Abstract

The translocation t(12; 21)(p13; q22) is difficult to detect by classic cytogenetics. However, using fluorescence in situ hybridization (FISH) and by screening for the TEL/AML1 rearrangement by the polymerase chain reaction (PCR), it has been demonstrated to be the most frequent known structural chromosomal abnormality in childhood acute lymphoblastic leukemia (ALL). It is closely correlated with a B-cell precursor (BCP) phenotype and is considered a favorable prognostic factor. However, little is known about the incidence of the translocation in relapsed patients and the duration of complete remission (CR) in children expressing the TEL/AML1 fusion gene. We therefore examined 49 bone marrow samples from children with ALL at first or second relapse that were consecutively mailed to our laboratory to test for the presence of t(12; 21) using reverse transcriptase (RT)-PCR. The TEL/AML1 rearrangement could be identified in nine of 44 (20%) of the patients, a result similar to the reported incidence at diagnosis. Most of the TEL/AML1–positive children showed no adverse clinical features at diagnosis (eg, white blood cell [WBC] count <100 × 109/L or age <10 years), and regarding these data, there were no differences versus children who were negative for the fusion gene. However, the period of remission was about 1 year longer in children expressing TEL/AML1 (P = .046), and the majority of relapses in this group appeared late (<2 years after diagnosis). Our findings therefore reinforce the urgent need for further prospective studies with a long follow-up period to determine the true prognostic significance of t(12; 21) and to avoid premature changes of treatment strategies.

THE TRANSLOCATION t(12; 21)(p13; q22), which is difficult to detect by classic cytogenetics (<0.05%), was originally considered a rare abnormality. With the use of additional techniques such as fluorescence in situ hybridization (FISH)1 and reverse transcriptase–polymerase chain reaction (RT-PCR) that identifies the molecular genetic equivalent, the TEL/AML1 rearrangement, more information has become available. The t(12; 21) has been shown to be the most frequent structural chromosomal aberration of childhood acute lymphoblastic leukemia (ALL),2-13 and is rare in adults (1.5%).2,5,7,14,15 This translocation typically occurs in patients between 1 and 10 years of age with a low white blood cell (WBC) count (∼25.0 × 109/L), a B-cell precursor (BCP) phenotype, and nonhyperdiploidy (>50). The reported frequency is between 12% and 36%, with an average of about 25%. Most investigators correlate the appearance of the TEL/AML1 rearrangement with a favorable prognosis, ie, 89% to 100% event-free survival (EFS).2,3,10 

If the presence of the TEL/AML1 rearrangement per se is a good prognostic factor, one might expect a very low incidence of this abnormality at relapse. To our knowledge, no investigation has yet been published exclusively describing children at relapse. There are only two reports8,16 mentioning the t(12; 21) being included among a small number of relapse patients from a larger series of initial leukemia. All of these studies were retrospectively performed and may be biased by selection.

To gain further knowledge about the prognostic meaning of t(12; 21) in childhood ALL, we screened for the TEL/AML1 rearrangement using RT-PCR in bone marrow samples from children with relapse that were consecutively referred to our laboratory, and compared the clinical features of TEL/AML1-positive and -negative children at relapse and at diagnosis.

SUBJECTS AND METHODS

From May to November 1996, 634 bone marrow samples were referred to our laboratory. Forty-nine were from children with relapsed ALL mailed from 26 pediatric centers in Germany. Relapse was diagnosed by criteria described previously.17 Whereas most of the children were initially treated in one of the German multicenter trials (Berlin-Frankfurt-Münster or Cooperative ALL), four of them had received leukemia therapy in Turkey, Kazakhstan, Singapore, or Dubai, respectively.

In this period, 204 ALL patients at diagnosis were successfully analyzed by RT-PCR for the TEL/AML1 rearrangement in a prospective study. The gene fusion was detected in 36, for an incidence of 18% in all cases and 21% in children with BCP-ALL at diagnosis.

RT-PCR. Total RNA was extracted by a single-step method.18 cDNA synthesis using random hexamer primers (Boehringer Mannheim, Germany) was performed in a total volume of 20 μL using a standard protocol.19 Amplification of the chimeric TEL/AML1 gene fragment was performed in a model 9600 thermocycler (Perkin Elmer, Langen, Germany) using a nested PCR protocol. After an initial melting step (1.5 minutes at 94°C), 35 amplification cycles of 15 seconds at 94°C, 45 seconds at 64°C, and 45 seconds at 72°C were performed in a 20-μL final volume containing 1.6 pmol of each outer primer during the first round of PCR. One microliter of the first-round product was subjected to the second round of PCR. This differed from the first round by the number of cycles (which was reduced to 25), the amount of internal primers (8 pmol), and the annealing temperature (60°C). PCR products were analyzed on a 1% agarose gel and visualized by ethidium bromide staining.

