Abstract

The helix-loop-helix transcription factor, scl, plays an essential role in hematopoietic development. Embryos in which the gene has been disrupted fail to develop yolk sac erythropoiesis, and scl-null embryonic stem cells do not contribute to hematopoiesis in chimeric mice. To analyze the molecular consequences of scl deficiency, we compared the gene expression profiles of control (wild-type and scl-heterozygous) and scl-null embryonic stem cells differentiated in vitro for up to 12 days. In control and scl-null embryoid bodies the temporal expression pattern of genes associated with the formation of ventral mesoderm, such as Brachyury, bone morphogenetic protein-4, and flk-1, was identical. Similarly, GATA-2, CD34, and c-kit, which are coexpressed in endothelial and hematopoietic lineages, were expressed normally in scl-null embryonic stem cell lines. However, hematopoietic-restricted genes, including the transcription factors GATA-1, EKLF, and PU.1 as well as globin genes and myeloperoxidase, were only expressed in wild-type and scl-heterozygous embryonic stem cells. Indirect immunofluorescence was used to confirm the observations that GATA-1 and globins were only present in control embryoid bodies but that CD34 was found on both control and scl-null embryoid bodies. These data extend the previous gene ablation studies and support a model whereby scl is absolutely required for commitment of a putative hemangioblast to the hematopoietic lineage but that it is dispensable for endothelial differentiation.

DURING MURINE EMBRYOGENESIS, ventral mesoderm migrates into the yolk sac at embryonic day 7.5 (E7.5) and forms aggregates of cells (hemangioblasts) that may represent the putative common precursor for endothelial and hematopoietic cells.1,2 These progenitor cells give rise to blood islands, which consist of an outer layer of endothelium enclosing primitive hematopoietic cells. Insights into the molecular mechanisms important in primitive hematopoiesis have been made through the analysis of gene ablation in the mouse and in vitro studies in Xenopus laevis.

Bone morphogenetic protein-4 (BMP-4), a member of the transforming growth factor (TGF ) β family, which induces ventral mesoderm,3 has been identified as a key component in this cascade. A dominant negative BMP-4 receptor dorsalizes Xenopus embryos that are then deficient in blood formation.4-8 The relevance of this signaling pathway to mammalian hematopoiesis is supported by a recent study by Johansson and Wiles,9 which showed that exogenous BMP-4 was required for mesoderm and globin gene induction in embryoid bodies (EBs) and was a prerequisite for BMP-4 expression from its endogenous locus.

Vertebrate homologues of the Drosophila mothers against decapentaplegic (mad ) gene (Smad1-5) function as homo- and hetero-dimeric signal transduction molecules downstream of TGFβ family receptors.10,11 It has been shown that BMP-4 uses Smad1 or 5 in a heterodimeric complex with Smad4 and that Smad1 can compensate for a dominant negative BMP receptor.12,13 Similar complementation studies have identified a number of homeobox genes including Mix.1,14PV.1,15  Xvent-1,16 Xvent-2/Vox/Xbr-1,17-19 and Xom20 as ventralizing genes downstream of BMP-4. Recently, the identification of a transcriptional partner for Smad2 in Xenopus, a novel winged-helix transcription factor denoted FAST-1 that cooperates to transactivate the Mix.2 gene in response to activin, has provided a definite link between TGFβ signaling and these homeodomain proteins in vertebrates.21 The large number of genes identified thus far reflects the complexity of the process and detailed analysis in the mouse awaits the cloning of their murine homologues.

Gene ablation studies in the mouse have also been instrumental in defining molecules critical for the initiation of hematopoiesis, such as BMP-4, flk-1, scl, and LMO2. Surprisingly, embryos mutant for BMP-4 or its type I receptor display a more severe phenotype than anticipated. Not only do they lack ventral mesoderm and hematopoietic cells, but they die early in development after a failure of epiblast proliferation, a necessary prerequisite for gastrulation.22,23 Ablation of the tyrosine kinase receptor flk-1, expressed on yolk sac hemangioblasts and endothelial cells,24 also results in early embryonic lethality, in this case associated with complete absence of yolk sac blood islands.2 

Recent work has shown that the helix-loop-helix transcription factor, scl, the oncogene most frequently activated in childhood T-cell leukemia,25 plays an essential role in hematopoietic development. scl localizes to embryonic and yolk sac mesoderm in E7.5 embryos before the formation of recognizable hematopoietic elements and expression subsequently continues in both endothelial and hematopoietic components of the blood island as well as in several nonhematopoietic sites.26,27 In the adult animal, scl expression is largely restricted to erythroid cells, megakaryocytes, mast cells, early myeloid cells, and committed progenitor cells.28 Embryos in which the scl gene has been disrupted fail to develop yolk sac hematopoiesis, although endothelium appears to form normally.29,30 Furthermore, scl-null embryonic stem (ES) cells do not give rise to colony-forming cells in vitro and fail to contribute to hematopoiesis in chimeric mice, implying that scl is also critical for definitive hematopoiesis.31,32 

Table 1.

