367   AML  19, 20  
  MLLex7/AF9 (B)  R5D 254 (499)   T  
  MLLex8/AF9(B)  R5D  368 (613)   
  MLLex9/AF9 (B)  R5D 515 (760)   T  
t(9;12)(q34;p13)  TEL(12p13)  TEL/ABL R6C  366   ALL  54  
 ABL (9q34) 
t(9;22)(q34;q11)  BCR (22q11) BCR/ABL e1a2  R6A  320   ALL  23, 55  
 ABL (9q34)  BCR/ABL b2a2  R6B  472  CML  23, 55  
  BCR/ABL b3a2  R6B  397  CML  23, 55  
t(10;11)(p12;q23)  MLL (11q23) MLLex5/AF10 (A;2222)  R2C  202   AML 56, 57  
 AF10 (10p12)  MLLex6/AF10(B:979)  R2D  270   AML  56, 57  
  MLLex7/AF10 (B:979)  R2D 157 (402)   AML  57  
  MLLex8/AF10 (B:979)  R2D 271 (516)   T  
  MLLex9/AF10(B:979)  R2D  418 (663)   
  MLLex6/AF10 (C:2110)  R2C  388  AML  56, 57  
  MLLex7/AF10 (C:2110) R2C  275 (520)   
  MLLex8/AF10 (C:2110)  R2C 389 (634)   T  
  MLLex9/AF10(C:2110)  R2C  536 (781)   
  MLLex6/AF10 (D:883)  R2D  366  AML  57  
  MLLex7/AF10 (D:883) R2D  253 (498)   AML  57  
  MLLex8/AF10 (D:883)  R2D 367 (612)   T  
  MLLex9/AF10(D:883)  R2D  514 (759)   
  MLLex6/AF10 (E:589)  R2E  267  AML  57  
  MLLex7/AF10 (E:589) R2E  154 (399)   
  MLLex8/AF10 (E:589)  R2E 268 (513)   T  
  MLLex9/AF10(E:589)  R2E  415 (660)   
  MLLex5/AF10 (F:1931)  R2C  493  AML¶  
t(10;14)(q24;q11) HOX11 (10q24)    Karpas-299  AML, ALL, CML¶   
dupMLL (11q23) MLL (11q23)  MLLex5/MLLex2  R2F 184   ALL¶  
 MLL (11q23) MLLex6/MLLex2  R2F  258   AML, ALL 15, 20, 21  
  MLLex7/MLLex2  R2F 145 (390)   AML  21  
  MLLex8/MLLex2  R2F  259 (504)  AML  21  
  MLLex9/MLLex2  R2F 406 (651)   AML  21  
t(11;17)(q23;q21) PLZF (11q23)  PLZF/RAR (A:1365)  R8A  315  APL  58, 59  
 RARA (17q21)  PLZF/RAR(B:1452)  R8A  402   APL  59  
t(11;17)(q23;q21) MLL (11q23)  MLLex5/AF17  R2B  281  AML  11  
 AF17 (17q21)  
t(11;19)(q23;p13.1) MLL (11q23)  MLLex6/ELL R1E  330  T  
 ELL (19p13.1)  MLLex7/ELL R1E  217 (462)   AML  9, 60, 61  
  MLLex8/ELL R1E  301 (576)  T  
  MLLex9/ELL R1E 448 (723)   
  MLLex6/ELL-ins120  R1E  450   
  MLLex7/ELL-ins120  R1E 337 (582)   AML  60  
  MLLex8/ELL-ins120  R1E 451 (696)   AML  60  
  MLLex9/ELL-ins120  R1E 598 (845)   T  
t(11;19)(q23;p13.3)  MLL(11q23)  MLLex6/ENL (A:177)  R5B  186  ALL  14, 17  
 ENL (19p13.3) MLLex7/ENL (A:177)  R5B  73 (318) KOCL-44§ ALL  14, 17  
  MLLex8/ENL(A:177)  R5B  187 (432)  KOCL-44§ ALL  14, 17  
  MLLex9/ENL (A:177)  R5B 334 (579)   T  
t(12;21)(p13;q22)  TEL(12p13)  TEL/AML1 R3C  293   ALL  62  
 AML1 (21q22)  TEL/AML1 R3C  332  ALL  62-64  
t(15;17)(q21;q22)  PML (15q21) PMLex3/RARα ex2  R8C  393  NB4  APL 65-67  
 RAR (17q21)  S-form (=BCR3
  PMLex3/RARα ex2  R8C  338  NB4 APL  66  
  S-form splice variant 
  PMLex6/RARα ex2  R8B  427  NB4 APL  66, 67  
  L-form (=BCR1)  
  PMLa ex3 Δex5 + 6/  R8C  464  NB4  APL  67  
  RARα ex2,  
  L-form splice variant 
  PML ex6-(+/−)ins-  R8B  +/−427  APL  66  
  RAR ex2  
  V-form (=BCR2)  
inv(16)(p13q22)  CBF (16q22) CBF/MYH11 (A)  R1A  270  ME-1§ AML  68  
 MYH11 (16p13)  CBF/MYH11 (B)  R1B  483  AML  68  
  CBF/MYH11 (C)  R1B  663  AML  68  
  CBF/MYH11 (D)  R1A  337  AML  68  
  CBF/MYH11 (E)  R1A  544  AML  68  
  CBF/MYH11 (F)  R1B  174  AML  68  
  CBF/MYH11 (G)  R1B  241  AML  68  
  CBF/MYH11 (H)  R1B  348  AML  68  
t(16;21)(p11;q22)  TLS (16p11) TLS/ERG (a)  R4C  318  UTP-L12§ AML  69  
 ERG (21q22)  TLS/ERG (b)  R4C  274 UTP-L12§ AML  69  
  TLS/ERG (c)  R4C 239  UTP-L12§ AML, ALL  69  
  TLS/ERG(d)  R4C  344   ALL¶  
  TLS/ERG (e) R4C  413   ALL¶  
t(17;19)(q22;p13)  E2A(19p13)  E2Aex13/HLFex4 (I)  R3B  390 HAL-01  ALL  70-72  
 HLF (17q22) E2Aex13insHLFex4 (I)  R3B  417   ALL 72  
  E2Aex12/HLFex4 (II)  R3B  207  ALL  72  

Abbreviations: No, number; t, translocation; inv, inversion; p, short chromosome arm; q, long chromosome arm; ex, exon; ins, insertion; T, theoretically possible translocation variant; AML, acute myelogenous leukemia; ALL, acute lymphoblastic leukemia; CML (-BC), chronic myeloid leukemia (in blast crisis); MDS, myelodysplastic syndrome; APL, acute promyelocytic leukemia; AUL, acute undifferentiated leukemia; CMML, chronic myelomonocytic leukemia; ALCL, anaplastic large cell lymphoma; AMMOL, acute myelomonocytic leukemia.

*Letters and numbers in parentheses after the fusion-gene indicates alternative breakpoints and/or splice variants.

†R1 through R8 indicate multiplex reaction number; suffixes A through F indicate split-out reaction.

§Cell line not available for testing described as positive: ME-1 in reference 73, Karpas-45 in reference 7, Kasumi-1 in reference 74, SKH1 in reference 43, UTP-L12 in reference 69, KOCL-44 in reference 14.

‡Numbers in parentheses indicate the size of the co-amplified PCR fragment resulting from the MLL exon 5 primer.

¶Novel variants detected in this study.

Internal positive control.

Because false-negative results are an inherent problem in RT-PCR assays because of varying RNA quality and/or handling errors, we included an internal positive control in which a 690-bp segment of the ubiquitously expressed transcription factor E2A mRNA is amplified.28,29 

Translocation specific cDNA primers.

The amount of patient RNA can be a limiting factor, and efficient cDNA synthesis is therefore a critical step in RT-PCR. To increase the sensitivity of cDNA synthesis and to reduce the background from irrelevant RNA, we opted not to use random hexamer primers, but instead designed a number of translocation-specific cDNA primers shown in Table 2. The cDNA primers were 11 to 13 nucleotides (nt) long and located 10 to 100 nt downstream of the most 3′ PCR primer. The melting temperature (Tm) of the cDNA primers was approximately 40°C, which is sufficiently high to ensure efficient cDNA priming and low enough to ensure that these primers would not interfere with the subsequent PCR reaction that was performed without purification of the cDNA.

Table 2.

Specific cDNA Primers

Name* Sequence 5′ to 3′  
ABL:797L12  GCTGCCATTGAT 
AF10:1150L12  ACCTGAGCTGTG  
AF10:2392L12  CCACTGCCTCTC 
AF10:750L13  GTAGCCACAGTAT  
AF17:1965L11  GACACCGGAAG 
AF1P:445L12  ATGGGAGCTCAG  
AF1Q:804L12  AGGGCTTTTGAG 
AF4:1664L12  TTCCTTGCTGAG  
AF6:355L12  CCGATCATCTTT 
AF9:1536L12  CTGCCATCACTT  
AF9:1910L12  GCATCCAGTTGT 
AFX1:70L12  AAGTGCCAACAG  
ALL1:417L13  TTTGGTCTCTGAT 
AML1A:1921L12  CGGTAGCATTTC  
AML1MDSEVI:2459L12 CCCATCCATAAC  
AML1MDSEVI:4905L12 TAAGGCTGCTCT 
CAN:2896L12  TTGGCTGGTACT  
E2A:1960L11  GCTTCGCTCAG 
ELL:456L12  CCAGCCTTGATG  
ENL:137L12  TCTCCACGAAGT 
ERG:1000L12  TGTAGGCGTAGC  
ETO:350L12  GTGCGAACTCTT 
HLF:1181L12  GGCCTCATACTT  
HOX11:897L11 TGCTGCCTCTC 
MLF1:320L12  TGGTCTGGAAAG  
MYH11:1552L12  CTGCTGGGTGAG 
MYH11:2271L12  AGCTGCTTGATG  
NPMALK:714L12 CAGCGAACAATG  
PBX1:526L11 CCCTCCAGAAG  
PDGFR:2451L12 CTGCAGGAAGGT  
RARA:700L12  CGGTCGTTTCTC  
TAL1:263L11 CCGTGCCTCTA 
Name* Sequence 5′ to 3′  
ABL:797L12  GCTGCCATTGAT 
AF10:1150L12  ACCTGAGCTGTG  
AF10:2392L12  CCACTGCCTCTC 
AF10:750L13  GTAGCCACAGTAT  
AF17:1965L11  GACACCGGAAG 
AF1P:445L12  ATGGGAGCTCAG  
AF1Q:804L12  AGGGCTTTTGAG 
AF4:1664L12  TTCCTTGCTGAG  
AF6:355L12  CCGATCATCTTT 
AF9:1536L12  CTGCCATCACTT  
AF9:1910L12  GCATCCAGTTGT 
AFX1:70L12  AAGTGCCAACAG  
ALL1:417L13  TTTGGTCTCTGAT 
AML1A:1921L12  CGGTAGCATTTC  
AML1MDSEVI:2459L12 CCCATCCATAAC  
AML1MDSEVI:4905L12 TAAGGCTGCTCT 
CAN:2896L12  TTGGCTGGTACT  
E2A:1960L11  GCTTCGCTCAG 
ELL:456L12  CCAGCCTTGATG  
ENL:137L12  TCTCCACGAAGT 
ERG:1000L12  TGTAGGCGTAGC  
ETO:350L12  GTGCGAACTCTT 
HLF:1181L12  GGCCTCATACTT  
HOX11:897L11 TGCTGCCTCTC 
MLF1:320L12  TGGTCTGGAAAG  
MYH11:1552L12  CTGCTGGGTGAG 
MYH11:2271L12  AGCTGCTTGATG  
NPMALK:714L12 CAGCGAACAATG  
PBX1:526L11 CCCTCCAGAAG  
PDGFR:2451L12 CTGCAGGAAGGT  
RARA:700L12  CGGTCGTTTCTC  
TAL1:263L11 CCGTGCCTCTA 

*The primer-names contain the name of the gene (or fusion-gene) used to construct the primer, the 5′ nucleotide number where the primer starts, U or L denotes forward or backward, and the length of the primer. Underlining indicates the gene where the primer is located.

Primers used for detection of HOX11 and EVI1expression. The use of these primers is not discussed further in this presentation.

PBX = PML.

Construction of primers.

All PCR oligonucleotide primers were designed with the primer analysis software OLIGO version 5.0 (National Biosciences Inc, Plymouth, MN) and published sequence data from the EMBL DNA database. Oligonucleotide primers were purchased high-performance liquid chromatography-purified from DNA Technology (Science Park, Aarhus, Denmark).

RT-PCR.