To check the integrity of the isolated RNA and the correctness of cDNA synthesis, the ubiquitously expressed ABL gene was amplified in a separate PCR. PCR primer sequences are shown in Table 1.

Table 1.

PCR Primers for Amplification of the Chimeric TEL/AML1 Fragment

Primer Sequence 5′-3′ Orientation 
TEL 
External AGCCCCATCATGCACCCTCTGATCC Sense 
Internal GCAGAATTCCACTCCGTGGATTTCAAACAGTCC Sense 
AML1 
External GTGGTCGGCCAGCACCTCCACC Antisense 
Internal AACGCCTCGCTCATCTTGCCTGGGCTC Antisense 
Primer Sequence 5′-3′ Orientation 
TEL 
External AGCCCCATCATGCACCCTCTGATCC Sense 
Internal GCAGAATTCCACTCCGTGGATTTCAAACAGTCC Sense 
AML1 
External GTGGTCGGCCAGCACCTCCACC Antisense 
Internal AACGCCTCGCTCATCTTGCCTGGGCTC Antisense 

Moreover, at diagnosis, all ALL patients were routinely screened for expression of a BCR/ABL mRNA as reported elsewhere.20 

FISH. For FISH analysis, whole-chromosome paints of chromosomes 12 (wcp12) and 21 (wcp21) were used (Appligene Oncor, Illkirch, France). Hybridization was performed according to the manufacturer's protocol.

Statistics. For statistical evaluation of the association between the clinical data and the appearance of the TEL/AML1 rearrangement, the Mann-Whitney test was used.21 

RESULTS

During a period of 7 months (May to November 1996), 49 bone marrow samples from children with relapsed ALL were consecutively mailed to our laboratory for molecular and cytogenetic analysis of chromosomal aberrations. RT-PCR for BCR/ABL and TEL/AML1 rearrangement was performed for all of them, but failed in three patients because of RNA degradation. Nine of 46 children were positive for the TEL/AML1 rearrangement (19.6%; Fig 1). This was confirmed by FISH with whole-chromosome paints for chromosomes 12 and 21 in seven of nine cases (Table 2). Two patients who were diagnosed and treated abroad were excluded from further evaluation because no data on the initial leukemia were available. However, another patient who had been diagnosed and treated in Turkey as AML was included (patient no. 96256).

Fig. 1.

RT-PCR detection of the TEL/AML1 fusion transcript. Upper panel, TEL/AML1 fusion transcript. Two different sizes of TEL/AML1 products are detectable (242 and 281 bp). To check integrity of the RNA, a 178-bp fragment of ABL was amplified from each patient (bottom panel). Lane M, 123-bp marker; lanes 1 to 9, patients no. 87086, 88615, 89100, 90568, 93437, 94112, 94565, 96526, 96569; lanes 10 to 12, water control for cDNA synthesis, first round of PCR, and second round of PCR; lane 13, positive control, REH cell line.

Fig. 1.

RT-PCR detection of the TEL/AML1 fusion transcript. Upper panel, TEL/AML1 fusion transcript. Two different sizes of TEL/AML1 products are detectable (242 and 281 bp). To check integrity of the RNA, a 178-bp fragment of ABL was amplified from each patient (bottom panel). Lane M, 123-bp marker; lanes 1 to 9, patients no. 87086, 88615, 89100, 90568, 93437, 94112, 94565, 96526, 96569; lanes 10 to 12, water control for cDNA synthesis, first round of PCR, and second round of PCR; lane 13, positive control, REH cell line.

Table 2.