Oligonucleotide Primers Used for RT-PCR

Gene Size (bp)* T (°C) 5′ Primer 3′ Primer Internal Probe Reference 
Mesodermal markers 
Brachyury 947 52 TGCTGCCTGTGAGTCATAAC TCCAGGTGCTATATATTGCC GAGCTCAGTTCTTTCGAGGC 49 
BMP RIA 451 55 CCAGAAGTGCTGGATGAAAGCC CCTATTCCATGCTAATCCCACC ACAGCGATGAATGTCTTCGAG 
BMP-4 570 55 ACTGTGAGGAGTTTCCATCACG TCTTATTCTTCTTCCTGGACCG GGACACCAGACTAGTCCATCAC 
Smad1 336 55 CCAGGCGGCATATTGGAAAAGG ATCTCAATCCAGCAGGGGGTGC AGCCGGAACTGCAACTACCACC 69 
      Transcription factors 
scl 396 55 TATGAGATGGAGATTTCTGATG GCTCCTCTGTGTAACTGTCC GTCCTCACACCAAAGTAGTG 70 
GATA-1 404 60 GGAATTCGGGCCCCTTGTGAGG CGGGGTACCTCACGCTCCAG GTCTGCAATGCCTGTGGCCTCTA 71 
   CCAGAGAG CCAGATTCGACCC 
GATA-2 ∼720 60 CGGAATTCGACACACCACCCGA CGGAATTCGCCTACGCCATGGC GTCTGCAATGCCTGTGGCCTCTA 59 
   TACCCACCTAT AGTCACCATGCT 
EKLF 359 55 TCGCCGGAGACGCAGGCT CCCAGTCCTTGTGCAGGA ACGCAGCCGGCGAACTTTGG 49 
NF-E2 391 62.5 GAGCCCTGGCCATGAAGATTCC CACCATCAGCAGCCTGTTGCAG GCAAGAACAAGGTGGCAGCCC 55 
c-myb 681 55 CCTCTAGGAGCTCATTTGTG TTCAAGGCCAGCATTCTTGC TACTAAACCATTTCATGAGG 49 
PU.1 615 55 TGGAAGGGTTTTCCCTCACC TGCTGTCCTTCATGTCGCCG GAGAACTTCCCTGAGAACCAC 72 
      Receptors 
CD34 618 55 GTTACCTCTGGGATCCCTTCAG CTCCAGAGGTGACCAATGAATA CAACCACAGACTTCCCCAAC 45 
   GCTC AG 
flk-1 398 60 TAGGTGCCTCCCCATACCCTGG TGGCCGGCTCTTTCGCTTACTG GGCAAAGACTATATTGTTCTTC 73 
flk-2 300 60 CTTCTGTGCAAATGCTGTGCGC GTTCTCTCTCGGGAACTCCCAC TTCTCATTGTGTTGATCTGCC 45 
   GTAC TTAAG 
c-kit 765 50 TGTCTCTCCAGTTTCCCTGC TTCAGGGACTCATGGGCTCA ACAACACTCTTATCGTAGACC 49 
Epo R 356 62 TTGACGCTGTCTCTCATTCTGG CAATACCAAGTAGGTGTCCTGG CGAGTTTGAGGGTCTCTTCACC 74 
      Erythroid and myeloid genes 
ζ globin 371 55 GCTCAGGCCGAGCCCATTGG TAGCGGTACTTCTCAGTCAG CGGTCAACTTCAAGCTCCTG 59 
α globin 334 55 CTCTCTGGGGAAGACAAAAGCA GGTGGCTAGCCAAGGTCACCAG GCCCTGGAAAGGATGTTTGCTA 59 
   AC CA GC 
βH1 globin 265 55 CTCAAGGAGACCTTTGCTCA AGTCCCCATGGAGTCAAAGA TCCAATCACCAGCTTCTGCC 49 
εy2 globin 157 55 GGAGAGTCCATTAAGAACCTAG CTGTGAATTCATTGCCGAA CCTGAGAACTTCAAACTCTTGG 59 
   ACAA GTAC GT 
βmaj globin 578 55 CACAACCCCAGAAACAGACA CTGACAGATGCTCTCTTGGG ACCTTCTGGAAGGCAGCCTGTGC 49 
MPO 379 55 GGTGCTGAAGAACCTGGAGTTG CTAGGTCTCCTTCCAGGAAGTC GATGGTGATCGGTTTTGGTGG 75 
Lysozyme 344 60 TGCAGGATGACATCACTGCAGC GCTGTGCTGACTGACAAGGGAG CATTCGAGCATGGGTGGCATG 76 
vav 604 55 GTATAACGTGGAGGTCAAGCA GGAGGACTGGAGAAAATCAGT GCAGAATTCCCTCAAAGATTGC 49 
LMO2 505 60 TCGCGAATTCCACCATGTCCTC CGAGTTCTAGACTAGATGATCC GAGGATTGCCTCAGCTGTGACC 29 
   GGCCATCGAAAGGA CATTGATCTTGGT 
HPRT 249 55 GCTGGTGAAAAGGACCTCT CACAGGACTAGAACACCTGC GGATACAGGCCAGACTTTGT 49 
Gene Size (bp)* T (°C) 5′ Primer 3′ Primer Internal Probe Reference 
Mesodermal markers 
Brachyury 947 52 TGCTGCCTGTGAGTCATAAC TCCAGGTGCTATATATTGCC GAGCTCAGTTCTTTCGAGGC 49 
BMP RIA 451 55 CCAGAAGTGCTGGATGAAAGCC CCTATTCCATGCTAATCCCACC ACAGCGATGAATGTCTTCGAG 
BMP-4 570 55 ACTGTGAGGAGTTTCCATCACG TCTTATTCTTCTTCCTGGACCG GGACACCAGACTAGTCCATCAC 
Smad1 336 55 CCAGGCGGCATATTGGAAAAGG ATCTCAATCCAGCAGGGGGTGC AGCCGGAACTGCAACTACCACC 69 
      Transcription factors 
scl 396 55 TATGAGATGGAGATTTCTGATG GCTCCTCTGTGTAACTGTCC GTCCTCACACCAAAGTAGTG 70 
GATA-1 404 60 GGAATTCGGGCCCCTTGTGAGG CGGGGTACCTCACGCTCCAG GTCTGCAATGCCTGTGGCCTCTA 71 
   CCAGAGAG CCAGATTCGACCC 
GATA-2 ∼720 60 CGGAATTCGACACACCACCCGA CGGAATTCGCCTACGCCATGGC GTCTGCAATGCCTGTGGCCTCTA 59 
   TACCCACCTAT AGTCACCATGCT 
EKLF 359 55 TCGCCGGAGACGCAGGCT CCCAGTCCTTGTGCAGGA ACGCAGCCGGCGAACTTTGG 49 
NF-E2 391 62.5 GAGCCCTGGCCATGAAGATTCC CACCATCAGCAGCCTGTTGCAG GCAAGAACAAGGTGGCAGCCC 55 
c-myb 681 55 CCTCTAGGAGCTCATTTGTG TTCAAGGCCAGCATTCTTGC TACTAAACCATTTCATGAGG 49 
PU.1 615 55 TGGAAGGGTTTTCCCTCACC TGCTGTCCTTCATGTCGCCG GAGAACTTCCCTGAGAACCAC 72 
      Receptors 
CD34 618 55 GTTACCTCTGGGATCCCTTCAG CTCCAGAGGTGACCAATGAATA CAACCACAGACTTCCCCAAC 45 
   GCTC AG 
flk-1 398 60 TAGGTGCCTCCCCATACCCTGG TGGCCGGCTCTTTCGCTTACTG GGCAAAGACTATATTGTTCTTC 73 
flk-2 300 60 CTTCTGTGCAAATGCTGTGCGC GTTCTCTCTCGGGAACTCCCAC TTCTCATTGTGTTGATCTGCC 45 
   GTAC TTAAG 
c-kit 765 50 TGTCTCTCCAGTTTCCCTGC TTCAGGGACTCATGGGCTCA ACAACACTCTTATCGTAGACC 49 
Epo R 356 62 TTGACGCTGTCTCTCATTCTGG CAATACCAAGTAGGTGTCCTGG CGAGTTTGAGGGTCTCTTCACC 74 
      Erythroid and myeloid genes 
ζ globin 371 55 GCTCAGGCCGAGCCCATTGG TAGCGGTACTTCTCAGTCAG CGGTCAACTTCAAGCTCCTG 59 
α globin 334 55 CTCTCTGGGGAAGACAAAAGCA GGTGGCTAGCCAAGGTCACCAG GCCCTGGAAAGGATGTTTGCTA 59 
   AC CA GC 
βH1 globin 265 55 CTCAAGGAGACCTTTGCTCA AGTCCCCATGGAGTCAAAGA TCCAATCACCAGCTTCTGCC 49 
εy2 globin 157 55 GGAGAGTCCATTAAGAACCTAG CTGTGAATTCATTGCCGAA CCTGAGAACTTCAAACTCTTGG 59 
   ACAA GTAC GT 
βmaj globin 578 55 CACAACCCCAGAAACAGACA CTGACAGATGCTCTCTTGGG ACCTTCTGGAAGGCAGCCTGTGC 49 
MPO 379 55 GGTGCTGAAGAACCTGGAGTTG CTAGGTCTCCTTCCAGGAAGTC GATGGTGATCGGTTTTGGTGG 75 
Lysozyme 344 60 TGCAGGATGACATCACTGCAGC GCTGTGCTGACTGACAAGGGAG CATTCGAGCATGGGTGGCATG 76 
vav 604 55 GTATAACGTGGAGGTCAAGCA GGAGGACTGGAGAAAATCAGT GCAGAATTCCCTCAAAGATTGC 49 
LMO2 505 60 TCGCGAATTCCACCATGTCCTC CGAGTTCTAGACTAGATGATCC GAGGATTGCCTCAGCTGTGACC 29 
   GGCCATCGAAAGGA CATTGATCTTGGT 
HPRT 249 55 GCTGGTGAAAAGGACCTCT CACAGGACTAGAACACCTGC GGATACAGGCCAGACTTTGT 49 

Abbreviations: BMP, bone morphogenetic protein; Epo R, erythropoietin receptor; MPO, myeloperoxidase; HPRT, hypoxanthine phosphoribosyl transferase.

*

Size of the predicted PCR product.

Annealing temperature.

Fig. 1.

Normal induction of early mesoderm-associated genes in control and scl-null EBs. (A through D) Expression of the early pan-mesodermal marker Brachyury, the ventral mesoderm inducing gene BMP-4, its type I receptor (BMP R1A), and the VEGF receptor tyrosine kinase flk-1 are shown at day 0, 4, 6, and 8 of embryoid body differentiation. At each time point, wild-type (+/+) or scl-heterozygous (+/−) lines are compared with three independent scl-null lines (−/−), except for day 0, when expression is shown for undifferentiated wild-type (+/+) ES cells only. RT-PCR amplification of three fivefold serial dilutions of cDNA is shown for each line. C, control lane with no cDNA added.

Fig. 1.

Normal induction of early mesoderm-associated genes in control and scl-null EBs. (A through D) Expression of the early pan-mesodermal marker Brachyury, the ventral mesoderm inducing gene BMP-4, its type I receptor (BMP R1A), and the VEGF receptor tyrosine kinase flk-1 are shown at day 0, 4, 6, and 8 of embryoid body differentiation. At each time point, wild-type (+/+) or scl-heterozygous (+/−) lines are compared with three independent scl-null lines (−/−), except for day 0, when expression is shown for undifferentiated wild-type (+/+) ES cells only. RT-PCR amplification of three fivefold serial dilutions of cDNA is shown for each line. C, control lane with no cDNA added.