To achieve maximal sensitivity, a nested PCR protocol was used and, to minimize the risk of contamination, filter-tips and four different laboratory rooms with indigenous pipettes were used for (1) preparation of stock solutions; (2) RNA preparation and cDNA synthesis/setup of first PCR; (3) the first to second PCR transfer; and (4) gel electrophoresis. One microgram of total RNA was incubated at 65°C for 5 minutes with a mixture of translocation-specific cDNA primers (2.5 pmol of each) and then reverse transcribed by incubation at 37°C for 45 minutes in a total volume of 25 μL containing 20 U RNase inhibitor (Boehringer), 1 mmol/L of each dNTP, 10 mmol/L dithiothreitol, 50 mmol/L Tris-HCl, pH 8.3, 75 mmol/L KCl, 3 mmol/L MgCl2, and 400 U Moloney murine leukemia virus reverse transcriptase (BRL, Bethesda, MD). After the incubation, the cDNA reaction mixture was diluted with ddH2O to 50 μL. PCR amplification was performed as 8 parallel nested (2-round) multiplex reactions in a Perkin Elmer 9600 thermocycler (Roche Molecular Systems, Branchburg, NJ). Five microliters of diluted cDNA reaction was added to each of 8 20-μL multiplex mixtures that contained 11 mmol/L Tris-HCl, pH 8.3, 55 mmol/L KCl, 1.65 mmol/L MgCl2, 0.2 mmol/L of each dNTP, a mixture of oligonucleotide primers (5 pmol of each primer), and 1.5 U AmpliTaq-Gold polymerase (Perkin Elmer). The first PCR consisted of an initial activation of the polymerase at 95°C for 15 minutes, followed by 25 cycles of PCR amplification (annealing at 58°C for 30 seconds, elongation at 72°C for 1 minute, and denaturation at 95°C for 30 seconds). After the first PCR, 1-μL aliquots from each of the 8 PCR reactions were transferred to 8 24-μL second-round multiplex mixtures that contained 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.2 mmol/L of each dNTP, 5 to 12.5 pmol of each primer, and 1.5 U AmpliTaq-Gold polymerase. The second PCR consisted of an initial activation of the polymerase at 95°C for 15 minutes, followed by 20 cycles of PCR amplification (annealing at 58°C for 30 seconds, elongation at 72°C for 1 minute, and denaturation at 95°C for 30 seconds), and finally by 10 minutes of extension at 72°C. Fifteen microliters of each PCR reaction was electrophoresed in a 1.5% agarose gel for 60 minutes at 100 V and stained with ethidium bromide as shown in Fig 1A. Negative controls without DNA template were included for all PCR reaction mixtures.

Fig. 1.

Multiplex RT-PCR and split-out analysis. (A) The two cell lines MV-4-11 and Mono-Mac-6 and patient no. 243 were positive for a translocation in multiplex reaction R5 (see Table 3). (B) To determine the translocation, a split-out PCR analysis was performed using the individual primer sets R5A, R5B, R5C, and R5D. M, DNA molecular weight marker VI (Boehringer).

Fig. 1.

Multiplex RT-PCR and split-out analysis. (A) The two cell lines MV-4-11 and Mono-Mac-6 and patient no. 243 were positive for a translocation in multiplex reaction R5 (see Table 3). (B) To determine the translocation, a split-out PCR analysis was performed using the individual primer sets R5A, R5B, R5C, and R5D. M, DNA molecular weight marker VI (Boehringer).

Split-out PCR and DNA sequence analysis.

Because each multiplex reaction identifies a number of translocations, many of which may be found in several variants, the number of possible translocation-positive PCR fragments is large (Table 1). To determine and verify a fusion gene in a positive multiplex reaction, we therefore performed split-out analysis using individual primer sets, as outlined in Fig 1B and detailed in Table 3. The split-out was performed using the same reaction conditions as for the multiplex PCR, except that only 1 U/reaction of AmpliTaq-Gold polymerase was used. Split-out of samples with a limiting amount of RNA was performed with 1 μL from the first round multiplex PCR as template and the second-round individual PCR primer sets. These analyses were performed with and without the internal positive control primers. Negative controls without DNA template were included for all PCR reaction mixtures. The presence of translocations were confirmed by determination of the sequence of the translocation specific DNA fragment. The DNA sequencing was performed using agarose gel-purified PCR fragments as a template and a Taq DyeDeoxy Terminator Sequencing kit (Perkin Elmer). The product was analyzed using an automated 373A DNA sequencer (Applied Biosystems, Foster City, CA).

Table 3.