Fig. 2.

Expression of hematopoietic genes in differentiating control and scl-null EBs. RT-PCR amplification of three fivefold serial dilutions of cDNA for each of the indicated genes is shown for each line at day 0, 4, 6, and 8 of embryoid body differentiation. As in Fig 1, the genotype of the cell line (+/+, +/−, or −/−) is indicated above the panel. Note the discordance in expression between control cells and scl-null cells for GATA-1, EKLF, NF-E2, c-myb, vav, and α globin at the day-8 timepoint.

Fig. 2.

Expression of hematopoietic genes in differentiating control and scl-null EBs. RT-PCR amplification of three fivefold serial dilutions of cDNA for each of the indicated genes is shown for each line at day 0, 4, 6, and 8 of embryoid body differentiation. As in Fig 1, the genotype of the cell line (+/+, +/−, or −/−) is indicated above the panel. Note the discordance in expression between control cells and scl-null cells for GATA-1, EKLF, NF-E2, c-myb, vav, and α globin at the day-8 timepoint.

LMO2 is a lin-11,is1-1,mec-3 (LIM) domain protein that was also identified by virtue of its involvement in chromosomal translocations in pediatric T-cell leukemia.33 It interacts in vivo with scl28  and displays a similar phenotype in gene-targeted mice, with failure of yolk sac erythropoiesis leading to embryonic lethality around E10.5.33 

To analyze the molecular nature of the block in hematopoiesis, which is a consequence of scl gene ablation, we examined the temporal expression pattern of genes involved in early hematopoiesis in differentiating EBs. In contrast with wild-type and scl-heterozygous (scl+/−) EBs, we observed a failure of induction of hematopoietic-specific genes in scl-null EBs, although expression of genes coexpressed in endothelium was normal. This is consistent with the hypothesis that scl is dispensible for endothelial differentiation but is absolutely required for hematopoietic commitment from a primitive hemangioblast. Thus, by applying an extensive analysis of hematopoietic gene expression to control and scl-null EBs, we have extended previous studies and have been able to more clearly define the place of scl within the network of interacting genes that regulate early hematopoiesis.

MATERIALS AND METHODS

Generation and in vitro differentiation of ES cell lines.The three scl-null and the two scl+/− ES cell lines used in this study were generated by electroporation of the scl+/− cell line 93 with the linearized targeting vector 607 and selecting for homologous or nonhomologous integrants as described.32 Parental (W9.5), scl+/− and scl-null cell lines were weaned off feeder layers and maintained in leukemia inhibitory factor (LIF ). Primary EBs were formed in 0.9% methylcellulose cultures (including a selected batch of fetal calf serum at 15%) supplemented with 100 ng/mL stem cell factor (SCF ) and 2 U/mL of recombinant human erythropoietin (Epo) in the absence of LIF. Cultures were established at 7.5 to 10 × 103 cells/mL and 10 to 20 EBs were generated per 1,000 cells plated.

cDNA synthesis and reverse transcription polymerase chain reaction (RT-PCR).Total RNA was isolated from EBs after 4, 6, 8, and 12 days of differentiation and undifferentiated ES cells using Trizol (GIBCO-BRL, Gaithersburg, MD) according to the manufacturer's instructions. Samples were treated with DNase I (Boehringer Mannheim, Mannheim, Germany) and oligo(dT)-primed first strand cDNA synthesis from 3 μg RNA was performed using avian myeloblastosis virus (AMV) reverse transcriptase (Boehringer Mannheim) in a total reaction volume of 60 μL. One microliter of fivefold serial dilutions of each sample was polymerase chain reaction (PCR) amplified with primers for hypoxanthine phosphoribasyl transferase (HPRT; Table 1) using 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 60 seconds. This was performed in a 20 μL reaction mixture containing 1 × PCR buffer (Boehringer Mannheim), 60 μmol/L each dNTP, 1.25 U Taq polymerase (Boehringer Mannheim) preincubated with TaqStart antibody (Clontech, San Diego, CA) at a ratio of 2:1:1 of Taq:TaqStart:TaqStart dilution buffer and 0.5 μmol/L of each specific primer. The product was electrophoresed on a 2% agarose gel, transferred to GeneScreen Plus (Dupont, Wilmington, DE) and the filter hybridized with a 32P-end labeled internal oligonucleotide (Table 1). Signal intensity was quantitated using a Phosphorimager (Molecular Dynamics, Sunnyvale, CA) and ImageQuant software (Molecular Dynamics). This information was used to equilibrate the quantity of serially diluted cDNA in each sample amplified in subsequent reactions with primers for hematopoietic genes. Thirty-cycle PCR reactions were used for all genes and the annealing temperatures are shown in Table 1. Most genes were analyzed on more than one occasion using cDNA from independently derived RNA samples.

Fig. 3.

scl-null EBs express endothelial genes but not specific erythroid and myeloid genes. RT-PCR amplification of three fivefold serial dilutions of cDNA for each of the indicated genes is shown for each ES cell line of indicated genotype after day 0 and day 12 of differentiation.

Fig. 3.

scl-null EBs express endothelial genes but not specific erythroid and myeloid genes. RT-PCR amplification of three fivefold serial dilutions of cDNA for each of the indicated genes is shown for each ES cell line of indicated genotype after day 0 and day 12 of differentiation.

To achieve signals within the linear amplification range for hematopoietic genes, serial dilutions commenced with cDNA synthesized from approximately 10 ng of RNA. For the HPRT control, serial dilutions commenced with cDNA synthesized from approximately 400 pg of DNase I-treated RNA. The hematopoietic gene primers, selected to cross introns where possible, are listed in Table 1. The duration of exposure of the autoradiographs shown in Figs 1-3 was chosen to approximate the intensity of signal on the ethidium bromide stained gel.

Immunofluorescence and confocal microscopy.EBs were harvested after 12 days and treated with trypsin to produce cell suspensions, which were allowed to adhere to poly-(L-lysine) (Sigma Chemical Co, St Louis, MO) coated glass coverslips for 5 minutes. Immunofluorescence was performed as previously described.34 Briefly, cells were fixed in 3.7% paraformaldehyde and stained with 1:25 dilution of biotinylated antimouse CD34 monoclonal antibody (Pharmingen, San Diego, CA) followed by 1:100 dilution of fluorescein isothiocyanate (FITC)-conjugated Avidin D (Calbiochem, San Diego, CA). For detection of globin, cells were permeabilized with 0.5% Triton-X100 after fixation and stained with 1:500 dilution of rabbit antimouse hemoglobin (Cappel Research Products, Durham, NC) followed by 1:100 dilution of FITC-conjugated antirabbit IgG (Silenus, Melbourne, Australia). Cells were briefly (45 seconds) permeabilized with 0.5% Triton-X100 before fixation to detect GATA-1 with a rat anti-mouse GATA-1 (N6) monoclonal antibody35 used at 30 μg/mL followed by 1:100 dilution of FITC-conjugated antirat IgG (Jackson Immunoresearch Laboratories, West Grove, PA).

Images of single optical sections were collected using a Leica Confocal Laser Scanning Microscope and Scanware software (Leica Lasertechnik Gmbh, Heidelberg, Germany).

RESULTS

To study the molecular consequences of scl deletion, gene expression profiles were compared in three control cell lines (two scl-heterozygous (+/−) and one wild-type (+/+) ES cell line) and three scl-null (−/−) ES cell lines that were differentiated in methylcellulose cultures in the presence of SCF and Epo. EBs were harvested after 4, 6, and 8 days of differentiation and cDNA was prepared. Gene expression in the ES cell lines was compared using PCR in a semiquantitative manner. As described in Materials and Methods, this involved careful titration of the quantity of cDNA amplified, the use of serial dilutions of cDNA, and a limitation of PCR cycle numbers to 30. In a further series of experiments, EBs were analyzed after 12 days of differentiation with and without the same growth factors. Four sets of genes were studied: genes involved in mesoderm induction and hematopoietic specification, transcription factors, cell surface molecules, and genes expressed in differentiated erythroid and myeloid cells. The results for all genes are summarized in Table 2, and representative Southern blots of RT-PCR reactions of selected examples are displayed in Figs 1-3.

Table 2.

Hematopoietic Gene Expression During Embryoid Body Development in Control and scl-Null ES Cells

Gene Gene Expression During ES Cell Differentiation (days)* 
 12 Induction Ratio   
 null null null null null c:null   
Mesodermal markers 
Brachyury − ++ ++ ± ± nd nd >500 >500 ∼1 
BMP R1A ++ ++ ++ ++ +++ +++ nd nd ∼5 ∼5 ∼1 
BMP-4 ± ± ± ++ ++ nd nd ∼50 ∼50 ∼1 
Smad1 ++ ++ ++ ++ ++ ++ >5 >5 ∼1 
Transcription factors 
scl − ± − − ++ − − >500 >500 
GATA-1 ± ± ± ± ± ++ ± ++ ± >5 ∼1 >5 
GATA-2 − ++ ++ ++ ++ ++ ++ >50 >50 ∼1 
EKLF ++ ++ >5 ∼1 >5 
NF-E2 ± ++ ++ ++ >5 >5 ∼1 
c-myb ++ ++ ± nd nd <5 ∼1ρ <5 
PU.1 ± ± ± ± ± ± ± >5 ∼1 >5 
Receptors 
CD34 ± ± ± ± ± ± ++ ++ >50 >50 ∼1 
flk-1 − +++ +++ +++ +++ nd nd >50 >50 ∼1 
flk-2 ± ± ± ± ± ± ± ± ± >5 >5 <5 
c-kit ++ ++ ++ ++ ++ ++ ++ nd nd ∼1 ∼1 ∼1 
Epo R ++ ++ ++ ++ ++ ++ nd nd >5 >5 ∼1 
Erythroid and myeloid genes 
ζ globin − − − ± − +++ − +++ − >500 >500 
α globin ± ± ± ± ± +++ ± +++ ± >500 ∼1 >500 
βH1 globin − − − ± − +++ − +++ − >500 >500 
ε2 globin − − − − − +++ − +++ − >500 >500 
βmaj globin − − − − − +++ − +++ − >500 >500 
MPO − ± ± ± ± ± ± >50 <5 >5 
Lysozyme − ± ± ± ± nd nd >50 >50 <5 
vav ± ± ∼1 0ρ >5 
LMO2 − ++ ++ ++ ++ nd nd >500 >50 <5 
Gene Gene Expression During ES Cell Differentiation (days)* 
 12 Induction Ratio   
 null null null null null c:null   
Mesodermal markers 
Brachyury − ++ ++ ± ± nd nd >500 >500 ∼1 
BMP R1A ++ ++ ++ ++ +++ +++ nd nd ∼5 ∼5 ∼1 
BMP-4 ± ± ± ++ ++ nd nd ∼50 ∼50 ∼1 
Smad1 ++ ++ ++ ++ ++ ++ >5 >5 ∼1 
Transcription factors 
scl − ± − − ++ − − >500 >500 
GATA-1 ± ± ± ± ± ++ ± ++ ± >5 ∼1 >5 
GATA-2 − ++ ++ ++ ++ ++ ++ >50 >50 ∼1 
EKLF ++ ++ >5 ∼1 >5 
NF-E2 ± ++ ++ ++ >5 >5 ∼1 
c-myb ++ ++ ± nd nd <5 ∼1ρ <5 
PU.1 ± ± ± ± ± ± ± >5 ∼1 >5 
Receptors 
CD34 ± ± ± ± ± ± ++ ++ >50 >50 ∼1 
flk-1 − +++ +++ +++ +++ nd nd >50 >50 ∼1 
flk-2 ± ± ± ± ± ± ± ± ± >5 >5 <5 
c-kit ++ ++ ++ ++ ++ ++ ++ nd nd ∼1 ∼1 ∼1 
Epo R ++ ++ ++ ++ ++ ++ nd nd >5 >5 ∼1 
Erythroid and myeloid genes 
ζ globin − − − ± − +++ − +++ − >500 >500 
α globin ± ± ± ± ± +++ ± +++ ± >500 ∼1 >500 
βH1 globin − − − ± − +++ − +++ − >500 >500 
ε2 globin − − − − − +++ − +++ − >500 >500 
βmaj globin − − − − − +++ − +++ − >500 >500 
MPO − ± ± ± ± ± ± >50 <5 >5 
Lysozyme − ± ± ± ± nd nd >50 >50 <5 
vav ± ± ∼1 0ρ >5 
LMO2 − ++ ++ ++ ++ nd nd >500 >50 <5 

Abbreviations: ES, embryonic stem; BMP, bone morphogenetic protein; Epo, erythropoietin; MPO, myeloperoxidase.

*

Gene expression profiles determined by RT-PCR after in vitro differentiation of ES cells. The mean level of expression is compared between two (day 12 samples) or three lines with at least one wild-type scl allele (c) and three lines with both scl alleles deleted (null). Samples were transferred to nylon membranes after electrophoresis, probed with 32P end-labeled specific internal oligonucleotides, and the signals quantitated on a phosphorimager. Scoring was as follows: −, no signal; ±, signal detected after hybridization only; +, ++, +++, signal of increasing intensity visible on ethidium bromide stained gel; nd, not determined.

Gene induction (fold) during differentiation compared with levels in undifferentiated ES cells.

The ratio of mean signal intensity in control versus null lines calculated at day 8 or 12 of differentiation.

ρ After initial induction, expression fell in null cell lines. See also Fig 2E and G.

EBs derived from both sets of cell lines recapitulated the temporal expression pattern of genes required for the formation of ventral mesoderm (Fig 1 and Table 2). The earliest mesoderm marker, Brachyury, expressed in the early primitive streak at E6.5,36 was induced equally in all six cell lines analyzed, peaking after 6 days differentiation and then declining by day 8 (Fig 1A). BMP-4 is detected, first in the E6.5 to E7.5 posterior primitive streak, and later in posterior-ventral mesoderm (which includes yolk sac blood islands among its descendants).22 BMP-4 levels increased from day 4 of differentiation (Fig 1C), whereas its receptor, BMP R1A, and one of the major downstream signaling molecules, Smad1, were present in uninduced ES cells (Fig 1B and Table 2). The VEGF receptor tyrosine kinase, flk-1, was expressed in all lines by day 4 and was present at higher levels by 6 days of differentiation (Fig 1D). This paralleled the induction of BMP-4 and antedated the expression of most hematopoietic genes (discussed later). In keeping with previous observations in scl-null embryos, these results showed that initial molecular events crucial for formation of ventral mesoderm, hemangioblasts, and vasculogenesis were preserved in the scl-mutant lines.

Fig. 4.

CD34 is detected on cells from both wild-type and scl-null EBs but only wild-type EBs contain cells positive for globin or GATA-1. Indirect immunofluorescence of cells from disaggregated day-12 scl+/+ (A, C, E, and F ) and scl-null (B, D, F, and H) EBs stained with antibodies to globin (A and B), GATA-1 (C and D), and CD34 (E through H).

Fig. 4.

CD34 is detected on cells from both wild-type and scl-null EBs but only wild-type EBs contain cells positive for globin or GATA-1. Indirect immunofluorescence of cells from disaggregated day-12 scl+/+ (A, C, E, and F ) and scl-null (B, D, F, and H) EBs stained with antibodies to globin (A and B), GATA-1 (C and D), and CD34 (E through H).

Analysis of hematopoietic transcription factors in control ES cells revealed that scl was first detected at day 4, coincident with the onset of flk-1 expression. Expression of scl increased exponentially over the next 4 days (Fig 2A). scl transcripts were absent from the scl-null cell lines. The patterns of expression of GATA-1, EKLF, and NF-E2 were consistent with their roles as transcription factors relevant in later, committed progenitor cells (Fig 2B to D). Low levels of transcription of all three genes were evident in undifferentiated ES cells and persisted unchanged in both scl control and scl-null cell lines until day 6. The significance of this was unclear (Fig 4). However, by day 8, levels of GATA-1, EKLF, and NF-E2 were elevated in scl control lines, consistent with an expansion of hematopoietic cells and their precursors. In contrast, expression remained at basal levels for the scl-null cell lines. Other transcription factors playing a role in hematopoiesis include c-myb, shown to be essential for definitive hematopoiesis,37 and PU.1, a factor important in lymphoid and macrophage differentiation.38,39 Although there was no induction of PU.1 in the scl-null EB (Table 2), c-myb was highly expressed in all lines by day 4, after which time its expression began to wane. In contrast to the stable levels of c-myb transcripts in the day-8 samples from scl control lines, there was a distinct fall in expression in the scl-null cell lines (Fig 2E) suggestive of a failure of formation or expansion of a hematopoietic population.