Primers Used in the Multiplex PCR

Multiplex No.  Split-Out Reaction Primers 1. PCR  Primers 2. PCR 
Name  Sequence 5′ to 3′  Name  Sequence 5′ to 3′  
R1 AB  CBFB:267U22  TTTGAAGGCTCCCATGATTCTG  CBFBMYH:344U21 TGGGCTGTCTGGAGTTTGATG  
 A  MYH11:2198L22 AGGTCCCCTTCCAGCTTCTTCT  MYH11:2041L19  TGAGCGCCTGCATGTTGAC 
 B  MYH11:1438L24  GAGCTGGATGTTGAGAGTGGAGAT MYH11:1387L20  TCCTCGTCCAGCTGGTCTTG  
 CDE  MLL:3730U20 CCGCCTCAGCCACCTACTAC  MLL:3751U20  GGACCGCCAAGAAAAGAAGT 
 CDE  MLL:3955U24  AGCACTCTCTCCAATGGCAATAGT MLL:3996U24  AGCAGATGGAGTCCACAGGATCAG  
 C  AFX1:29L20 GGGTGACTGGCAGCACAGAT  AFX1:5L24  GGTTTCTTCTTGGGGGCTTTAACT 
 D  AF6:279L21  CCGCTGACATGCACTTCATAG  AF6:242L22 GAGGACAGCATTCGCATATCAG  
 E  ELL:351L23 ACACCGTGATCTTGTCCTGTATG  ELL:306L22  TTCCCCATGACTGGAGACATAC 
 ABCDE  E2A:1075U21  TTCTCGTCCAGCCCTTCTACC  E2A:1173U19 CTACGACGGGGGTCTCCAC  
 ABCDE  E2A:1883L22 TTTTCCTCTTCTCGCCGTTTCA  E2A:1844L19  AGGTTCCGCTCTCGCACTT 
R2  ABCDEF  MLL:3730U20  CCGCCTCAGCCACCTACTAC MLL:3751U20  GGACCGCCAAGAAAAGAAGT  
 ABCDEF  MLL:3955U24 AGCACTCTCTCCAATGGCAATAGT  MLL:3996U24 AGCAGATGGAGTCCACAGGATCAG  
 A  AF1P:273L22 GGATACCTTTGCCATCTGTGTC  AF1P:255L22  TGTCGGCTAAATCCCAAATCT 
 B  AF17:1937L21  CCTCCAGGTCTGGCTCTGTGT  AF17:1834L23 GTAGAGCCAGCCAGAGAAAACAC  
 C  AF10:2363L23 CTGTTCTATGCTGGCTGCTACTG  AF10:2327L21  AACTGCTGTTGCCTGGTTGAT 
 D  AF10:1109L22  TTGCCCTCTGACCCTCTAGTCT  AF10:1074L23 TTCCACTAGAGGTGTGTGCAGAG  
 E  AF10:728L22 TGGACATTATCGGCACCATTAC  AF10:685L21  GGCAAACTGAGCGCATGTTAC 
 F  MLL:391L23  TTTAGAGGGGAAAACACAGATGG  MLL:333L22 TCTAGGTCTCCCACGAGGTTTT  
 ABCDEF  E2A:1075U21 TTCTCGTCCAGCCCTTCTACC  E2A:1173U19  CTACGACGGGGGTCTCCAC 
 ABCDEF  E2A:1883L22  TTTTCCTCTTCTCGCCGTTTCA E2A:1884L19  AGGTTCCGCTCTCGCACTT  
R3  A  PBX1:459L18* GCCACGCCTTCCGCTAAC  PBX1:436L21  CATGTTGTCCAGCCGCATCAG 
 D  SIL:24U19  CGACCCCAACGTCCCAGAG  SIL:83U20 CCCGCTCCTACCCTGCAAAC  
 D  TAL1:203L21 CGGTCATCCTGGGGCATATTT  TAL1:179L20  AGACCGGCCCCTCTGAATAG 
 B  HLF:1140L20  GCCCAGCTCCTTCCTCAAGT  HLF:998L20 CGCCTTGCCCAGTACTTGTC  
 C  TEL:871U23 CACTCCGTGGATTTCAAACAGTC  TEL:944U23  CTCATCGGGAAGACCTGGCTTAC 
 C  AML1A:1891L23  AGCCGAGTAGTTTTCATCATTGC AML1A:1772L21  AGCACGGAGCAGAGGAAGTTG  
 ABCD E2A:1075U21  TTCTCGTCCAGCCCTTCTACC  E2A:1173U19 CTACGACGGGGGTCTCCAC  
 ABCD  E2A:1883L22 TTTTCCTCTTCTCGCCGTTTCA  E2A:1844L19  AGGTTCCGCTCTCGCACTT 
R4  AB  AML1A:1863U21  GATGGCACTCTGGTCACTGTG AML1A:1885U20  TGGCTGGCAATGATGAAAAC  
 AMLMDSEVI:2375L24  CGATCTTCCTTTTGGTCCATATTC AMLMDSEVI:2345L21  CCCCAGGCATATTTGACTCTC  
 D HOX11:590U20  GGGCGTCAACAACCTCACTG  HOX11:617U22 CTTCCCCTGGATGGAGAGTAAC  
 D HOX11:857L21 GTCTGCCGTCTCCACTTTGTC  HOX11:810L19  GCGCATCGGTCATTTTGAG 
 A  ETO:327L23  TCTCCTATCTCGGGTGAAATGTC  ETO:116L22 CGTTGTCGGTGTAAATGAACTG  
 C  TLS:649U19 GGTGGCGGTTATGGCAATC  TLS:690U19  CAGCGGTGGCTATGGACAG 
 C  ERG:908L22  GTTCATGTTGGGTTTGCTCTTC  ERG:833L19 GGTGCCTTCCCAGGTGATG  
 ABCD  E2A:1075U21 TTCTCGTCCAGCCCTTCTACC  E2A:1173U19  CTACGACGGGGGTCTCCAC 
 ABCD  E2A:1883L22  TTTTCCTCTTCTCGCCGTTTCA E2A:1844L19  AGGTTCCGCTCTCGCACTT  
R5  ABCDE MLL:3730U20  CCGCCTCAGCCACCTACTAC  MLL:3751U20 GGACCGCCAAGAAAAGAAGT  
 ABCDE  MLL:3955U24 AGCACTCTCTCCAATGGCAATAGT  MLL:3996U24 AGCAGATGGAGTCCACAGGATCAG  
 A  AF4:1636L29 GAATTTGAGTGAGTTTTTGAAGATGTATC  AF4:1606L25 GTTTTTGGTTTGGGTTACAGAACT  
 D  AF9:1869L24  AF9:1818L24  GAGCAAAGATCAAAATCAAATGTT  
 AF9:1498L22  CCAGATGTTTCCAGGTAACTCTGT  AF9:1466L26 CTCCATTTCAGAGTCATTGTCGTTAT  
 E  AF1Q:660L22 TTCGGCTGCCTCCTCTATTTAC  AF1Q:580L20  TGCTGGCAATGGGAGCTCTC 
 B  ENL:81L22  GCTTGAGAGGGAAGACAATGAG  ENL:30L19 GCGATGCCCCAGCTCTAAC  
 ABCDE  E2A:1075U21 CACCATCCAGTCGTGAGTGAAC  E2A:1173U19  CTACGACGGGGGTCTCCAC 
 ABCDE  E2A:1883L22  TTCTCGTCCAGCCCTTCTACC  E2A:1844L19 AGGTTCCGCTCTCGCACTT 
   TTTTCCTCTTCTCGCCGTTTCA  
R6  BCR:1698U19  CGCTCTCCCTCGCAGAACT  BCR:1777U19 ACTGCCCGGTTGTCGTGTC  
 B  BCR:3060U23 GAGTCACTGCTGCTGCTTATGTC  BCR:3128U22  CACGTTCCTGATCTCCTCTGAC 
 ABC  ABL:661L20  TTTTGGTTTGGGCTTCACAC  ABL:642L23 ACACCATTCCCCATTGTGATTAT  
 CD  TEL:309U21 GCTGCTGACCAAAGAGGACTT  TEL:343U24  CCTCATTCAGGTGATGTGCTCTAT 
 D  PDGFR:2282L22  CATAAGGGCTTGCTTCTCACTG PDGFR:2090L22  CATGGGGTCCACGTAGATGTAC  
 ABCD E2A:1075U21  TTCTCGTCCAGCCCTTCTACC  E2A:1173U19 CTACGACGGGGGTCTCCAC  
 ABCD  E2A:1883L22 TTTTCCTCTTCTCGCCGTTTCA  E2A:1844L19  AGGTTCCGCTCTCGCACTT 
R7  A  DEK:870U24  TGCCAATGTTAAGAAAGCAGATAG  DEK:892U21 AGCAGCACCACCAAGAAGAAT  
 AB  CAN:2872L21 GGCAAGGATTTGGTGTGAGAT  CAN:2642L20  GTCTCTCGCTCTGGCACAAG 
 B  SET:468U23  CACCCGAAATCAAATGGAAATCTG  SET:552U24 TGAGGAACCAGAGAGCTTCTTTAC 
 C AMLMDSEVI:4331U23 CCACTAAGCGAAAGGATGAGAAG  AMLMDSEVI:4509U21 CGTCGAATCAAGACCTGCTTC  
 C AMLMDSEVI:4866L21 TGCCGTGTTAGGTTTGCAGAC  AMLMDSEVI:4746L25 GAACATAGAGGGCACTGACTGTAAG  
 ABC  E2A:1075U21 TTCTCGTCCAGCCCTTCTACC  E2A:1173U19  CTACGACGGGGGTCTCCAC 
 ABC  E2A:1883L22  TTTTCCTCTTCTCGCCGTTTCA  E2A:1884L19 AGGTTCCGCTCTCGCACTT  
R8  A  PLZF:1092U21 CCACAAGGCTGACGCTGTATT  PLZF:1252U21  GTGGGCATGAAGTCAGAGAGC 
 B  PML3:1211U19  CAAGAAAGCCAGCCCAGAG  PML3:1370U21 GCCAGTGTACGCCTTCTCCAT  
 C  PML3:861U19 GTGCGCCAGGTGGTAGCTC  PML3:930U20  CAGCGCGACTACGAGGAGAT 
 ABCE  RARA:540L19  AAGCCCTTGCAGCCCTCAC  RARA:508L22 CCCATAGTGGTAGCCTGAGGAC  
 DEF  NPM:290U25 ACGAAGGCAGTCCAATTAAAGTAAC  NPM:403U21  GGTTCAGGGCCAGTGCATATT 
 D  NPMALK:627L21  CACACTTCAGGCAGCGTCTTC NPMALK:590L19  CTTGGGTCGTTGGGCATTC  
 MLF1:235L27  AGCTCTCCCTCTACCATCAGAGATACT  MLF1:192L28 AAAGGGTTCAGAAAAACTTCTTATCATC  
 ABCDEF  E2A:1075U21 TTCTCGTCCAGCCCTTCTACC  E2A:1173U19  CTACGACGGGGGTCTCCAC 
 ABCDEF  E2A:1883L22  TTTTCCTCTTCTCGCCGTTTCA E2A:1844L19  AGGTTCCGCTCTCGCACTT 
Multiplex No.  Split-Out Reaction Primers 1. PCR  Primers 2. PCR 
Name  Sequence 5′ to 3′  Name  Sequence 5′ to 3′  
R1 AB  CBFB:267U22  TTTGAAGGCTCCCATGATTCTG  CBFBMYH:344U21 TGGGCTGTCTGGAGTTTGATG  
 A  MYH11:2198L22 AGGTCCCCTTCCAGCTTCTTCT  MYH11:2041L19  TGAGCGCCTGCATGTTGAC 
 B  MYH11:1438L24  GAGCTGGATGTTGAGAGTGGAGAT MYH11:1387L20  TCCTCGTCCAGCTGGTCTTG  
 CDE  MLL:3730U20 CCGCCTCAGCCACCTACTAC  MLL:3751U20  GGACCGCCAAGAAAAGAAGT 
 CDE  MLL:3955U24  AGCACTCTCTCCAATGGCAATAGT MLL:3996U24  AGCAGATGGAGTCCACAGGATCAG  
 C  AFX1:29L20 GGGTGACTGGCAGCACAGAT  AFX1:5L24  GGTTTCTTCTTGGGGGCTTTAACT 
 D  AF6:279L21  CCGCTGACATGCACTTCATAG  AF6:242L22 GAGGACAGCATTCGCATATCAG  
 E  ELL:351L23 ACACCGTGATCTTGTCCTGTATG  ELL:306L22  TTCCCCATGACTGGAGACATAC 
 ABCDE  E2A:1075U21  TTCTCGTCCAGCCCTTCTACC  E2A:1173U19 CTACGACGGGGGTCTCCAC  
 ABCDE  E2A:1883L22 TTTTCCTCTTCTCGCCGTTTCA  E2A:1844L19  AGGTTCCGCTCTCGCACTT 
R2  ABCDEF  MLL:3730U20  CCGCCTCAGCCACCTACTAC MLL:3751U20  GGACCGCCAAGAAAAGAAGT  
 ABCDEF  MLL:3955U24 AGCACTCTCTCCAATGGCAATAGT  MLL:3996U24 AGCAGATGGAGTCCACAGGATCAG  
 A  AF1P:273L22 GGATACCTTTGCCATCTGTGTC  AF1P:255L22  TGTCGGCTAAATCCCAAATCT 
 B  AF17:1937L21  CCTCCAGGTCTGGCTCTGTGT  AF17:1834L23 GTAGAGCCAGCCAGAGAAAACAC  
 C  AF10:2363L23 CTGTTCTATGCTGGCTGCTACTG  AF10:2327L21  AACTGCTGTTGCCTGGTTGAT 
 D  AF10:1109L22  TTGCCCTCTGACCCTCTAGTCT  AF10:1074L23 TTCCACTAGAGGTGTGTGCAGAG  
 E  AF10:728L22 TGGACATTATCGGCACCATTAC  AF10:685L21  GGCAAACTGAGCGCATGTTAC 
 F  MLL:391L23  TTTAGAGGGGAAAACACAGATGG  MLL:333L22 TCTAGGTCTCCCACGAGGTTTT  
 ABCDEF  E2A:1075U21 TTCTCGTCCAGCCCTTCTACC  E2A:1173U19  CTACGACGGGGGTCTCCAC 
 ABCDEF  E2A:1883L22  TTTTCCTCTTCTCGCCGTTTCA E2A:1884L19  AGGTTCCGCTCTCGCACTT  
R3  A  PBX1:459L18* GCCACGCCTTCCGCTAAC  PBX1:436L21  CATGTTGTCCAGCCGCATCAG 
 D  SIL:24U19  CGACCCCAACGTCCCAGAG  SIL:83U20 CCCGCTCCTACCCTGCAAAC  
 D  TAL1:203L21 CGGTCATCCTGGGGCATATTT  TAL1:179L20  AGACCGGCCCCTCTGAATAG 
 B  HLF:1140L20  GCCCAGCTCCTTCCTCAAGT  HLF:998L20 CGCCTTGCCCAGTACTTGTC  
 C  TEL:871U23 CACTCCGTGGATTTCAAACAGTC  TEL:944U23  CTCATCGGGAAGACCTGGCTTAC 
 C  AML1A:1891L23  AGCCGAGTAGTTTTCATCATTGC AML1A:1772L21  AGCACGGAGCAGAGGAAGTTG  
 ABCD E2A:1075U21  TTCTCGTCCAGCCCTTCTACC  E2A:1173U19 CTACGACGGGGGTCTCCAC  
 ABCD  E2A:1883L22 TTTTCCTCTTCTCGCCGTTTCA  E2A:1844L19  AGGTTCCGCTCTCGCACTT 
R4  AB  AML1A:1863U21  GATGGCACTCTGGTCACTGTG AML1A:1885U20  TGGCTGGCAATGATGAAAAC  
 AMLMDSEVI:2375L24  CGATCTTCCTTTTGGTCCATATTC AMLMDSEVI:2345L21  CCCCAGGCATATTTGACTCTC  
 D HOX11:590U20  GGGCGTCAACAACCTCACTG  HOX11:617U22 CTTCCCCTGGATGGAGAGTAAC  
 D HOX11:857L21 GTCTGCCGTCTCCACTTTGTC  HOX11:810L19  GCGCATCGGTCATTTTGAG 
 A  ETO:327L23  TCTCCTATCTCGGGTGAAATGTC  ETO:116L22 CGTTGTCGGTGTAAATGAACTG  
 C  TLS:649U19 GGTGGCGGTTATGGCAATC  TLS:690U19  CAGCGGTGGCTATGGACAG 
 C  ERG:908L22  GTTCATGTTGGGTTTGCTCTTC  ERG:833L19 GGTGCCTTCCCAGGTGATG  
 ABCD  E2A:1075U21 TTCTCGTCCAGCCCTTCTACC  E2A:1173U19  CTACGACGGGGGTCTCCAC 
 ABCD  E2A:1883L22  TTTTCCTCTTCTCGCCGTTTCA E2A:1844L19  AGGTTCCGCTCTCGCACTT  
R5  ABCDE MLL:3730U20  CCGCCTCAGCCACCTACTAC  MLL:3751U20 GGACCGCCAAGAAAAGAAGT  
 ABCDE  MLL:3955U24 AGCACTCTCTCCAATGGCAATAGT  MLL:3996U24 AGCAGATGGAGTCCACAGGATCAG  
 A  AF4:1636L29 GAATTTGAGTGAGTTTTTGAAGATGTATC  AF4:1606L25 GTTTTTGGTTTGGGTTACAGAACT  
 D  AF9:1869L24  AF9:1818L24  GAGCAAAGATCAAAATCAAATGTT  
 AF9:1498L22  CCAGATGTTTCCAGGTAACTCTGT  AF9:1466L26 CTCCATTTCAGAGTCATTGTCGTTAT  
 E  AF1Q:660L22 TTCGGCTGCCTCCTCTATTTAC  AF1Q:580L20  TGCTGGCAATGGGAGCTCTC 
 B  ENL:81L22  GCTTGAGAGGGAAGACAATGAG  ENL:30L19 GCGATGCCCCAGCTCTAAC  
 ABCDE  E2A:1075U21 CACCATCCAGTCGTGAGTGAAC  E2A:1173U19  CTACGACGGGGGTCTCCAC 
 ABCDE  E2A:1883L22  TTCTCGTCCAGCCCTTCTACC  E2A:1844L19 AGGTTCCGCTCTCGCACTT 
   TTTTCCTCTTCTCGCCGTTTCA  
R6  BCR:1698U19  CGCTCTCCCTCGCAGAACT  BCR:1777U19 ACTGCCCGGTTGTCGTGTC  
 B  BCR:3060U23 GAGTCACTGCTGCTGCTTATGTC  BCR:3128U22  CACGTTCCTGATCTCCTCTGAC 
 ABC  ABL:661L20  TTTTGGTTTGGGCTTCACAC  ABL:642L23 ACACCATTCCCCATTGTGATTAT  
 CD  TEL:309U21 GCTGCTGACCAAAGAGGACTT  TEL:343U24  CCTCATTCAGGTGATGTGCTCTAT 
 D  PDGFR:2282L22  CATAAGGGCTTGCTTCTCACTG PDGFR:2090L22  CATGGGGTCCACGTAGATGTAC  
 ABCD E2A:1075U21  TTCTCGTCCAGCCCTTCTACC  E2A:1173U19 CTACGACGGGGGTCTCCAC  
 ABCD  E2A:1883L22 TTTTCCTCTTCTCGCCGTTTCA  E2A:1844L19  AGGTTCCGCTCTCGCACTT 
R7  A  DEK:870U24  TGCCAATGTTAAGAAAGCAGATAG  DEK:892U21 AGCAGCACCACCAAGAAGAAT  
 AB  CAN:2872L21 GGCAAGGATTTGGTGTGAGAT  CAN:2642L20  GTCTCTCGCTCTGGCACAAG 
 B  SET:468U23  CACCCGAAATCAAATGGAAATCTG  SET:552U24 TGAGGAACCAGAGAGCTTCTTTAC 
 C AMLMDSEVI:4331U23 CCACTAAGCGAAAGGATGAGAAG  AMLMDSEVI:4509U21 CGTCGAATCAAGACCTGCTTC  
 C AMLMDSEVI:4866L21 TGCCGTGTTAGGTTTGCAGAC  AMLMDSEVI:4746L25 GAACATAGAGGGCACTGACTGTAAG  
 ABC  E2A:1075U21 TTCTCGTCCAGCCCTTCTACC  E2A:1173U19  CTACGACGGGGGTCTCCAC 
 ABC  E2A:1883L22  TTTTCCTCTTCTCGCCGTTTCA  E2A:1884L19 AGGTTCCGCTCTCGCACTT  
R8  A  PLZF:1092U21 CCACAAGGCTGACGCTGTATT  PLZF:1252U21  GTGGGCATGAAGTCAGAGAGC 
 B  PML3:1211U19  CAAGAAAGCCAGCCCAGAG  PML3:1370U21 GCCAGTGTACGCCTTCTCCAT  
 C  PML3:861U19 GTGCGCCAGGTGGTAGCTC  PML3:930U20  CAGCGCGACTACGAGGAGAT 
 ABCE  RARA:540L19  AAGCCCTTGCAGCCCTCAC  RARA:508L22 CCCATAGTGGTAGCCTGAGGAC  
 DEF  NPM:290U25 ACGAAGGCAGTCCAATTAAAGTAAC  NPM:403U21  GGTTCAGGGCCAGTGCATATT 
 D  NPMALK:627L21  CACACTTCAGGCAGCGTCTTC NPMALK:590L19  CTTGGGTCGTTGGGCATTC  
 MLF1:235L27  AGCTCTCCCTCTACCATCAGAGATACT  MLF1:192L28 AAAGGGTTCAGAAAAACTTCTTATCATC  
 ABCDEF  E2A:1075U21 TTCTCGTCCAGCCCTTCTACC  E2A:1173U19  CTACGACGGGGGTCTCCAC 
 ABCDEF  E2A:1883L22  TTTTCCTCTTCTCGCCGTTTCA E2A:1844L19  AGGTTCCGCTCTCGCACTT 

The nomenclature of the primers is as in Table 2.

*

PBX = PML.

Primers used for detection of HOX11 and EVI1expression. The use of these primers is not discussed further in this presentation.

RESULTS

Optimization of multiplex RT-PCR conditions.

The aim of the multiplex RT-PCR procedure is to detect and define translocation-specific mRNA related to leukemia. To set up the procedure, we first defined primers with a binding sequence near putative breakpoints of the corresponding mRNA sequence. Primers were designed to allow identical conditions in all PCR reactions. For cDNA synthesis, we elected to use primers specific for the recombined mRNA rather than random or poly-dT primers. Use of specific primers improved sensitivity 25- to 125-fold relative to random hexamer primers. When cell lines or patient material were available with known translocations that lead to recombination-specific mRNA, we tested the constructed primer pairs in PCR reactions before and after combining the different primer sets into the multiplex PCR reaction. If not working properly, the primers were redesigned. Finally, the sensitivity of the multiplex PCR assay was evaluated by limiting dilution experiments in which fivefold dilutions of RNA from translocation-positive cell lines were mixed with RNA from the NALM-6 cell line. Several series of multiplex RT-PCR experiments consistently showed that the translocation positive band could be readily detected in the 3,000- or 15,000-fold dilutions, indicating that the multiplex assay, at least for the cell lines tested, may detect 1 malignant cell out of 5,000 normal cells.

Translocations detected in AML and ALL patients by the multiplex PCR analysis.

To verify the value of the multiplex PCR system, we reproduced cytogenetic findings by multiplex PCR with material from cell lines and patients with known translocations. To evaluate the multiplex RT-PCR as a potential diagnostic tool used in up-front leukemia diagnosis, we next applied the multiplex PCR assay in a retrospective analysis of RNA purified from cryopreserved mononuclear blood or bone marrow samples of 102 AML and 62 pediatric ALL patients. RNA quality was evaluated by inspection of the 8 internal positive control bands in the multiplex PCR. In 8 of 102 of the AML and in 6 of 62 of the ALL cases, the internal positive control band had a weak and scattered appearance or was absent. This could be ascribed to insufficient amount or quality of RNA due to low cell number or cell lysis.