Two other genes that play pivotal roles in early hematopoiesis are LMO233 and GATA-2.40 LMO2 was first detected at day 4 and expressed at higher levels from day 6 in all cell lines (Table 2). Our analysis of GATA-2 revealed a similar expression profile to that of scl in control EBs. This pattern was unaltered in the scl-null EBs (Fig 3 and Table 2). This accords with the known expression of GATA-2 in endothelial cells, a lineage that appears to develop normally in an scl-null background.29,30 

A number of cell surface molecules expressed on primitive hematopoietic cells are coexpressed on other cell types, notably CD34, c-kit, and the Epo receptor, which include endothelial cells in their tissue repertoire.41-43 Furthermore, transcripts for both c-kit and the Epo receptor have been detected in undifferentiated ES cells.44,45 It was not surprising, therefore, that CD34, c-kit, and the Epo receptor were expressed approximately equally in our cohort of differentiating EBs independent of scl-status (Figs 2F and 3 and Table 2). The flk-2 receptor is predominantly expressed in definitive hematopoietic stem cells but is also found in placenta, testis, and brain.46,47 However, because we detected only very low levels of expression, it was not possible to be sure that minor differences between the control and scl-null lines were significant (Table 2).

We investigated genes expressed in hematopoietic cells at later stages of differentiation. The vav gene, which probably functions as a signaling intermediate downstream of receptor tyrosine kinases in hematopoietic cells,48 was detected in all cell lines from days 0 to 6 of differentiation (Fig 2G). However, reminiscent of the expression pattern for c-myb, we noted a marked fall in the amount of vav cDNA from day 8 in the scl-null cell lines. This again suggested the failure to form or expand a hematopoietic population.

Most globin genes were not expressed in scl-null EBs (Figs 2H and 3 and Table 2). However, a consistent exception was a low level of spliced α globin cDNA in all cell lines even in the absence of differentiation induction (Fig 2H). This pattern of expression was similar to that seen with the GATA-1, NF-E2, and EKLF transcription factors but was not seen with other globin genes and was not associated with translation to immunologically detectable protein (Fig 4). The macrophage gene, lysozyme, was barely detectable after 8 days of differentiation in all cell lines (Table 2). On the other hand, the primitive myeloid gene, myeloperoxidase, was expressed from day 8 in scl control EBs but was virtually absent in the scl-null lines (Fig 3 and Table 2).

Fig. 5.

(A) Sequential expression of genes required for ventral mesoderm induction, hemangioblast formation, and hematopoiesis and vasculogenesis during control EB differentiation. (B) Pattern of gene expression observed during differentiation of scl-null EBs showing a failure of expression of hematopoietic-restricted genes. The data for this figure was derived from gene expression in embryoid bodies harvested at 4, 6, and 8 days of differentiation compared with the expression of each gene in undifferentiated ES cells. Expression levels were quantitated on the phosphorimager as described in Materials and Methods. The expression of each gene in undifferentiated ES cells was normalized to the base line and the maximal level of expression given the same arbitrary value for each gene. Gene expression is shown on a logarithmic scale on the Y axis, and the day of differentiation is indicated on the X axis. The points have been linked to form a curve to make the data easier to appreciate. The approximate timing of the major developmental processes of mesoderm induction, hemangioblast formation, and blood cell differentiation are shown in boxes above the curves.

Fig. 5.

(A) Sequential expression of genes required for ventral mesoderm induction, hemangioblast formation, and hematopoiesis and vasculogenesis during control EB differentiation. (B) Pattern of gene expression observed during differentiation of scl-null EBs showing a failure of expression of hematopoietic-restricted genes. The data for this figure was derived from gene expression in embryoid bodies harvested at 4, 6, and 8 days of differentiation compared with the expression of each gene in undifferentiated ES cells. Expression levels were quantitated on the phosphorimager as described in Materials and Methods. The expression of each gene in undifferentiated ES cells was normalized to the base line and the maximal level of expression given the same arbitrary value for each gene. Gene expression is shown on a logarithmic scale on the Y axis, and the day of differentiation is indicated on the X axis. The points have been linked to form a curve to make the data easier to appreciate. The approximate timing of the major developmental processes of mesoderm induction, hemangioblast formation, and blood cell differentiation are shown in boxes above the curves.

Expression of key genes was reexamined in EBs after 12 days of culture (summarized in Fig 3 and Table 2) to ensure that we did not mistake a delay in gene induction for a failure of expression. These data were consistent with the earlier timepoints examined: globin and myeloperoxidase expression were absent in the scl-null lines, there was persistent failure of induction of GATA-1 and EKLF but normal expression of GATA-2 and CD34. Interestingly, by day 12, NF-E2 levels were equivalent in all cell lines in contrast to our day 8 observations in which expression was clearly diminished in the scl-null EBs (compare Fig 2D and Fig 3).

We also compared gene expression from EBs grown with or without SCF and Epo. The results were not influenced by the addition or omission of these growth factors (data not shown).

To correlate the cDNA expression data with protein production, we immunostained cell suspensions made from day 12 EBs with antibodies to globins, GATA-1, and CD34 (Fig 4). Globin and GATA-1, which displayed its characteristic subnuclear localization to GATA bodies,34 were only detectable in cells derived from control EB (Fig 4A to D). This suggested that the low level, noninducible transcripts observed for both α globin and GATA-1 in the scl-null cell lines did not result in significant quantities of translated product. CD34 gene expression was equivalent in all the cell lines and immunoreactive protein was present in both control and scl-null ES cell lines (Fig 4E to H). Both single cells and larger clumps of CD34+ cells were detected, although the percentage of positive cells was lower in the scl-null EBs (1.3% versus 3.1% of 200 to 700 cells counted per cell line per experiment. Two experiments were performed using 1 or 2 control and 2 or 3 scl-null cell lines in each).

DISCUSSION

We have characterized the expression profiles of ES cells bearing wild-type or mutant scl genes allowed to differentiate in vitro for up to 12 days and established a temporal sequence for the induction of genes important in hematopoiesis. Equilibration of the quantity of cDNA amplified, limitation of cycle numbers, and the use of three independent control and scl-null ES cell lines reasonably permits a comparison of the gene expression between both groups of differentiating ES cells.

Induction of hematopoietic genes in control ES cells.In wild-type or scl+/− ES cells, the first 4 to 6 days of in vitro differentiation was associated with the sequential induction of genes that correlate with the embryonic processes of mesoderm induction, its ventral specification, and formation of mesenchymal aggregates of yolk sac hemangioblasts. It was interesting that the BMP-4 type 1A receptor and Smad1 were expressed in undifferentiatied ES cells in the light of evidence that differentiating EBs are not competent to respond to the inductive effects of BMP-4 for the first 3 to 4 days.9 In control ES cells, expression of flk-1 paralleled BMP-4 and transcripts for scl, and GATA-2 also progressively increased in abundance from day 4. It was only after day 6 that a second cohort of hematopoietic transcription factors appeared (GATA-1, EKLF, NF-E2, and PU.1), associated with more committed progenitors, and globin and myeloperoxidase were expressed. This sequence of events is displayed diagrammatically in Fig 5A.

Our results in control EBs are generally in agreement with other studies of hematopoietic gene expression during in vitro differentiation of ES cells. For example, Keller et al49 also showed that Brachyury expression peaked before the induction of GATA-1 and the globin genes. However, unlike our study in which scl expression preceded GATA-1, Keller et al observed that scl and GATA-1 were expressed contemporaneously. Resolution of the sequence of gene induction may have been more difficult in their study because of the rapid transit from mesoderm formation to hematopoiesis (approximately 2 days). These differences in kinetics may be explicable by differences between the ES cell lines (CCE versus W9.5) and/or by differences in reagents or the culture conditions. The time course of flk-1 induction we observed was similar to that reported in a recent study examining endothelial cell differentiation in EBs.50 In their evaluation of cytokine and receptor gene expression during ES cell differentiation, both Schmitt et al44 and McClanahan et al45 showed significant levels of c-kit and the Epo receptor throughout ES cell differentiation, similar to our findings, and the latter authors also showed increasing CD34 levels during EB differentiation from day 7 onwards.