As seen in Tables 4 and 5, the multiplex PCR analysis detected a fusion gene in 45 of 102 of the AML and in 28 of 62 of the ALL cases. The frequencies and distributions between the two patient groups of the 16 different chromosomal aberrations resulting in a fusion gene that could be detected in the multiplex PCR are compared with cytogenetic data in Table 6. Examples of various aberrations detected by the multiplex RT-PCR are shown in Fig 2. The value of the described multiplex PCR analysis is demonstrated by the finding of 3 previously undescribed fusion gene variants: (1) a duplication of the MLL gene in which exon 5 was fused to exon 2 (patient no. 44), (2) a new breakpoint of the AF10 gene in a t(10;11)(p12;q23) (patient no. 22),30 and (3) a new breakpoint in the TLS gene in a t(16;21)(p11;q22) (patient no. 93).

Table 4.

Multiplex RT-PCR and Cytogenetic Data on 102 AML Patients

UPN3-150 Status  Sex  Age (yr)  Sample Multiplex RT-PCR  Karyotype  
A  
   15  Presen.  30  PB  t(8;21)(q22;q22)  46,XX,t(8;21)(q22;q22)[5] 
   16  Presen.  F  18  PB  t(8;21)(q22;q22) 46,XX[1]/47,XX,ins(1)(q11;?),+mar[5]  
   19  Presen. F  2.5  BM  t(6;11)(q27;q23)  46,XX[10]  
   20 Presen.  M  68  PB  inv(16)(p13;q22) 46,XY[2]/46,XY,inv(16)(p13q22)[8]  
   22  Presen. M  9  PB  t(10;11)(p12;q23) 46,XY,t(10;11)(q23;q25)[3]/47,XY,ibid,der(19)t(1;19)(q21;p13 or q13)[9]  
   23  Relapse  F  38  PB t(6;9)(p23;q34)  46,XX,t(6;9)(p23;q34)[10]  
   25 Relapse  M  43  PB  inv(16)(p13;q22) 46,XY[4]/46,XY,inv(16)(p13q22)[6]  
   29  Relapse M  73  PB  t(8;21)(q22;q22) 46,XY,t(8;21)(q22;q22)[6]  
   31  Presen.  M  64 PB  dupMLL(11q23)  Failed  
   43  Relapse M  72  PB  dupMLL(11q23)  Failed  
   44 Presen.  M  84  PB  dupMLL(11q23) 47,XY,+8[3]/48,XY,+8,+18[7]  
   48  Presen.  34  BM  t(9;11)(q22;q23)  46,XX[4]  
   62 Presen.  F  24  BM  dupMLL(11q23) 46,XX[2]  
   67  Remis.  M  52  PB dupMLL(11q23)  46,XY[1]/46,XY,del(9)(q?31)[4] 
   70  Remis.  M  60  PB  dupMLL(11q23) 46,XY[10]  
   73  Presen.  F  1.0  PB t(10;11)(p12;q23) 46,X,der(X)t(X;1)(q13;q12),10,der(11)t(10;11)(q22;q23),+mar[11] 
   75  Presen.  F  38  BM  t(11;19)(q23;p13.1) 46,XX,[8]/47,XX,+8[2]  
   84  Presen.  M  57 PB  t(15;17)(q21;q22) 46,XY[1]/47,XY,+Y[6]/48,XY,+Y,+?21[2]  
  137  Presen. M  60  BM  dupMLL(11q23)  Failed  
  181 Presen.  F  40  PB  t(8;21)(q22;q22) 46,XX,dup(1)(q21qter),add(14q)[10]  
  186  Presen.  41  PB  t(8;21)(q22;q22) 46,XY,t(3;3)(q26,q29)[8]/47,XY,idem,+21[2]  
  192 Presen.  M  76  PB  dupMLL(11q23) 46,XY[1]  
  208  Presen.  F  66  PB t(6;9)(p23;q34)  46,XX[2]  
  212  Relapse  F  55 PB  dupMLL(11q23)  47,XX,+83-150[1]  
  221 Presen.  F  44  PB  inv(16)(p13;q22)  46,XX[10] 
  223  Presen.  F  63  PB  inv(16)(p13;q22) 46,XX[1]  
  267  Presen.  M  70  PB t(15;17)(q21;q22)  46,XY,t(15;17)(q?22;q11.2)[8]  
  342 Presen.  F  23  PB  t(15;17)(q21;q22)  46,XX[10] 
 10023-151 Presen.  M  69  PB  t(15;17)(q21;q22) 47,XY,+8[4]/47,XY,+8,del(17)(q?24)[10]  
 10043-151 Presen. M  65  PB  t(15;17)(q21;q22)  46,XY[5]  
 
  18  Presen.  M  2.0  PB  inv(16)(p13;q22)  ND 
 118  Presen.  M  57  PB  inv(16)(p13;q22)  ND 
 119  Presen.  M  77  PB  t(15;17)(q21;q22)  ND 
 122  Presen.  F  41  PB  t(9;22)(q34;q11)  ND 
 125  Presen.  M  21  PB  dupMLL(11q23) ND  
 128  Presen.  F  55  PB  t(8;21)(q22;q22) ND  
 129  Presen.  M  21  BM dupMLL(11q23)  ND  
 132  Presen.  M  43 BM  t(8;21)(q22;q22)  ND  
 145  Presen.  F  82 PB  t(9;22)(q34;q11)  ND  
 148  Presen.  F  59 PB  t(9;22)(q34;q11)  ND  
 161  Presen.  M  79 PB  t(15;17)(q21;q22)  ND  
 172  Presen.  F  71 PB  dupMLL(11q23)  ND  
 193  Presen.  55  PB  t(8;21)(q22;q22)  ND  
 200  Presen.  33  PB  t(6;11)(q27;q23)  ND  
 240  Remis.  1.0  PB  t(2;5)(p23;q35)  ND  
 
C  
  28 Presen.  F  38  PB  NAD  46,XX[6]  
  34 Presen.  M  75  PB  NAD  Failed  
  36 Presen.  F  53  PB  NAD  46,XX[10]  
  39 Presen.  M  23  PB  Ins. N/Q cells 46,XY,t(15;17)(q22;q21)[10]  
  45  Presen.  F  62 BM  Ins. N/Q cells  46,XX[4]/47-48,X,idic(X),+8[cp.6] 
  46  Presen.  F  49  PB  NAD  46,XX[10] 
  47  Presen.  M  65  PB  NAD  47,XY,+8[10] 
  51  Presen.  F  83  PB  NAD 46,XX[7]/48-49,X,−X,+dic(17;17)(p11;p11),+19[cp.3]  
  53 Presen.  F  39  PB  NAD  46,XX[10]  
  54 Presen.  F  53  PB  NAD  46,XX[10]  
  55 Presen.  M  71  PB  NAD 46,XY[8]/48,XY,+8,+18[7] 
  56  Relapse  F  32 PB  NAD  46,XX[10] 
  57  Presen.  M  56 PB  NAD  45,XY,−7[3]  
  58  Presen.  F  PB  NAD  46,XX[12]/47,XX,+4[5]  
  60  Presen. F  43  PB  NAD  46,XY[10]  
  66  Presen. F  78  PB  NAD  46,XX[10]  
  71  Presen. F  49  PB  NAD  46,XX,der(21)t(?X;21)(q26;q11.2)[10] 
  72  Presen.  F  65  PB  NAD  46,XX[10] 
  76  Presen.  F  70  PB  NAD  46,XX[4] 
  79  Presen.  M  69  PB  NAD  46,XY[12] 
  80  Presen.  F  48  PB  NAD  46,XX[10] 
  82  Presen.  F  55  PB  NAD  46,XX[10] 
  83  Presen.  F  53  PB  NAD  46,XX[10] 
  85  Relapse  M  71  BM  NAD 46,XY[2]/45,XY,−7[7]  
  86  Remis.  M  51 PB  NAD  46,XY[6]  
 144  Presen.  F  39  BM NAD  46,XX[8]  
 146  Presen.  M  63  PB NAD  46,XY[10]  
 150  Presen.  F  63  PB Ins, N/Q cells  46,XX[10]  
 179  Presen.  M  63 PB  NAD  47,XY,+8[6]  
 183  Presen.  M  74 PB  NAD  46,XY[5]  
 184  Presen.  M  42  BM NAD  46,XY[10]  
 185  Presen.  M  73  PB NAD  46,XY[3]  
 190  Presen.  M  75  PB NAD  46,XX[3] 46,XX,5q-[2]  
 195  Presen.  68  PB  NAD  47,XX,+4[2]  
 201  Presen.  48  PB  NAD  46,XY[10]  
 210  Presen.  47  PB  NAD  46,XY[11]  
 
D  
  30  Presen. F  71  PB  NAD  ND  
  33  Presen.  M  74 PB  Ins. N/Q cells  ND  
  78  Presen.  M  78 BM  NAD  ND  
  87  Presen.  M  76  PB NAD  ND  
 116  Presen.  F  38  PB  NAD  ND 
 130  Presen.  F  72  PB  NAD  ND  
 131 Presen.  F  38  BM  NAD  ND  
 133  Presen. F  35  PB  Ins. N/Q cells  ND  
 136  Presen. F  75  PB  Ins. N/Q cells  ND  
 140  Presen. F  47  PB  Ins. N/Q cells  ND  
 141  Presen. F  82  BM  NAD  ND  
 153  Presen.  F  36 PB  NAD  ND  
 155  Presen.  M  78  PB  NAD ND  
 158  Presen.  F  80  BM  Ins. N/Q cells ND  
 159  Presen.  M  77  PB  NAD  ND 
 160  Presen.  F  76  BM  NAD  ND  
 164 Presen.  M  22  PB  NAD  ND  
 169  Presen. F  75  BM  NAD  ND  
 170  Presen.  M  57 PB  NAD  ND  
 171  Presen.  M  79  BM  NAD ND  
 178  Presen.  F  56  PB  NAD  ND 
UPN3-150 Status  Sex  Age (yr)  Sample Multiplex RT-PCR  Karyotype  
A  
   15  Presen.  30  PB  t(8;21)(q22;q22)  46,XX,t(8;21)(q22;q22)[5] 
   16  Presen.  F  18  PB  t(8;21)(q22;q22) 46,XX[1]/47,XX,ins(1)(q11;?),+mar[5]  
   19  Presen. F  2.5  BM  t(6;11)(q27;q23)  46,XX[10]  
   20 Presen.  M  68  PB  inv(16)(p13;q22) 46,XY[2]/46,XY,inv(16)(p13q22)[8]  
   22  Presen. M  9  PB  t(10;11)(p12;q23) 46,XY,t(10;11)(q23;q25)[3]/47,XY,ibid,der(19)t(1;19)(q21;p13 or q13)[9]  
   23  Relapse  F  38  PB t(6;9)(p23;q34)  46,XX,t(6;9)(p23;q34)[10]  
   25 Relapse  M  43  PB  inv(16)(p13;q22) 46,XY[4]/46,XY,inv(16)(p13q22)[6]  
   29  Relapse M  73  PB  t(8;21)(q22;q22) 46,XY,t(8;21)(q22;q22)[6]  
   31  Presen.  M  64 PB  dupMLL(11q23)  Failed  
   43  Relapse M  72  PB  dupMLL(11q23)  Failed  
   44 Presen.  M  84  PB  dupMLL(11q23) 47,XY,+8[3]/48,XY,+8,+18[7]  
   48  Presen.  34  BM  t(9;11)(q22;q23)  46,XX[4]  
   62 Presen.  F  24  BM  dupMLL(11q23) 46,XX[2]  
   67  Remis.  M  52  PB dupMLL(11q23)  46,XY[1]/46,XY,del(9)(q?31)[4] 
   70  Remis.  M  60  PB  dupMLL(11q23) 46,XY[10]  
   73  Presen.  F  1.0  PB t(10;11)(p12;q23) 46,X,der(X)t(X;1)(q13;q12),10,der(11)t(10;11)(q22;q23),+mar[11] 
   75  Presen.  F  38  BM  t(11;19)(q23;p13.1) 46,XX,[8]/47,XX,+8[2]  
   84  Presen.  M  57 PB  t(15;17)(q21;q22) 46,XY[1]/47,XY,+Y[6]/48,XY,+Y,+?21[2]  
  137  Presen. M  60  BM  dupMLL(11q23)  Failed  
  181 Presen.  F  40  PB  t(8;21)(q22;q22) 46,XX,dup(1)(q21qter),add(14q)[10]  
  186  Presen.  41  PB  t(8;21)(q22;q22) 46,XY,t(3;3)(q26,q29)[8]/47,XY,idem,+21[2]  
  192 Presen.  M  76  PB  dupMLL(11q23) 46,XY[1]  
  208  Presen.  F  66  PB t(6;9)(p23;q34)  46,XX[2]  
  212  Relapse  F  55 PB  dupMLL(11q23)  47,XX,+83-150[1]  
  221 Presen.  F  44  PB  inv(16)(p13;q22)  46,XX[10] 
  223  Presen.  F  63  PB  inv(16)(p13;q22) 46,XX[1]  
  267  Presen.  M  70  PB t(15;17)(q21;q22)  46,XY,t(15;17)(q?22;q11.2)[8]  
  342 Presen.  F  23  PB  t(15;17)(q21;q22)  46,XX[10] 
 10023-151 Presen.  M  69  PB  t(15;17)(q21;q22) 47,XY,+8[4]/47,XY,+8,del(17)(q?24)[10]  
 10043-151 Presen. M  65  PB  t(15;17)(q21;q22)  46,XY[5]  
 