Fig. 6.

Correlation of major events in hematopoietic development with expression of flk-1, scl, and LMO2. Gastrulating epiblast cells give rise to ventral mesoderm under the influence of BMP-4. Putative hemangioblasts expressing flk-1 and scl differentiate down endothelial and hematopoietic pathways. The molecular event(s) (gene x), which specifies a hematopoietic progenitor and downregulates flk-1, is not known, although LMO2 is a possible candidate. Differentiating erythroid lineage cells continue to express scl and LMO2 but their expression is extinguished in myeloid cells.

Fig. 6.

Correlation of major events in hematopoietic development with expression of flk-1, scl, and LMO2. Gastrulating epiblast cells give rise to ventral mesoderm under the influence of BMP-4. Putative hemangioblasts expressing flk-1 and scl differentiate down endothelial and hematopoietic pathways. The molecular event(s) (gene x), which specifies a hematopoietic progenitor and downregulates flk-1, is not known, although LMO2 is a possible candidate. Differentiating erythroid lineage cells continue to express scl and LMO2 but their expression is extinguished in myeloid cells.

Gene expression in scl-null embryoid bodies.A major objective of this study was to define the expression patterns of key hematopoietic genes during differentiation of scl-null EBs. As displayed in Fig 5B, the results indicate that whereas the scl-null EBs were competent to express mesoderm-related genes and express genes associated with primitive hemangioblasts and endothelium (for example flk-1, GATA-2, and CD34), they did not undergo differentiation to hematopoietic precursors expressing transcription factors such as GATA-1, EKLF, or PU.1. Consistent with this, markers of more differentiated hematopoietic cells such as globin genes or myeloperoxidase were also absent.

For both c-myb and vav genes, early higher levels of expression could correlate with known nonhematopoietic sites of expression.48,51 The marked differences in levels between control and scl-null EBs from day 8 onwards probably reflect proliferation of hematopoietic cells restricted to control EBs.

LMO2 was induced equally in all ES cell lines with kinetics similar to flk-1 and GATA-2 (Table 2 and data not shown). LMO2 is expressed in nonhematopoietic tissues, such as the brain and kidney,52-54 but the cell type(s) responsible for its early embryonic expression is not known. Also, the leucine zipper transcription factor NF-E255 appeared to be present at normal levels in scl-null ES cells at day 12 of differentiation, arguing for an as yet unidentified nonhematopoietic site of transcription.

Expression of early endothelial genes in scl-null embryoid bodies. flk-1 expression is first detected in the yolk sac at approximately E7 in prospective blood islands, but by E8.5, expression is confined to the endothelium surrounding the hematopoietic cells.2,24 This suggests that hemangioblasts express flk-1 before lineage commitment and that flk-1 expression is retained by the endothelial arm and downregulated in hematopoietic cells. Therefore, our observation that scl-null EBs expressed flk-1 at normal levels argues for the preservation of primitive hemangioblasts in the absence of scl. Experiments to confirm this hypothesis are in progress.

Although scl is also detected in the yolk sac mesoderm, it differs from flk-1 in that expression continues in both endothelial and hematopoietic components of the blood island.27 Thus, it is likely, although not formally proven, that flk-1 and scl are coexpressed in the same cells. Whereas deletion of either gene completely abrogates in vivo hematopoiesis, it is possible that the key role of flk-1 is to provide an endothelially lined microenvironment to foster scl-dependent hematopoiesis. Indeed, the derivation of a small number of hematopoietic colonies from flk-1–null yolk sacs suggests that this receptor may not be absolutely required for hematopoietic commitment.2 

Several other genes shared by primitive hematopoietic cells and vascular endothelium, such as GATA-2,56,57 CD34,41 and c-kit,42  were expressed in differentiating scl-null ES cells. This is not entirely surprising because endothelium appears normal in scl-null embryos.29,30 However, as GATA-2 and c-kit transcripts were detected early in differentiation, they could conceivably also mark the common hemangioblast that may be formed in scl-null embryos. As noted for scl, GATA-2, CD34, and c-kit are also dispensable for endothelial development,40,42,58 although gene ablation has hematopoietic consequences of variable severity.

Comparison of the differentiation of scl-null ES cells with other mutant ES cell lines.The in vitro differentiation of doubly targeted ES cells has been studied for a number of hematopoietic regulatory genes. By morphological criteria, LMO2-null ES cells retained macrophage colony forming ability but molecular markers were not used to confirm lineage assignment.33 Because GATA-2–null EBs gave rise to hematopoietic colonies, commitment to hematopoiesis occurred, and other transcription factors were able to partially compensate for GATA-2 deficiency.40 Although GATA-1–null ES cell-derived erythroblasts were blocked in differentiation at the proerythroblast stage, there was little perturbation of gene expression,59 and ES cells in which both copies of GATA-3 were deleted displayed a selective defect in the earliest stages of T-cell differentiation.60 EBs derived from GATA-4–null ES cells did not form visceral yolk sac endoderm61 resulting in disorganization and reduction of vascular and hematopoietic elements.62 However, normal flk-1 and globin gene expression showed that hematopoiesis does not absolutely depend on endodermal signals.

A number of genes specifically affect definitive hematopoiesis. These include c-myb and members of the heterodimeric core binding factor (CBF ) complex, CBFα2 (AML1) and CBFβ. Mice deficient in c-myb had a selective defect in fetal liver hematopoiesis, but analysis of doubly targeted ES cells has not been published.37 Animals homozygous for mutations in either CBFα2 (AML1)63,64 or CBFβ65,66 died between E11.5 and E13.5 with central nervous system hemorrhage and failure of fetal liver hematopoiesis. Vasculogenesis and primitive hematopoiesis were intact in the mutant embryos and CBFα2-null ES cells formed hemoglobinized EBs containing primitive nucleated erythrocytes. Disruption of the PU.1 gene, an ets-family transcription factor, showed a multilineage defect involving monocytes, granulocytes, and lymphocytes, but primitive erythropoiesis was not affected.38,39 Consistent with this late defect, PU.1-null EB cells retained the capacity to express myeloperoxidase and β globin after in vitro differentiation.67,68 

Additional molecular events in hematopoietic commitment.The earliest ventral mesoderm genes identified in yolk sac hemangioblasts are flk-1 and scl. Because both genes continue to be expressed in endothelium, as are GATA-2, CD34, and c-kit, it is clear that specification to a hematopoietic phenotype requires additional genetic event(s). Although it is likely that LMO2, which complexes with scl and is induced with similar kinetics, is important, its role remains speculative because its expression pattern in the developing yolk sac or endothelium has not been reported. It may be that as yet unknown gene products are essential, acting either to downregulate flk-1, induce LMO2, or to directly complement genes like scl, GATA-2, CD34, and c-kit (Fig 6). The elucidation of these genetic events remains a major challenge in developmental hematopoiesis.

ACKNOWLEDGMENT

We thank Professor D. Metcalf and Professor T. Graf for helpful discussions and for critically reviewing the manuscript.

Supported in part by the AntiCancer Council of Victoria; the National Health and Medical Research Council, Canberra; and the Rotary Bone Marrow Research Laboratories, the Royal Melbourne Hospital. A.G.E. is a recipient of a Neil Hamilton Fairley Fellowship of the NH&MRC.

Address reprint requests to Andrew G. Elefanty, FRACP, PhD, The Walter and Eliza Hall Institute of Medical Research, PO Royal Melbourne Hospital, Parkville, 3050 Victoria, Australia.