  18  Presen.  M  2.0  PB  inv(16)(p13;q22)  ND 
 118  Presen.  M  57  PB  inv(16)(p13;q22)  ND 
 119  Presen.  M  77  PB  t(15;17)(q21;q22)  ND 
 122  Presen.  F  41  PB  t(9;22)(q34;q11)  ND 
 125  Presen.  M  21  PB  dupMLL(11q23) ND  
 128  Presen.  F  55  PB  t(8;21)(q22;q22) ND  
 129  Presen.  M  21  BM dupMLL(11q23)  ND  
 132  Presen.  M  43 BM  t(8;21)(q22;q22)  ND  
 145  Presen.  F  82 PB  t(9;22)(q34;q11)  ND  
 148  Presen.  F  59 PB  t(9;22)(q34;q11)  ND  
 161  Presen.  M  79 PB  t(15;17)(q21;q22)  ND  
 172  Presen.  F  71 PB  dupMLL(11q23)  ND  
 193  Presen.  55  PB  t(8;21)(q22;q22)  ND  
 200  Presen.  33  PB  t(6;11)(q27;q23)  ND  
 240  Remis.  1.0  PB  t(2;5)(p23;q35)  ND  
 
C  
  28 Presen.  F  38  PB  NAD  46,XX[6]  
  34 Presen.  M  75  PB  NAD  Failed  
  36 Presen.  F  53  PB  NAD  46,XX[10]  
  39 Presen.  M  23  PB  Ins. N/Q cells 46,XY,t(15;17)(q22;q21)[10]  
  45  Presen.  F  62 BM  Ins. N/Q cells  46,XX[4]/47-48,X,idic(X),+8[cp.6] 
  46  Presen.  F  49  PB  NAD  46,XX[10] 
  47  Presen.  M  65  PB  NAD  47,XY,+8[10] 
  51  Presen.  F  83  PB  NAD 46,XX[7]/48-49,X,−X,+dic(17;17)(p11;p11),+19[cp.3]  
  53 Presen.  F  39  PB  NAD  46,XX[10]  
  54 Presen.  F  53  PB  NAD  46,XX[10]  
  55 Presen.  M  71  PB  NAD 46,XY[8]/48,XY,+8,+18[7] 
  56  Relapse  F  32 PB  NAD  46,XX[10] 
  57  Presen.  M  56 PB  NAD  45,XY,−7[3]  
  58  Presen.  F  PB  NAD  46,XX[12]/47,XX,+4[5]  
  60  Presen. F  43  PB  NAD  46,XY[10]  
  66  Presen. F  78  PB  NAD  46,XX[10]  
  71  Presen. F  49  PB  NAD  46,XX,der(21)t(?X;21)(q26;q11.2)[10] 
  72  Presen.  F  65  PB  NAD  46,XX[10] 
  76  Presen.  F  70  PB  NAD  46,XX[4] 
  79  Presen.  M  69  PB  NAD  46,XY[12] 
  80  Presen.  F  48  PB  NAD  46,XX[10] 
  82  Presen.  F  55  PB  NAD  46,XX[10] 
  83  Presen.  F  53  PB  NAD  46,XX[10] 
  85  Relapse  M  71  BM  NAD 46,XY[2]/45,XY,−7[7]  
  86  Remis.  M  51 PB  NAD  46,XY[6]  
 144  Presen.  F  39  BM NAD  46,XX[8]  
 146  Presen.  M  63  PB NAD  46,XY[10]  
 150  Presen.  F  63  PB Ins, N/Q cells  46,XX[10]  
 179  Presen.  M  63 PB  NAD  47,XY,+8[6]  
 183  Presen.  M  74 PB  NAD  46,XY[5]  
 184  Presen.  M  42  BM NAD  46,XY[10]  
 185  Presen.  M  73  PB NAD  46,XY[3]  
 190  Presen.  M  75  PB NAD  46,XX[3] 46,XX,5q-[2]  
 195  Presen.  68  PB  NAD  47,XX,+4[2]  
 201  Presen.  48  PB  NAD  46,XY[10]  
 210  Presen.  47  PB  NAD  46,XY[11]  
 
D  
  30  Presen. F  71  PB  NAD  ND  
  33  Presen.  M  74 PB  Ins. N/Q cells  ND  
  78  Presen.  M  78 BM  NAD  ND  
  87  Presen.  M  76  PB NAD  ND  
 116  Presen.  F  38  PB  NAD  ND 
 130  Presen.  F  72  PB  NAD  ND  
 131 Presen.  F  38  BM  NAD  ND  
 133  Presen. F  35  PB  Ins. N/Q cells  ND  
 136  Presen. F  75  PB  Ins. N/Q cells  ND  
 140  Presen. F  47  PB  Ins. N/Q cells  ND  
 141  Presen. F  82  BM  NAD  ND  
 153  Presen.  F  36 PB  NAD  ND  
 155  Presen.  M  78  PB  NAD ND  
 158  Presen.  F  80  BM  Ins. N/Q cells ND  
 159  Presen.  M  77  PB  NAD  ND 
 160  Presen.  F  76  BM  NAD  ND  
 164 Presen.  M  22  PB  NAD  ND  
 169  Presen. F  75  BM  NAD  ND  
 170  Presen.  M  57 PB  NAD  ND  
 171  Presen.  M  79  BM  NAD ND  
 178  Presen.  F  56  PB  NAD  ND 

(A) PCR-positive patients with cytogenetic data; (B) PCR-positive patients with no cytogenetic data; (C) PCR-negative patients with cytogenetic data; (D) PCR-negative patients with no cytogenetic data.

Abbreviations: Presen., presentation; Remis., remission; PB, peripheral blood; BM, bone marrow; NAD, no abnormality detected; Ins. N/Q cells, insufficient number or quality of cells; ND, not done.

F3-150

Patients for whom both PB and BM samples were analyzed, only 1 has been included in the table.

F3-151

RNA was purified at Aarhus University Hospital before this study.

Table 5.

Multiplex RT-PCR and Cytogenetic Data on 62 Pediatric ALL Patients

UPN  Status  Diagnose  Sex  Age (yr)  Sample Multiplex RT-PCR  Karyotype  
A  
  41  Relapse T-ALL  M  22  PB  t(9;22)(q34;q11) 46,XY[1]/46-47,XY,del(7)(q11q21),+8,der(11)t(11;14)(p14;q21),14, +21,del(21)(q21)[cp.8]  
  89  Presen.  Pre-B-ALL M  2.9  PB  dupMLL(11q23) 53,XY,+X,+4,+6,+8,+14,+17,+18,+21[co.5] 
  90 Relapse  Pre-B-ALL  M  9  PB t(9;22)(q34;q11)  46,XY[2]/46,XY,del(12)(p11.1p12.1)[3] 
  91  Presen.  Pre-B-ALL  M  3.3  BM t(9;22)(q34;q11)  46,XY[10]  
  94  Relapse Pre-B-ALL  M  3.0  PB  t(9;22)(q34;q11) 46,XY[4]/46,XY,t(9;22)(q34;q11)[6]  
  97  Remis. Pre-B-ALL  M  3.4  PB  dupMLL(11q23) 53-54,XY,+X,+Y,add(5p),+8,add(8p),+10,+14,+21[co.6] 
  99  Presen.  Pre-B-ALL  F  0.6  PB t(10;11)(p12;q23)  46,XX,add(21)(q?22)[1]  
 101 Presen.  Pre-B-ALL  M  3.9  PB dupMLL(11q23)  46,XY[10]  
 103  Relapse Pre-B-ALL  M  21  BM  dupMLL(11q23) 46-47,XY,del(1)(q25),del(8)(q?21.1q?22),del(10)(q24),+20,+21, [c.10]  
 108  Remis.  Pre-B-ALL  M  9  BM dupMLL(11q23)  46,XY[5]  
 109  Presen. Pre-B-ALL  M  2.7  PB  t(12;21)(p13;q22) Failed  
 111  Presen.  Pre-B-ALL  M  2.4 PB  dupMLL(11q23)  46,XY[5]  
 229 Presen.  Pre-B-ALL  F  9  BM  t(12;21)(p13;q22) 46,X,del(X)(q?25)[3]  
 234  Presen.  Pre-B-ALL M  5  PB  t(4;11)(q21;q23) 50-51,XY,+Y,+8,+21,+22[cp.3]  
  ?  
 243 Presen.  T-ALL  M  1.0  PB  t(11;19)(q23;p13.3) 46,XY,ins(1)(q21;?)[16]/46,XY,idem,t(14;?)(q11;?)[3]/48,XY, ins(1)(q21;?),+8,+8[3]  
 253  Presen.  Pre-B-ALL  3.4  PB  t(1;19)(q23;p13)  Failed  
 254 Presen.  Pre-B-ALL  F  4.6  PB  t(12;21)(p13;q22) Failed  
 256  Presen.  Pre-B-ALL  F  2.6 PB  t(1;19)(q23;p13) 46,XY[3]/47,XY,−1,+1p-,+1q-[1]  
 257  Remis. Pre-B-ALL  M  3.3  BM  t(1;19)(q23;p13) 46,XY[10]  
 262  Remis.  Pre-B-ALL  F  BM  t(6;11)(q27;q23)  46,XX[7]/46,XX,del(6)(q24)[3] 
 264  Presen.  Pre-B-ALL  M  13  BM t(6;11)(q27;q23)  Failed  
 265  Remis.  Pre-B-ALL F  6  BM  t(11;19)(q23;p13.1)  46,XX[10] 
 
B  
  93  Presen.  Pre-B-ALL  M  2.5  PB t(16;21)(p11;q22)  ND  
 106  Presen.  T-ALL  10  BM  dupMLL(11q23)  ND  
 112 Presen.  ALL  M  10  BM  dupMLL(11q23) ND  
 227  Presen.  ALL  F  14  PB t(11;19)(q23;p13.1)  ND  
 238  Presen.  Pre-B-ALL F  10  BM  t(12;21)(p13;q22)  ND  
 259 Remis.  Pre-B-ALL  F  5  BM  t(6;11)(q27;q23) ND  
 
C  
  95  Presen.  Pre-B-ALL  M  PB  NAD  46,XY[10]  
  96  Presen. Pre-B-ALL  F  3.9  PB  NAD  46,XX[4] 
  98  Relapse  ALL  M  14  PB  NAD 46,XY[4]  
 102  Presen.  T-ALL  M  5  PB NAD  46,XY[10]  
 110  Presen.  Pre-B-ALL  5  BM  NAD  46,XY[1]/46,XY,−9,+14,add(14q)[4] 
 230  Presen.  Pre-B-ALL  F  1.5  PB  NAD 46,XX[10]  
 235  Presen.  Pre-B-ALL  M  PB  NAD 46,XY[3]/44-45,XY,3p-,t(4;6)(p16;q?25),−7,−9[cp.3] 
 237  Presen.  T-ALL  F  6  BM  NAD 46,XX[4]/46,XX,del(6)(q26)[4]/46,XX,del(16)(q23)[2] 
 239  Presen.  Pre-B-ALL  M  2.5  PB  NAD 46,XY[4]  
 241  Presen.  Pre-B-ALL  M  4.3 BM  NAD  Failed  
 242  Presen.  Pre-B-ALL M  7  PB  NAD  Failed  
 244  Presen. Pre-B-ALL  F  4.3  PB  Ins. N/Q cells 46,XX[10]  
 245  Presen.  Pre-B-ALL  M  4.7 PB  Ins. N/Q cells  47,XY,+21[4]/48,XY,+21,+r[2] 
 248  Remis.  Pre-B-ALL  F  5  BM  Ins. N/Q cells  46,XX[1]  
 249  Presen.  Pro-B-ALL  5  PB  NAD  46,XY[9]  
 250  Presen. T-ALL  M  5  BM  NAD  Failed  
 251 Presen.  Pre-B-ALL  M  2.0  PB  NAD 46,XY[10]  
 252  Relapse  Pre-B-ALL  F  12 BM  Ins. N/Q cells  Failed  
 255  Presen. Pre-B-ALL  M  5  PB  NAD  Failed  
 258 Presen.  Pre-B-ALL  F  5  PB  NAD 46,XX[1]/47,XX,+21[3]  
 260  Presen.  Pre-B-ALL M  3.7  BM  Ins. N/Q cells  Failed  
 261 Presen.  Pre-B-ALL  M  4.3  BM  NAD  Failed 
 263  Presen.  Pre-B-ALL  F  6  BM  NAD 46,XX[6]  
 