REFERENCES

REFERENCES
1
Palis
J
McGrath
KE
Kingsley
PD
Initiation of hematopoiesis and vasculogenesis in murine yolk sac explants.
Blood
86
1995
156
2
Shalaby
F
Rossant
J
Yamaguchi
TP
Gertsenstein
M
Wu
X-F
Breitman
ML
Schuh
AC
Failure of blood-island formation and vasculogenesis in Flk-1–deficient mice.
Nature
376
1995
62
3
Hogan
BLM
Bone morphogenetic proteins: Multifunctional regulators of vertebrate development.
Genes Dev
10
1996
1580
4
Graff
JM
Thies
RS
Song
JJ
Celeste
AJ
Melton
DA
Studies with a Xenopus BMP receptor suggest that ventral mesoderm-inducing signals override dorsal signals in vivo.
Cell
79
1994
169
5
Maéno
M
Ong
RC
Suzuki
A
Ueno
N
Kung
H-F
A truncated bone morphogenetic protein 4 receptor alters the fate of ventral mesoderm to dorsal mesoderm: Roles of animal pole tissue in the development of ventral mesoderm.
Proc Natl Acad Sci USA
91
1994
10260
6
Suzuki
A
Thies
RS
Yamaji
N
Song
JJ
Wozney
JM
Murakami
K
Ueno
N
A truncated bone morphogenetic protein receptor affects dorsal-ventral patterning in the early Xenopus embryo.
Proc Natl Acad Sci USA
91
1994
10255
7
Maéno
M
Mead
PE
Kelley
C
Xu
R-H
Kung
H-F
Suzuki
A
Ueno
N
Zon
LI
The role of BMP-4 and GATA-2 in the induction and differentiation of hematopoietic mesoderm in Xenopus laevis.
Blood
88
1996
1965
8
Zhang
C
Evans
T
BMP-like signals are required after the midblastula transition for blood cell development.
Dev Genet
18
1996
267
9
Johansson
BM
Wiles
MV
Evidence for involvement of Activin A and bone morphogenetic protein 4 in mammalian mesoderm and hematopoietic development.
Mol Cell Biol
15
1995
141
10
Massagué
J
TGFβ signaling: Receptors, transducers, and mad proteins.
Cell
85
1996
947
11
Derynck
R
Zhang
Y
Intracellular signalling: The mad way to do it.
Current Biol
6
1996
1226
12
Lagna
G
Hata
A
Hemmati-Brivanlou
A
Massagué
J
Partnership between DPC4 and SMAD proteins in TGF-β signalling pathways.
Nature
383
1996
832
13
Graff
JM
Bansal
A
Melton
DA
Xenopus mad proteins transduce distinct subsets of signals for the TGFβ superfamily.
Cell
85
1996
479
14
Mead
PE
Brivanlou
IH
Kelley
CM
Zon
LI
BMP-4–responsive regulation of dorsal-ventral patterning by the homeobox protein Mix.1.
Nature
382
1996
357
15
Ault
KT
Dirksen
M-L
Jamrich
M
A novel homeobox gene PV.1 mediates induction of ventral mesoderm in Xenopus embryos.
Proc Natl Acad Sci USA
93
1996
6415
16
Gawantka
V
Delius
H
Hirschfeld
K
Blumenstock
C
Niehrs
C
Antagonizing the Spemann organizer: Role of the homeobox gene Xvent-1.
EMBO J
14
1995
6268
17
Onichtchouk
D
Gawantka
V
Dosch
R
Delius
H
Hirschfeld
K
Blumenstock
C
Niehrs
C
The Xvent-2 homeobox gene is part of the BMP-4 signalling pathway controlling dorsoventral patterning of Xenopus mesoderm.
Development
122
1996
3045
18
Schmidt
JE
von Dassow
G
Kimelman
D
Regulation of dorsal-ventral patterning: The ventralizing effects of the novel Xenopus homeobox gene Vox.
Development
122
1996
1711
19
Papalopulu
N
Kintner
C
A Xenopus gene, Xbr-1, defines a novel class of homeobox genes and is expressed in the dorsal ciliary margin of the eye.
Dev Biol
174
1996
104
20
Ladher
R
Mohun
TJ
Smith
JC
Snape
AM
Xom: A Xenopus homeobox gene that mediates the early effects of BMP-4.
Development
122
1996
2385
21
Chen
X
Rubock
MJ
Whitman
M
A transcriptional partner for MAD proteins in TGF-β signalling.
Nature
383
1996
691
22
Winnier
G
Blessing
M
Laborsky
PA
Hogan
BLM
Bone morphogenetic protein-4 (BMP-4) is required for mesoderm formation and patterning in the mouse.
Genes Dev
9
1995
2105
23
Mishina
Y
Suzuki
A
Ueno
N
Behringer
RR
Bmpr encodes a type I bone morphogenetic protein receptor that is essential for gastrulation during mouse embryogenesis.
Genes Dev
9
1995
3027
24
Yamaguchi
TP
Dumont
DJ
Conlon
RA
Breitman
ML
Rossant
J
flk-1, an flt-related receptor tyrosine kinase is an early marker for endothelial precursors.
Development
118
1993
489
25
Bash
R
Hall
S
Timmons
C
Crist
W
Amylon
M
Smith
R
Baer
R
Does activation of the TAL1 gene occur in a majority of patients with T-cell acute lymphoblastic leukemia? A Pediatric Oncology Group study.
Blood
86
1995
666
26
Green
AR
Lints
T
Visvader
J
Harvey
R
Begley
CG
SCL is coexpressed with GATA-1 in hemopoietic cells but is also expressed in developing brain.
Oncogene
7
1992
653
27
Kallianpur
AR
Jordan
JE
Brandt
SJ
The SCL/TAL-1 gene is expressed in progenitors of both the hematopoietic and vascular systems during embryogenesis.
Blood
83
1994
1200
28
Robb
L
Begley
CG
The helix-loop-helix gene SCL: Implicated in T-cell acute lymphoblastic leukaemia and in normal haematopoietic development.
Int J Biochem Cell Biol
28
1996
609
29
Robb
L
Lyons
I
Ruili
L
Hartley
L
Köntgen
F
Harvey
RP
Metcalf
D
Begley
CG
Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene.
Proc Natl Acad Sci USA
92
1995
7075
30
Shivdasani
RA
Mayer
EL
Orkin
SH
Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-1/SCL.
Nature
373
1995
432
31
Porcher
C
Swat
W
Rockwell
K
Fujiwara
Y
Alt
FW
Orkin
SH
The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages.
Cell
86
1996
47
32
Robb
L
Elwood
NJ
Elefanty
AG
Köntgen
F
Li
R
Barnett
LD
Begley
CG
The scl gene product is required for the generation of all hematopoietic lineages in the adult mouse.
EMBO J
15
1996
4123
33
Warren
AJ
Colledge
WH
Carlton
MBL
Evans
MJ
Smith
AJH
Rabbitts
TH
The oncogenic cysteine-rich LIM domain protein Rbtn2 is essential for erythroid development.
Cell
78
1994
45
34
Elefanty
AG
Antoniou
M
Custodio
N
Carmo-Fonseca
M
Grosveld
FG
GATA transcription factors associate with a novel class of nuclear bodies in erythroblasts and megakaryocytes.
EMBO J
15
1996
319
35
Ito
E
Toki
T
Ishihara
H
Ohtani
H
Gu
L
Yokoyama
M
Engel
JD
Yamamoto
M
Erythroid transcription factor GATA-1 is abundantly transcribed in mouse testis.
Nature
362
1993
466
36
Wilkinson
DG
Bhatt
S
Hermann
BG
Expression pattern of the mouse T gene and its role in mesoderm formation.
Nature
343
1990
657
37
Mucenski
ML
McLain
K
Kier
AB
Swerdlow
SH
Schreiner
CM
Miller
TA
Pietryga
DW
Scott
WJ
Potter
SS
A functional c-myb gene is required for normal murine hepatic hematopoiesis.
Cell
65
1991
677
38
Scott
E
Simon
M
Anastasi
J
Singh
H
Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages.
Science
265
1994
1573
39
McKercher
SR
Torbett
BE
Anderson
KL
Henkel
GW
Vestal
DJ
Baribault
H
Klemsz
M
Feeney
AJ
Wu
GE
Paige
CJ
Maki
RA
Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities.
EMBO J
15
1996
5647
40
Tsai
F-Y
Keller
G
Kuo
FC
Weiss
MJ
Chen
J
Rosenblatt
M
Alt
FW
Orkin
SH
An early hematopoietic defect in mice lacking the transcription factor GATA-2.