D  
  88  Presen.  Pre-B-ALL F  4.8  PB  NAD  ND  
  92  Remis. Pre-B-ALL  M  7  BM  NAD  ND  
 100 Relapse  Pre-B-ALL  M  14  PB  NAD  ND 
 107  Presen.  Pre-B-ALL  F  6  PB  NAD ND  
 228  Presen.  Pre-B-ALL  M  3.3  PB NAD  ND  
 231  Presen.  Pre-B-ALL  F  PB  NAD  ND  
 232  Presen.  Pre-B-ALL  2.2  BM  NAD  ND  
 236  Presen.  Pre-B-ALL F  3.2  PB  NAD  ND  
 246  Relapse Pre-B-ALL  F  5  BM  NAD  ND  
 247 Presen.  Pre-B-ALL  M  1.7  PB  Ins. N/Q cells ND  
 320  Presen.  Pre-B-ALL  F  2.7  BM NAD  ND 
UPN  Status  Diagnose  Sex  Age (yr)  Sample Multiplex RT-PCR  Karyotype  
A  
  41  Relapse T-ALL  M  22  PB  t(9;22)(q34;q11) 46,XY[1]/46-47,XY,del(7)(q11q21),+8,der(11)t(11;14)(p14;q21),14, +21,del(21)(q21)[cp.8]  
  89  Presen.  Pre-B-ALL M  2.9  PB  dupMLL(11q23) 53,XY,+X,+4,+6,+8,+14,+17,+18,+21[co.5] 
  90 Relapse  Pre-B-ALL  M  9  PB t(9;22)(q34;q11)  46,XY[2]/46,XY,del(12)(p11.1p12.1)[3] 
  91  Presen.  Pre-B-ALL  M  3.3  BM t(9;22)(q34;q11)  46,XY[10]  
  94  Relapse Pre-B-ALL  M  3.0  PB  t(9;22)(q34;q11) 46,XY[4]/46,XY,t(9;22)(q34;q11)[6]  
  97  Remis. Pre-B-ALL  M  3.4  PB  dupMLL(11q23) 53-54,XY,+X,+Y,add(5p),+8,add(8p),+10,+14,+21[co.6] 
  99  Presen.  Pre-B-ALL  F  0.6  PB t(10;11)(p12;q23)  46,XX,add(21)(q?22)[1]  
 101 Presen.  Pre-B-ALL  M  3.9  PB dupMLL(11q23)  46,XY[10]  
 103  Relapse Pre-B-ALL  M  21  BM  dupMLL(11q23) 46-47,XY,del(1)(q25),del(8)(q?21.1q?22),del(10)(q24),+20,+21, [c.10]  
 108  Remis.  Pre-B-ALL  M  9  BM dupMLL(11q23)  46,XY[5]  
 109  Presen. Pre-B-ALL  M  2.7  PB  t(12;21)(p13;q22) Failed  
 111  Presen.  Pre-B-ALL  M  2.4 PB  dupMLL(11q23)  46,XY[5]  
 229 Presen.  Pre-B-ALL  F  9  BM  t(12;21)(p13;q22) 46,X,del(X)(q?25)[3]  
 234  Presen.  Pre-B-ALL M  5  PB  t(4;11)(q21;q23) 50-51,XY,+Y,+8,+21,+22[cp.3]  
  ?  
 243 Presen.  T-ALL  M  1.0  PB  t(11;19)(q23;p13.3) 46,XY,ins(1)(q21;?)[16]/46,XY,idem,t(14;?)(q11;?)[3]/48,XY, ins(1)(q21;?),+8,+8[3]  
 253  Presen.  Pre-B-ALL  3.4  PB  t(1;19)(q23;p13)  Failed  
 254 Presen.  Pre-B-ALL  F  4.6  PB  t(12;21)(p13;q22) Failed  
 256  Presen.  Pre-B-ALL  F  2.6 PB  t(1;19)(q23;p13) 46,XY[3]/47,XY,−1,+1p-,+1q-[1]  
 257  Remis. Pre-B-ALL  M  3.3  BM  t(1;19)(q23;p13) 46,XY[10]  
 262  Remis.  Pre-B-ALL  F  BM  t(6;11)(q27;q23)  46,XX[7]/46,XX,del(6)(q24)[3] 
 264  Presen.  Pre-B-ALL  M  13  BM t(6;11)(q27;q23)  Failed  
 265  Remis.  Pre-B-ALL F  6  BM  t(11;19)(q23;p13.1)  46,XX[10] 
 
B  
  93  Presen.  Pre-B-ALL  M  2.5  PB t(16;21)(p11;q22)  ND  
 106  Presen.  T-ALL  10  BM  dupMLL(11q23)  ND  
 112 Presen.  ALL  M  10  BM  dupMLL(11q23) ND  
 227  Presen.  ALL  F  14  PB t(11;19)(q23;p13.1)  ND  
 238  Presen.  Pre-B-ALL F  10  BM  t(12;21)(p13;q22)  ND  
 259 Remis.  Pre-B-ALL  F  5  BM  t(6;11)(q27;q23) ND  
 
C  
  95  Presen.  Pre-B-ALL  M  PB  NAD  46,XY[10]  
  96  Presen. Pre-B-ALL  F  3.9  PB  NAD  46,XX[4] 
  98  Relapse  ALL  M  14  PB  NAD 46,XY[4]  
 102  Presen.  T-ALL  M  5  PB NAD  46,XY[10]  
 110  Presen.  Pre-B-ALL  5  BM  NAD  46,XY[1]/46,XY,−9,+14,add(14q)[4] 
 230  Presen.  Pre-B-ALL  F  1.5  PB  NAD 46,XX[10]  
 235  Presen.  Pre-B-ALL  M  PB  NAD 46,XY[3]/44-45,XY,3p-,t(4;6)(p16;q?25),−7,−9[cp.3] 
 237  Presen.  T-ALL  F  6  BM  NAD 46,XX[4]/46,XX,del(6)(q26)[4]/46,XX,del(16)(q23)[2] 
 239  Presen.  Pre-B-ALL  M  2.5  PB  NAD 46,XY[4]  
 241  Presen.  Pre-B-ALL  M  4.3 BM  NAD  Failed  
 242  Presen.  Pre-B-ALL M  7  PB  NAD  Failed  
 244  Presen. Pre-B-ALL  F  4.3  PB  Ins. N/Q cells 46,XX[10]  
 245  Presen.  Pre-B-ALL  M  4.7 PB  Ins. N/Q cells  47,XY,+21[4]/48,XY,+21,+r[2] 
 248  Remis.  Pre-B-ALL  F  5  BM  Ins. N/Q cells  46,XX[1]  
 249  Presen.  Pro-B-ALL  5  PB  NAD  46,XY[9]  
 250  Presen. T-ALL  M  5  BM  NAD  Failed  
 251 Presen.  Pre-B-ALL  M  2.0  PB  NAD 46,XY[10]  
 252  Relapse  Pre-B-ALL  F  12 BM  Ins. N/Q cells  Failed  
 255  Presen. Pre-B-ALL  M  5  PB  NAD  Failed  
 258 Presen.  Pre-B-ALL  F  5  PB  NAD 46,XX[1]/47,XX,+21[3]  
 260  Presen.  Pre-B-ALL M  3.7  BM  Ins. N/Q cells  Failed  
 261 Presen.  Pre-B-ALL  M  4.3  BM  NAD  Failed 
 263  Presen.  Pre-B-ALL  F  6  BM  NAD 46,XX[6]  
 
D  
  88  Presen.  Pre-B-ALL F  4.8  PB  NAD  ND  
  92  Remis. Pre-B-ALL  M  7  BM  NAD  ND  
 100 Relapse  Pre-B-ALL  M  14  PB  NAD  ND 
 107  Presen.  Pre-B-ALL  F  6  PB  NAD ND  
 228  Presen.  Pre-B-ALL  M  3.3  PB NAD  ND  
 231  Presen.  Pre-B-ALL  F  PB  NAD  ND  
 232  Presen.  Pre-B-ALL  2.2  BM  NAD  ND  
 236  Presen.  Pre-B-ALL F  3.2  PB  NAD  ND  
 246  Relapse Pre-B-ALL  F  5  BM  NAD  ND  
 247 Presen.  Pre-B-ALL  M  1.7  PB  Ins. N/Q cells ND  
 320  Presen.  Pre-B-ALL  F  2.7  BM NAD  ND 

(A) PCR-positive patients with cytogenetic data; (B) PCR-positive patients with no cytogenetic data; (C) PCR-negative patients with cytogenetic data; (D) PCR-negative patients with no cytogenetic data. Cytogenetically t(9;22)(q34;q11)[10] at diagnosis. Abbreviations and notes are as in Table 4.

Table 6.

Summary of Aberrations in AML and ALL Patients Detected by Multiplex RT-PCR and Cytogenetic Analysis

Aberration  Multiplex PCR Cytogenetic  
AML  ALL  AML  ALL 
t(1;19)(q23;p13)  0/102  3/62  0/66  0/45 
t(2;5)(p23;q35)  1/102  0/62  0/66  0/45 
t(4;11)(q21;q23)  0/102  1/62  0/66  0/45 
t(6;9)(q23;q34)  2/102  0/62  1/66  0/45 
t(6;11)(q27;q23)  2/102  3/62  0/66  0/45 
t(8;21)(q22;q22)  8/102  0/62  2/66  0/45 
t(9;11)(q22;q23)  1/102  0/62  0/66  0/45 
t(9;22)(q34;q11)  3/102  4/62  0/66  1/45 
t(10;11)(p12;q23)  2/102  1/62  2/66  0/45 
dupMLL(11q23)  12/102  8/62  — —  
t(11;19)(q23;p13.1)  1/102  2/62  0/66 0/45  
t(11;19)(q23;p13.3)  0/102  1/62  0/66  0/45 
t(12;21)(p13;q22)  0/102  4/62  —  — 
t(15;17)(q21;q22)  7/102  0/62  2/66  0/45 
inv(16)(p13q22)  6/102  0/62  2/66  0/45 
t(16;21)(p11;q22)  0/102  1/62  0/66  0/45  
Patients with numerical aberrations  —  —  17/66 11/45  
Patients with chromosomal aberrations  45/102 28/62  29/66  17/45 
Aberration  Multiplex PCR Cytogenetic  
AML  ALL  AML  ALL 
t(1;19)(q23;p13)  0/102  3/62  0/66  0/45 
t(2;5)(p23;q35)  1/102  0/62  0/66  0/45 
t(4;11)(q21;q23)  0/102  1/62  0/66  0/45 
t(6;9)(q23;q34)  2/102  0/62  1/66  0/45 
t(6;11)(q27;q23)  2/102  3/62  0/66  0/45 
t(8;21)(q22;q22)  8/102  0/62  2/66  0/45 
t(9;11)(q22;q23)  1/102  0/62  0/66  0/45 
t(9;22)(q34;q11)  3/102  4/62  0/66  1/45 
t(10;11)(p12;q23)  2/102  1/62  2/66  0/45 
dupMLL(11q23)  12/102  8/62  — —  
t(11;19)(q23;p13.1)  1/102  2/62  0/66 0/45  
t(11;19)(q23;p13.3)  0/102  1/62  0/66  0/45 
t(12;21)(p13;q22)  0/102  4/62  —  — 
t(15;17)(q21;q22)  7/102  0/62  2/66  0/45 
inv(16)(p13q22)  6/102  0/62  2/66  0/45 
t(16;21)(p11;q22)  0/102  1/62  0/66  0/45  
Patients with numerical aberrations  —  —  17/66 11/45  
Patients with chromosomal aberrations  45/102 28/62  29/66  17/45 
Fig. 2.

Examples on chromosomal aberrations found by the multiplex RT-PCR. The loading order and DNA molecular weight marker are as in Fig 1. The band specific for the translocation is indicated by an arrowhead beside the band. The dots indicate activation of HOX11 (lane 4) or EVI1 (lane 7). Because HOX11 and EVI1 represent activation of native gene products and not of chimerical products, these are not further discussed in this presentation. *Patient no. 335 was a chronic myeloid leukemia case not included in this study.

Fig. 2.

Examples on chromosomal aberrations found by the multiplex RT-PCR. The loading order and DNA molecular weight marker are as in Fig 1. The band specific for the translocation is indicated by an arrowhead beside the band. The dots indicate activation of HOX11 (lane 4) or EVI1 (lane 7). Because HOX11 and EVI1 represent activation of native gene products and not of chimerical products, these are not further discussed in this presentation. *Patient no. 335 was a chronic myeloid leukemia case not included in this study.

In this material, we did not identify patients positive for the following translocations: TAL1D, t(X;11)(q13;q23), t(1;11)(q21;q23), t(1;11)(p32;q23), t(3;5)(q25.1;q34), t(3;21)(q26;q22), t(5;12)(q33;p13), t(5;17)(q35;q22), ?t(9;9), t(9;12)(q34;p13), t(11;17)(q23;q21), and t(17;19)(q22;p13). These translocations should be detected by the PCR primers used and their absence in our material can be ascribed to the low frequency of these chromosomal aberrations. Thus, the t(X;11)(q13;q23), t(5;17)(q35;q22), ?t(9;9), and t(9;12)(q34;p13) have, to our knowledge, been described only in single cases, and only a few cases of the t(1;11)(p32;q23), t(1;11)(q21;q23), t(3;5)(q25.1;q34), t(5;12)(q33;p13), t(11;17)(q23;q21), and t(17;19)(q22;p13) have been reported. The t(3;21) has been described primarily in therapy-related AML, and only recently in 1 de novo AML patient.31 TheTAL1D, with the fusion gene SIL/TAL1, has been found in 25% of T-ALL cases.32 Because only 6 T-ALL patients were included in this study, the absence of patients with theSIL/TAL1 fusion-gene may be ascribed to statistical variation. However, we cannot exclude that one or more of the PCR primers for these translocations may be incompatible with the multiplex PCR conditions, with the exception of the t(17;19)(q22;p13) andTAL1D, for which we have positive controls. This issue awaits the availability of positive patients, cell lines, or in vitro synthesized control RNA.

Comparison between the multiplex PCR and the cytogenetic analysis.

Cytogenetic data were available for 66 AML cases. In 62 of the cases, metaphase cells were obtained, but cytogenetic aberrations were detected in only 28 cases. The corresponding numbers for ALL were in total 45 cases, 34 with available metaphase cells and 17 with chromosomal aberrations. When the cytogenetic analysis showed one of the translocations included in the multiplex PCR, the corresponding fusion gene mRNA was detected, except in 1 case in which the multiplex PCR could not be performed because of insufficient RNA. The chromosomal rearrangements dupMLL, TALD, t(12;21)(p13;q22), and t(6;11)(q27;q23) cannot be detected (or are easily overlooked) by classical cytogenetic analysis. In the multiplex PCR analysis, 14 of 102 AML and 15 of 62 ALL cases were positive for this group of aberrations. A new finding in this work is the high frequency of dupMLL in ALL. Thus, in 6 AML and in 2 ALL cases with an adequate cytogenetic analysis (10 or more metaphases obtained at presentation), a fusion gene was detected by PCR that was not detected by the cytogenetic analysis. Masked translocations, which are not apparent in cytogenetic analysis but detectable by Southern blotting or RT-PCR, have previously been observed.33,34 In contrast, numerical aberrations, which cannot be detected by PCR, were found by cytogenetic analysis in 17 of 66 of the AML and in 11 of 45 of the ALL cases. The combined results from multiplex PCR and cytogenetic analysis are presented in Table 6. Taken together, the two methods uncovered chromosomal aberrations in 42 of 66 of the AML and in 27 of 45 of the ALL cases and supplemented each other in detecting chromosomal aberrations.