Nature
371
1994
221
41
Young
PE
Baumhueter
S
Lasky
LA
The sialomucin CD34 is expressed on hematopoietic cells and blood vessels during murine development.
Blood
85
1995
96
42
Bernex
F
De Sepulveda
P
Kress
C
Elbaz
C
Delouis
C
Panthier
J-J
Spatial and temporal patterns of c-kit-expressing cells in W lacZ/+ and W lacZ/W lacZ mouse embryos.
Development
122
1996
3023
43
Anagnostou
A
Lin
Z
Steiner
M
Chin
K
Kessimian
N
Noguchi
CT
Erythropoietin receptor mRNA expression in human endothelial cells.
Proc Natl Acad Sci USA
91
1994
3974
44
Schmitt
RM
Bruyns
E
Snodgrass
HR
Hematopoietic development of embryonic stem cells in vitro: Cytokine and receptor gene expression.
Genes Dev
5
1991
728
45
McClanahan
T
Dalrymple
S
Barkett
M
Lee
F
Hematopoietic growth factor receptor genes as markers of lineage commitment during in vitro development of hematopoietic cells.
Blood
81
1993
2903
46
Matthews
W
Jordan
CT
Wiegand
GW
Pardoll
D
Lemischka
IR
A receptor tyrosine kinase specific to hematopoietic stem and progenitor cell-enriched populations.
Cell
65
1991
1143
47
Rosnet
O
Marchetto
S
deLapeyriere
O
Birnbaum
D
Murine Flt3, a gene encoding a novel tyrosine kinase receptor of the PDGFR/CSF1R family.
Oncogene
6
1991
1641
48
Zmuidzinas
A
Fischer
K-D
Lira
SA
Forrester
L
Bryant
S
Bernstein
A
Barbacid
M
The vav proto-oncogene is required early in embryogenesis but not for hematopoietic development in vitro.
EMBO J
14
1995
1
49
Keller
G
Kennedy
M
Papayannopoulou
T
Wiles
MV
Hematopoietic commitment during embryonic stem cell differentiation in culture.
Mol Cell Biol
13
1993
473
50
Vittet
D
Prandini
M-H
Berthier
R
Schweitzer
A
Martin-Sisteron
H
Uzan
G
Dejana
E
Embryonic stem cells differentiate in vitro to endothelial cells through successive maturation steps.
Blood
88
1996
3424
51
Sitzmann
J
Noben-Trauth
K
Klempnauer
K-H
Expression of mouse c-myb during embryonic development.
Oncogene
11
1995
2273
52
Boehm
T
Foroni
L
Kaneko
Y
Perutz
MF
Rabbits
TH
The rhombotin family of cysteine-rich LIM-domain oncogenes: Distinct members are involved in T-cell translocations to human chromosomes 11p15 and 11p13.
Proc Natl Acad Sci USA
88
1991
4367
53
Royer-Pokora
B
Loos
U
Ludwig
W-D
TTG-2, a new gene encoding a cysteine-rich protein with the LIM motif, is overexpressed in acute T-cell leukaemia with the t(11; 14)(p13; q11).
Oncogene
6
1991
1887
54
Foroni
L
Boehm
T
White
L
Forster
A
Sherrington
P
Liao
XB
Brannan
CI
Jenkins
NA
Copeland
NG
Rabbitts
TH
The rhombotin gene family encode related LIM-domain proteins whose differing expression suggests multiple roles in mouse development.
J Mol Biol
226
1992
747
55
Andrews
NC
Erdjument-Bromage
H
Davidson
MB
Tempst
P
Orkin
SH
Erythroid transcription factor NF-E2 is a haematopoietic-specific basic-leucine zipper protein.
Nature
362
1993
722
56
Lee
M-E
Temizer
DH
Clifford
JA
Quertermous
T
Cloning of the GATA-binding protein that regulates endothelin-1 gene expression in endothelial cells.
J Biol Chem
266
1991
16188
57
Dorfman
DM
Wilson
DB
Bruns
GAP
Orkin
SH
Human transcription factor GATA-2. Evidence for regulation of preproendothelin-1 gene expression in endothelial cells.
J Biol Chem
267
1992
1279
58
Cheng
J
Baumhueter
S
Cacalano
G
Carver-Moore
K
Thibodeaux
H
Thomas
R
Broxmeyer
HE
Cooper
S
Hague
N
Moore
M
Lasky
LA
Hematopoietic defects in mice lacking the sialomucin CD34.
Blood
87
1996
479
59
Weiss
MJ
Keller
G
Orkin
SH
Novel insights into erythroid development revealed through in vitro differentiation of GATA-1− embryonic stem cells.
Genes Dev
8
1994
1184
60
Ting
C-N
Olson
MC
Barton
KB
Leiden
JM
Transcription factor GATA-3 is required for development of the T-cell lineage.
Nature
384
1996
474
61
Soudais
C
Bielinska
M
Heikinheimo
M
MacArthur
CA
Narita
N
Saffitz
JE
Simon
MC
Leiden
JM
Wilson
DB
Targeted mutagenesis of the transcription factor GATA-4 gene in mouse embryonic stem cells disrupts visceral endoderm differentiation in vitro.
Development
121
1995
3877
62
Bielinska
M
Narita
N
Heikinheimo
M
Porter
SB
Wilson
DB
Erythropoiesis and vasculogenesis in embryoid bodies lacking visceral yolk sac endoderm.
Blood
88
1996
3720
63
Okuda
T
van Deursen
J
Hiebert
SW
Grosveld
G
Downing
JR
AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis.
Cell
84
1996
321
64
Wang Q, Stacy T, Binder M, Marı́n-Padilla M, Sharpe AH, Speck NA: Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc Natl Acad Sci USA 93:3444, 1996
65
Sasaki
K
Yagi
H
Bronson
RT
Tominaga
K
Matsunashi
T
Deguchi
K
Tani
Y
Kishimoto
T
Komori
T
Absence of fetal liver hematopoiesis in mice deficient in transcriptional coactivator core binding factor β.
Proc Natl Acad Sci USA
93
1996
12359
66
Wang Q, Stacy T, Miller JD, Lewis AF, Gu T-L, Huang X, Bushweller JH, Bories J-C, Alt FW, Ryan G, Liu PP, Wynshaw-Boris A, Binder M, Marı́n-Padilla M, Sharpe AH, Speck NA: The CBFβ subunit is essential for CBFα2 (AML1) function in vivo. Cell 87:697, 1996
67
Olson
MC
Scott
EW
Hack
AA
Su
GH
Tenen
DG
Singh
H
Simon
MC
PU.1 is not essential for early myeloid gene expression but is required for terminal myeloid differentiation.
Immunity
3
1995
703
68
Henkel
GW
McKercher
SR
Yamamoto
H
Anderson
KL
Oshima
RG
Maki
RA
PU.1 but not Ets-2 is essential for macrophage development from embryonic stem cells.
Blood
88
1996
2917
69
Hoodless
PA
Haerry
T
Abdollah
S
Stapleton
M
O'Connor
MB
Attisano
L
Wrana
JL
MADR1, a MAD-related protein that functions in BMP2 signalling pathways.
Cell
85
1996
489
70
Begley
CG
Visvader
J
Green
AR
Aplan
PD
Metcalf
D
Kirsch
IR
Gough
NM
Molecular cloning and chromosomal localization of the murine homolog of the human helix-loop-helix gene SCL.
Proc Natl Acad Sci USA
88
1991
869
71
Tsai
S-F
Martin
DIK
Zon
L
D'Andrea
AD
Wong
GG
Orkin
SH
Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells.
Nature
339
1989
446
72
Wulf
GM
Adra
CN
Lim
B
Inhibition of haematopoietic development from embryonic stem cells by antisense vav RNA.
EMBO J
12
1993
5065
73
Fennie
C
Cheng
J
Dowbenko
D
Young
P
Lasky
LA
CD34+ endothelial cell lines derived from murine yolk sac induce the proliferation and differentiation of yolk sac CD34+ hematopoietic progenitors.
Blood
86
1995
4454
74
Kuramochi
S
Ikawa
Y
Todokoro
K
Characterization of murine erythropoietin receptor genes.
J Mol Biol
216
1990
567
75
Venturelli
D
Shirsat
N
Gemperlein
I
Bittenbender
S
Hudson
S
Rovera
G
Nucleotide sequence of cDNA for murine myeloperoxidase.
Nucl Acids Res
17
1989
5852
76
Cross
M
Mangelsdorf
I
Wedel
A
Renkawitz
R
Mouse lysozyme M gene: Isolation, characterization, and expression studies.
Proc Natl Acad Sci USA
85
1988
6232