DISCUSSION

During the last decade, the multidisciplinary diagnosis of acute leukemia has been expanded by the description of an ever-increasing number of balanced translocations that are amenable to detection by classical karyotype analysis and by PCR analysis when sequence information is available for the designing of PCR primers.

Multiplex PCR has been used previously for characterization of individual or small groups of translocations found in leukemic cells.22,23 We have scaled up this method of analysis to cover most of the published translocations and describe here our experience with a multiplex PCR procedure on cryopreserved material from more than 160 patients diagnosed and treated at Aarhus University Hospital. We emphasize that the material is not necessarily representative as an unselected material, because cryopreservation of cells in the Biobase at the Laboratory of Immunohematology, Aarhus University Hospital, was performed only if the sample contained at least 5 million cells after immunophenotyping. Consequently, patients with scarce cell material at diagnosis were not included. Moreover, in 8 of 102 of the AML and 6 of 62 of the ALL cases, too small amounts of RNA to warrant PCR analysis were obtained from cryopreserved cells because of cell lysis. In fresh material, the fraction of patients with insufficient RNA should therefore, in theory, be lower, a supposition that is substantiated by our recent results from applying the method prospectively (Hoklandet al, unpublished data). Our cell material was cryopreserved over a period of 14 years; therefore, we caution against a close comparison between cytogenetics and PCR results. Banding techniques have improved considerably over the years, and the percentage of translocation positive cases has, in our hands, increased over time. Also, cytogenetic analysis on patients dating back to the 1980s was performed on only 10 metaphase cells per sample.

Given these limitations, we believe that the data presented here clearly prove the usefulness of the multiplex PCR concept. First, the assay can be performed (including the split-out phase) within 2 to 3 days and is amenable to the analysis of up to 10 samples simultaneously by 1 person. Second, the reaction clearly increases the number of translocation-positive patients relative to cytogenetic analysis, especially in cases of material with sufficient numbers of high-quality metaphase cells. This is exemplified by the demonstration of 22 of 66 AML and 21 of 45 ALL patients in whom additional chromosomal rearrangements were found by the multiplex PCR. Importantly, these translocations were not restricted to submicroscopical chromosomal aberrations, which are difficult, if not impossible, to detect by cytogenetic analysis. Rather, we found a wide range of translocations, including both those that are frequent [eg, t(8;21) and t(15;17)] and those that are infrequent [eg, t(11;19)]. Of equal importance, the additional translocations were found in both AML and ALL patients.

The multiplex PCR detects the expression, on the RNA level, of fusion genes generated by chromosomal rearrangements. It does not detect rearrangements in which native oncogenes are deregulated, as described in, eg, t(8;14), t(11;14), and t(1;14). Such rearrangements may be detected by PCR on DNA level. Similarly, Ig and T-cell receptor gene rearrangements35 cannot be detected by the proposed multiplex system. Although not generally considered to be of independent prognostic significance, these aberrations can be very important in the detection of minimal residual disease. Finally, the relative contribution of this reaction and fluorescent in situ hybridization (FISH) techniques36 cannot presently be directly evaluated, but (as with karyotypic analysis) we would expect these methodologies to be complementary.

For at least two reasons, the PCR methodology cannot fully replace karyotypic analysis. First, numerical aberrations and abnormalities other than balanced translocations cannot be detected. Second, unknown balanced translocations are obviously not detected. Cytogenetic analysis will thus form an important platform for molecular characterization of new genetic aberrations.

Because of its versatility and sensitivity, we believe that this novel multiplex PCR procedure holds promises as a screening tool for the initial diagnostic phase of acute leukemia. In addition, moving the PCR methodology up-front will allow its use for remission evaluation, when bone marrow material is often scarce. Here, the very high sensitivity of the PCR reaction may yield information in cases in which the translocation found at diagnosis would also be detected at remission. Our retrospective data (patients no. 70, 90, 108, 259, and 265) and the preliminary clinical experience clearly support the notion given above, because we have positive multiplex reaction in several marrow preparations at remission for the corresponding translocation identified originally by cytogenetic analysis at diagnosis.

It might be argued that the multiplex concept is weakened by the decrease in sensitivity relative to single PCR reactions, particularly when the multiplex reaction is used for detection of minimal residual diseases (eg, in Ph+ patients). In acute leukemia at diagnosis, the cell source used for RNA preparations is usually greater than 90% leukemic blasts. However, as demonstrated in this report, the sensitivity of our reactions is comparable to single-pair reactions probably because of the use of two (nested) primer sets. Moreover, the split-out primer sets will have a sensitivity comparable to the individual multiplex reactions.

We believe that the multiplex PCR assay is clinically useful as an efficient and fast procedure for the detection of genetic changes in acute leukemia and that it complements the cytogenetic analysis in a fruitful manner. Clearly, this novel approach for addressing the multitude of genetic changes in acute leukemia is open for addition of new primer sets as information of novel translocations accumulates. However, in our hands, this reaction has already yielded new information in the retrospective setting as well as in the initial diagnosis. Finally, our approach can be extended to the detection of minimal residual leukemia, because the split-out reaction has a sensitivity equivalent to that of single PCR assays. Thus, the multiplex approach would be of significance not only at diagnosis, but also for subsequent clinical decision-making.

ACKNOWLEDGMENT

The authors thank Dr Niels Clausen (Aarhus University Hospital) for supplying the pediatric ALL samples and Dr Kazuma Ohyashiki (Tokyo Medical Collage) for the HAL-01 cell line. We are indebted to Dr K. Paludan for critical reading of the manuscript.

Supported by Research Grants from the Danish Cancer Society and the Karen Elise Jensen Foundation.

Address reprint requests to Poul Jørgensen, PhD, Institute of Molecular and Structural Biology, Aarhus University, C.F. Møllers Allé Bld. 130, DK-8000 Aarhus C, Denmark; e-mail:pj@mbio.aau.dk.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.

© 1998 by the American Society of Hematology.

REFERENCES

REFERENCES
1
Mrozek
K
Heinonen
K
de la Chapelle
A
Bloomfield
CD
Clinical significance of cytogenetics in acute myeloid leukemia.
Semin Oncol
24
1997
17
2
Look
AT
Oncogenic transcription factors in the human acute leukemias.
Science
278
1997
1059
3
Leder
P
Battey
J
Lenoir
G
Moulding
C
Murphy
W
Potter
H
Stewart
T
Taub
R
Translocations among antibody genes in human cancer.
Science
222
1983
765
4
Finger
LR
Harvey
RC
Moore
RC
Showe
LC
Croce
CM
A common mechanism of chromosomal translocation in T- and B-cell neoplasia.
Science
234
1986
982
5
Miyoshi
H
Kozu
T
Shimizu
K
Enomoto
K
Maseki
N
Kaneko
Y
Kamada
N
Ohki
M
The t(8;21) translocation in acute myeloid leukemia results in production of an AML1-MTG8 fusion transcript.
EMBO J
12
1993
2715
6
Meyers
S
Lenny
N
Hiebert
SW
The t(8;21) fusion protein interferes with AML-1B-dependent transcriptional activation.
Mol Cell Biol
15
1995
1974
7
Parry
P
Wei
Y
Evans
G
Cloning and characterization of the t(X;11) breakpoint from a leukemic cell line identify a new member of the forkhead gene family.
Genes Chromosom Cancer
11
1994
79
8
Prasad
R
Gu
Y
Alder
H
Nakamura
T
Canaani
O
Saito
H
Huebner
K
Gale
RP
Nowell
PC
Kuriyama
K
Miyazaki
Y
Croce
CM
Canaani
E
Cloning of the ALL-1 fusion partner, the AF-6 gene, involved in acute myeloid leukemias with the t(6;11) chromosome translocation.
Cancer Res
53
1993
5624
9
Thirman
MJ
Levitan
DA
Kobayashi
H
Simon
MC
Rowley
JD
Cloning of ELL, a gene that fuses to MLL in a t(11;19)(q23; p13.1) in acute myeloid leukemia.
Proc Natl Acad Sci USA
91
1994
12110
10
Bernard
OA
Mauchauffe
M
Mecucci
C
Van den Berghe
H
Berger
R
A novel gene, AF-1p, fused to HRX in t(1;11)(p32;q23), is not related to AF-4, AF-9 nor ENL.
Oncogene
9
1994
1039
11
Prasad
R
Leshkowitz
D
Gu
Y
Alder
H
Nakamura
T
Saito
H
Huebner
K
Berger
R
Croce
CM
Canaani
E
Leucine-zipper dimerization motif encoded by the AF17 gene fused to ALL-1 (MLL) in acute leukemia.
Proc Natl Acad Sci USA
91
1994
8107
12
Chaplin
T
Ayton
P
Bernard
OA
Saha
V
Della Valle
V
Hillion
J
Gregorini
A
Lillington
D
Berger
R
Young
BD
A novel class of zinc finger/leucine zipper genes identified from the molecular cloning of the t(10;11) translocation in acute leukemia.
Blood
85
1995
1435
13
Tse
W
Zhu
W
Chen
HS
Cohen
A
A novel gene, AF1q, fused to MLL in t(1;11) (q21;q23), is specifically expressed in leukemic and immature hematopoietic cells.
Blood
85
1995
650
14
Yamamoto
K
Seto
M
Iida
S
Komatsu
H
Kamada
N
Kojima
S
Kodera
Y
Nakazawa
S
Saito
H
Takahashi
T
Ueda
R
A reverse transcriptase-polymerase chain reaction detects heterogeneous chimeric mRNAs in leukemias with 11q23 abnormalities.
Blood
83
1994
2912
15
Schichman
SA
Caligiuri
MA
Gu
Y
Strout
MP
Canaani
E
Bloomfield
CD
Croce
CM
ALL-1 partial duplication in acute leukemia.
Proc Natl Acad Sci USA
91
1994
6236
16
Biondi
A
Rambaldi
A
Rossi
V
Elia
L
Caslini
C
Basso
G
Battista
R
Barbui
T
Mandelli
F
Masera
G
Croce
C
Canaani
E
Cimino
G
Detection of ALL-1/AF4 fusion transcript by reverse transcription-polymerase chain reaction for diagnosis and monitoring of acute leukemias with the t(4;11) translocation.
Blood
82
1993
2943
17
Corral
J
Forster
A
Thompson
S
Lampert
F
Kaneko
Y
Slater
R
Kroes
WG
van der Schoot
CE
Ludwig
WD
Karpas
A
Pocock
C
Cotter
F
Rabbitts
TH
Acute leukemias of different lineages have similar MLL gene fusions encoding related chimeric proteins resulting from chromosomal translocation.
Proc Natl Acad Sci USA
90
1993
8538
18
Cimino
G
Rapanotti
MC
Biondi
A
Elia
L
Lo Coco
F
Price
C
Rossi
V
Rivolta
A
Canaani
E
Croce
CM
Mandelli
F
Greaves
M
Infant acute leukemias show the same biased distribution of ALL1 gene breaks as topoisomerase II related secondary acute leukemias.
Cancer Res
57
1997
2879
19
Nakamura
T
Alder
H
Gu
Y
Prasad
R
Canaani
O
Kamada
N
Gale
RP
Lange
B
Crist
WM
Nowell
PC
Croce
CM
Canaani
E
Genes on chromosomes 4, 9, and 19 involved in 11q23 abnormalities in acute leukemia share sequence homology and/or common motifs.
Proc Natl Acad Sci USA
90
1993
4631
20
Poirel
H
Rack
K
Delabesse
E
Radford Weiss
I
Troussard
X
Debert
C
Leboeuf
D
Bastard
C
Picard
F
Veil Buzyn
A
Flandrin
G
Bernard
O
Macintyre
E
Incidence and characterization of MLL gene (11q23) rearrangements in acute myeloid leukemia M1 and M5.
Blood
87
1996
2496
21
Caligiuri
MA
Strout
MP
Schichman
SA
Mrozek
K
Arthur
DC
Herzig
GP
Baer
MR
Schiffer
CA
Heinonen
K
Knuutila
S
Nousiainen
T
Ruutu
T
Block
AW
Schulman
P
Pedersen Bjergaard
J
Croce
CM
Bloomfield
CD
Partial tandem duplication of ALL1 as a recurrent molecular defect in acute myeloid leukemia with trisomy 11.
Cancer Res
56
1996
1418
22
Repp
R
Borkhardt
A
Haupt
E
Kreuder
J
Brettreich
S
Hammermann
J
Nishida
K
Harbott
J
Lampert
F
Detection of four different 11q23 chromosomal abnormalities by multiplex-PCR and fluorescence-based automatic DNA-fragment analysis.
Leukemia
9
1995
210
23
Cross
NC
Melo
JV
Feng
L
Goldman
JM
An optimized multiplex polymerase chain reaction (PCR) for detection of BCR-ABL fusion mRNAs in haematological disorders.
Leukemia
8
1994
186
24
Drexler
HG
MacLeod
RA
Borkhardt
A
Janssen
JW
Recurrent chromosomal translocations and fusion genes in leukemia-lymphoma cell lines.
Leukemia
9
1995
480
25
Yunis
JJ
New chromosome techniques in the study of human neoplasia.
Hum Pathol
12
1981
540
26
Pedersen
B
Kerndrup
G
Specific minor chromosome deletions consistently occurring in myelodysplastic syndromes.
Cancer Genet Cytogenet
23
1986
61
27
Chomczynski
P
Sacchi
N
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162
1987
156
28
Kamps
MP
Murre
C
Sun
XH
Baltimore
D
A new homeobox gene contributes the DNA binding domain of the t(1;19) translocation protein in pre-B ALL.
Cell
60
1990
547
29
Watada
H
Kajimoto
Y
Umayahara
Y
Matsuoka
T
Morishima
T
Yamasaki
Y
Kawamori
R
Kamada
T
Ubiquitous, but variable, expression of two alternatively spliced mRNAs encoding mouse homologues of transcription factors E47 and E12.
Gene
153
1995
255
30
Hjorth-Sorensen
B
Pallisgaard
N
Gronholm
M
Hokland
P
Clausen
N
Jorgensen
P
A novel MLL-AF10 fusion gene detected in an acute myeloid leukemia patient using a newly developed asymmetric reverse transcription PCR method.
Leukemia
11
1997
1588
31
Johansson
B
Fioretos
T
Garwicz
S
Heim
S
Mitelman
F
t(3;21)(q26;q22) with AML1 rearrangement in a de novo childhood acute monoblastic leukaemia.
Br J Haematol
92
1996
429
32
Bash
RO
Crist
WM
Shuster
JJ
Link
MP
Amylon
M
Pullen
J
Carroll
AJ
Buchanan
GR
Smith
RG
Baer
R
Clinical features and outcome of T-cell acute lymphoblastic leukemia in childhood with respect to alterations at the TAL1 locus: A Pediatric Oncology Group study.
Blood
81
1993
2110
33
Maseki
N
Miyoshi
H
Shimizu
K
Homma
C
Ohki
M
Sakurai
M
Kaneko
Y
The 8;21 chromosome translocation in acute myeloid leukemia is always detectable by molecular analysis using AML1.
Blood
81
1993
1573
34
Wells
SJ
Phillips
CN
Winton
EF
Farhi
DC
Reverse transcriptase-polymerase chain reaction for bcr/abl fusion in chronic myelogenous leukemia.
Am J Clin Pathol
105
1996
756
35
(suppl 1)
van Dongen
JJ
Breit
TM
Adriaansen
HJ
Beishuizen
A
Hooijkaas
H
Detection of minimal residual disease in acute leukemia by immunological marker analysis and polymerase chain reaction.
Leukemia
6
1992
47
36
Bentz
M
Dohner
H
Cabot
G
Lichter
P
Fluorescence in situ hybridization in leukemias: ‘The FISH are spawning!’.
Leukemia
8
1994
1447
37
Aplan
PD
Lombardi
DP
Ginsberg
AM
Cossman
J
Bertness
VL
Kirsch
IR
Disruption of the human SCL locus by “illegitimate” V-(D)-J recombinase activity.
Science
250
1990
1426
38
Nourse
J
Mellentin
JD
Galili
N
Wilkinson
J
Stanbridge
E
Smith
SD
Cleary
ML
Chromosomal translocation t(1;19) results in synthesis of a homeobox fusion mRNA that codes for a potential chimeric transcription factor.
Cell
60
1990
535
39
Izraeli
S
Kovar
H
Gadner
H
Lion
T
Unexpected heterogeneity in E2A/PBX1 fusion messenger RNA detected by the polymerase chain reaction in pediatric patients with acute lymphoblastic leukemia.
Blood
80
1992
1413
40
(erratum 267:316, 1995)
Morris
SW
Kirstein
MN
Valentine
MB
Dittmer
KG
Shapiro
DN
Saltman
DL
Look
AT
Fusion of a kinase gene, ALK, to a nucleolar protein gene, NPM, in non-Hodgkin's lymphoma.
Science
263
1994
1281
41
Weisenburger
DD
Gordon
BG
Vose
JM
Bast
MA
Chan
WC
Greiner
TC
Anderson
JR
Sanger
WG
Occurrence of the t(2;5)(p23;q35) in non-Hodgkin's lymphoma.
Blood
87
1996
3860
42
Yoneda Kato
N
Look
AT
Kirstein
MN
Valentine
MB
Raimondi
SC
Cohen
KJ
Carroll
AJ
Morris
SW
The t(3;5)(q25.1;q34) of myelodysplastic syndrome and acute myeloid leukemia produces a novel fusion gene, NPM-MLF1.
Oncogene
12
1996
265
43
Mitani
K
Ogawa
S
Tanaka
T
Miyoshi
H
Kurokawa
M
Mano
H
Yazaki
Y
Ohki
M
Hirai
H
Generation of the AML1-EVI-1 fusion gene in the t(3;21)(q26;q22) causes blastic crisis in chronic myelocytic leukemia.
EMBO J
13
1994
504
44
Nucifora
G
Begy
CR
Kobayashi
H
Roulston
D
Claxton
D
Pedersen Bjergaard
J
Parganas
E
Ihle
JN
Rowley
JD
Consistent intergenic splicing and production of multiple transcripts between AML1 at 21q22 and unrelated genes at 3q26 in (3;21)(q26;q22) translocations.
Proc Natl Acad Sci USA
91
1994
4004
45
Nucifora
G
Rowley
JD
AML1 and the 8;21 and 3;21 translocations in acute and chronic myeloid leukemia.
Blood
86
1995
1
46
Downing
JR
Head
DR
Raimondi
SC
Carroll
AJ
Curcio Brint
AM
Motroni
TA
Hulshof
MG
Pullen
DJ
Domer
PH
The der(11)-encoded MLL/AF-4 fusion transcript is consistently detected in t(4;11)(q21;q23)-containing acute lymphoblastic leukemia.
Blood
83
1994
330
47
Golub
TR
Barker
GF
Lovett
M
Gilliland
DG
Fusion of PDGF receptor beta to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation.
Cell
77
1994
307
48
Redner
RL
Rush
EA
Faas
S
Rudert
WA
Corey
SJ
The t(5;17) variant of acute promyelocytic leukemia expresses a nucleophosmin-retinoic acid receptor fusion.
Blood
87
1996
882
49
von Lindern
M
Fornerod
M
van Baal
S
Jaegle
M
de Wit
T
Buijs
A
Grosveld
G
The translocation (6;9), associated with a specific subtype of acute myeloid leukemia, results in the fusion of two genes, dek and can, and the expression of a chimeric, leukemia-specific dek-can mRNA.
Mol Cell Biol
12
1992
1687
50
Kennedy
MA
Gonzalez Sarmiento
R
Kees
UR
Lampert
F
Dear
N
Boehm
T
Rabbitts
TH
HOX11, a homeobox-containing T-cell oncogene on human chromosome 10q24.
Proc Natl Acad Sci USA
88
1991
8900
51
Hatano
M
Roberts
CW
Minden
M
Crist
WM
Korsmeyer
SJ
Deregulation of a homeobox gene, HOX11, by the t(10;14) in T cell leukemia.
Science
253
1991
79
52
Downing
JR
Head
DR
Curcio Brint
AM
Hulshof
MG
Motroni
TA
Raimondi
SC
Carroll
AJ
Drabkin
HA
Willman
C
Theil
KS
Civin
CI
Erickson
P
An AML1/ETO fusion transcript is consistently detected by RNA-based polymerase chain reaction in acute myelogenous leukemia containing the (8;21)(q22;q22) translocation.
Blood
81
1993
2860
53
von Lindern
M
van Baal
S
Wiegant
J
Raap
A
Hagemeijer
A
Grosveld
G
Can, a putative oncogene associated with myeloid leukemogenesis, may be activated by fusion of its 3′ half to different genes: Characterization of the set gene.
Mol Cell Biol
12
1992
3346
54
Papadopoulos
P
Ridge
SA
Boucher
CA
Stocking
C
Wiedemann
LM
The novel activation of ABL by fusion to an ets-related gene, TEL.
Cancer Res
55
1995
34
55
Hermans
A
Heisterkamp
N
von Linden
M
van Baal
S
Meijer
D
van der Plas
D
Wiedemann
LM
Groffen
J
Bootsma
D
Grosveld
G
Unique fusion of bcr and c-abl genes in Philadelphia chromosome positive acute lymphoblastic leukemia.
Cell
51
1987
33
56
Chaplin
T
Ayton
P
Bernard
OA
Saha
V
Della Valle
V
Hillion
J
Gregorini
A
Lillington
D
Berger
R
Young
BD
A novel class of zinc finger/leucine zipper genes identified from the molecular cloning of the t(10;11) translocation in acute leukemia.
Blood
85
1995
1435
57
Chaplin
T
Bernard
O
Beverloo
HB
Saha
V
Hagemeijer
A
Berger
R
Young
BD
The t(10;11) translocation in acute myeloid leukemia (M5) consistently fuses the leucine zipper motif of AF10 onto the HRX gene.
Blood
86
1995
2073
58
Chen
Z
Brand
NJ
Chen
A
Chen
SJ
Tong
JH
Wang
ZY
Waxman
S
Zelent
A
Fusion between a novel Kruppel-like zinc finger gene and the retinoic acid receptor-alpha locus due to a variant t(11;17) translocation associated with acute promyelocytic leukaemia.
EMBO J
12
1993
1161
59
Licht
JD
Chomienne
C
Goy
A
Chen
A
Scott
AA
Head
DR
Michaux
JL
Wu
Y
DeBlasio
A
Miller WH Jr
Zelenetz
AD
Willman
CL
Chen
Z
Chen
SJ
Zelent
A
Macintyre
E
Veil
A
Cortes
J
Kantarjian
H
Waxman
S
Clinical and molecular characterization of a rare syndrome of acute promyelocytic leukemia associated with translocation (11;17).
Blood
85
1995
1083
60
Mitani
K
Kanda
Y
Ogawa
S
Tanaka
T
Inazawa
J
Yazaki
Y
Hirai
H
Cloning of several species of MLL/MEN chimeric cDNAs in myeloid leukemia with t(11;19)(q23;p13.1) translocation.
Blood
85
1995
2017
61
Rubnitz
JE
Behm
FG
Curcio Brint
AM
Pinheiro
RP
Carroll
AJ
Raimondi
SC
Shurtleff
SA
Downing
JR
Molecular analysis of t(11;19) breakpoints in childhood acute leukemias.
Blood
87
1996
4804
62
Romana
SP
Poirel
H
Leconiat
M
Flexor
MA
Mauchauffe
M
Jonveaux
P
Macintyre
EA
Berger
R
Bernard
OA
High frequency of t(12;21) in childhood B-lineage acute lymphoblastic leukemia.
Blood
86
1995
4263
63
Romana
SP
Mauchauffe
M
Le Coniat
M
Chumakov
I
Le Paslier
D
Berger
R
Bernard
OA
The t(12;21) of acute lymphoblastic leukemia results in a tel-AML1 gene fusion.
Blood
85
1995
3662
64
Golub
TR
Barker
GF
Bohlander
SK
Hiebert
SW
Ward
DC
Bray Ward
P
Morgan
E
Raimondi
SC
Rowley
JD
Gilliland
DG
Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia.
Proc Natl Acad Sci USA
92
1995
4917
65
de The
H
Lavau
C
Marchio
A
Chomienne
C
Degos
L
Dejean
A
The PML-RAR alpha fusion mRNA generated by the t(15;17) translocation in acute promyelocytic leukemia encodes a functionally altered RAR.
Cell
66
1991
675
66
Pandolfi
PP
Alcalay
M
Fagioli
M
Zangrilli
D
Mencarelli
A
Diverio
D
Biondi
A
Lo Coco
F
Rambaldi
A
Grignani
F
Rochette-Egly
C
Gaube
M
Chambon
P
Pelicci
P
Genomic variability and alternative splicing generate multiple PML/RAR alpha transcripts that encode aberrant PML proteins and PML/RAR alpha isoforms in acute promyelocytic leukaemia.
EMBO J
11
1992
1397
67
Hiorns
LR
Min
T
Swansbury
GJ
Zelent
A
Dyer
MJ
Catovsky
D
Interstitial insertion of retinoic acid receptor-alpha gene in acute promyelocytic leukemia with normal chromosomes 15 and 17.
Blood
83
1994
2946
68
Liu
PP
Hajra
A
Wijmenga
C
Collins
FS
Molecular pathogenesis of the chromosome 16 inversion in the M4Eo subtype of acute myeloid leukemia.
Blood
85
1995
2289
69
Ichikawa
H
Shimizu
K
Hayashi
Y
Ohki
M
An RNA-binding protein gene, TLS/FUS, is fused to ERG in human myeloid leukemia with t(16;21) chromosomal translocation.
Cancer Res
54
1994
2865
70
Hunger
SP
Ohyashiki
K
Toyama
K
Cleary
ML
Hlf, a novel hepatic bZIP protein, shows altered DNA-binding properties following fusion to E2A in t(17;19) acute lymphoblastic leukemia.
Genes Dev
6
1992
1608
71
Inaba
T
Roberts
WM
Shapiro
LH
Jolly
KW
Raimondi
SC
Smith
SD
Look
AT
Fusion of the leucine zipper gene HLF to the E2A gene in human acute B-lineage leukemia.
Science
257
1992
531
72
Hunger
SP
Devaraj
PE
Foroni
L
Secker Walker
LM
Cleary
ML
Two types of genomic rearrangements create alternative E2A-HLF fusion proteins in t(17;19)-ALL.
Blood
83
1994
2970
73
Liu
P
Tarle
SA
Hajra
A
Claxton
DF
Marlton
P
Freedman
M
Siciliano
MJ
Collins
FS
Fusion between transcription factor CBF beta/PEBP2 beta and a myosin heavy chain in acute myeloid leukemia.
Science
261
1993
1041
74
Kozu
T
Miyoshi
H
Shimizu
K
Maseki
N
Kaneko
Y
Asou
H
Kamada
N
Ohki
M
Junctions of the AML1/MTG8(ETO) fusion are constant in t(8;21) acute myeloid leukemia detected by reverse transcription polymerase chain reaction.
Blood
82
1993
1270