Clinical Data for TEL/AML 1-Positive Patients

Patient No. Sex Initial Leukemia First Relapse Second Relapse 
  Age (yr) Immunophenotype WBC Diagnosis Date TEL/AML1 Therapy CR Relapse Date WBC TEL/AML1 Site Therapy Second CR (yr) Relapse Date Site TEL/AML1 
    (×109/L)    (yr)  (×109/L)        
87086 13.9 c-ALL 46.0 2/18/87 PCR+ BFM 86-RG 3.9 1/4/91 12.0 No mat BM ALL-REZ 90 5.5 7/1/96 BM PCR+ 
88615 3.5 c-ALL 15.6 12/14/88 FISH+ BFM 86-RG 3.6 7/31/92 12.4 PCR+ BM ALL-REZ 90 3.9 6/25/96 BM PCR+ 
89100 3.0 c-ALL 84.9 3/6/89 No mat BFM 86-RG 4.1 3/24/93 3.1 No mat BM ALL-REZ 90 3.5 9/9/96 BM PCR+, FISH+ 
90568 5.6 Pre-B-ALL 6.1 12/20/90 No mat BFM 90-SR 2.5 6/28/93 3.1 PCR+ BM ALL-REZ 90 3.2 8/28/96 BM/T PCR+, FISH+ 
93473 6.3 c-ALL 18.9 9/23/93 PCR+ BFM 90-MR 2.9 8/21/96 8.6 PCR+, FISH+ BM ALL-REZ P95 
94112 3.4 c-ALL 6.7 2/14/94 PCR+ CoALL-05-92-LR 2.7 10/14/96 3.9 PCR+, FISH+ BM ALL-REZ P95 
94565 3.3 c-ALL 5.6 10/5/94 PCR+ CoALL-05-92-HR 2.1 11/1/96 5.0 PCR+, FISH+ BM ALL-REZ P95 
96526 5.9 c-ALL* ND 1/22/93 No mat AML therapy 3.6 9/14/96 9.5 PCR+, FISH+ BM/CNS 
96569 4.1 c-ALL 9.2 9/3/93 No mat BFM 90-SR 3.1 10/7/96 4.3 PCR+, FISH+ BM/CNS ALL-REZ P95 
Patient No. Sex Initial Leukemia First Relapse Second Relapse 
  Age (yr) Immunophenotype WBC Diagnosis Date TEL/AML1 Therapy CR Relapse Date WBC TEL/AML1 Site Therapy Second CR (yr) Relapse Date Site TEL/AML1 
    (×109/L)    (yr)  (×109/L)        
87086 13.9 c-ALL 46.0 2/18/87 PCR+ BFM 86-RG 3.9 1/4/91 12.0 No mat BM ALL-REZ 90 5.5 7/1/96 BM PCR+ 
88615 3.5 c-ALL 15.6 12/14/88 FISH+ BFM 86-RG 3.6 7/31/92 12.4 PCR+ BM ALL-REZ 90 3.9 6/25/96 BM PCR+ 
89100 3.0 c-ALL 84.9 3/6/89 No mat BFM 86-RG 4.1 3/24/93 3.1 No mat BM ALL-REZ 90 3.5 9/9/96 BM PCR+, FISH+ 
90568 5.6 Pre-B-ALL 6.1 12/20/90 No mat BFM 90-SR 2.5 6/28/93 3.1 PCR+ BM ALL-REZ 90 3.2 8/28/96 BM/T PCR+, FISH+ 
93473 6.3 c-ALL 18.9 9/23/93 PCR+ BFM 90-MR 2.9 8/21/96 8.6 PCR+, FISH+ BM ALL-REZ P95 
94112 3.4 c-ALL 6.7 2/14/94 PCR+ CoALL-05-92-LR 2.7 10/14/96 3.9 PCR+, FISH+ BM ALL-REZ P95 
94565 3.3 c-ALL 5.6 10/5/94 PCR+ CoALL-05-92-HR 2.1 11/1/96 5.0 PCR+, FISH+ BM ALL-REZ P95 
96526 5.9 c-ALL* ND 1/22/93 No mat AML therapy 3.6 9/14/96 9.5 PCR+, FISH+ BM/CNS 
96569 4.1 c-ALL 9.2 9/3/93 No mat BFM 90-SR 3.1 10/7/96 4.3 PCR+, FISH+ BM/CNS ALL-REZ P95 

Abbreviations: ND, not determined; no mat, no material available; BM, bone marrow; T, testis; RG, risk group; SR, standard risk; MR, medium risk; LR, low risk; HR, high risk; ALL-REZ, ALL relapse therapy trials; BFM, Berlin-Frankfurt-Münster therapy trials; CoALL, Cooperative ALL therapy trials.

*

Immunophenotype of relapse; this patient was diagnosed and treated in Turkey as AML.

Thirty-two of 44 children had a first relapse and 12 a second relapse. The TEL/AML1 rearrangement was detected at first relapse in five patients, whereas the remaining four had a second relapse. From six of nine positive patients, cryopreserved bone marrow from diagnosis and/or first relapse was available. A retrospectively performed RT-PCR or FISH analysis confirmed the presence of the TEL/AML1 fusion gene in all of them (Table 2).

The clinical data at initial diagnosis of the children with TEL/AML1 rearrangement showed a sex ratio of 1.25, a median age at diagnosis of 4.1 years, and a median WBC count of 12.4 × 109/L (Table 3). Flow cytometric data were only available for 13 children, including one positive for TEL/AML1. Only one TEL/AML1-negative patient showed a DNA index more than 1.16 (data not shown). In all of the TEL/AML1-positive patients, BCP-ALL was diagnosed either as common (n = 8) or pre-B-ALL (n = 1), whereas the negative group included two with pre-B-ALL and six with T-ALL.

Table 3.

Clinical Data for TEL/AML1-Positive Children at Relapse Compared With TEL/AML1-Negative Patients With c- and Pre-B-ALL and All Negative Patients at Relapse

Parameter TEL/AML1-Positive TEL/AML1-Negative Pre-B-/c-ALL Total 
 
Sex ratio (M:F), P = .99/.7 5:4 (1.25) 12:10 (1.2) 23:12 (1.9) 
Age at diagnosis (yr),P = .86/.25 
22 35 
Range 3-13.94 0.7-15.6 0.7-16.3 
Median 4.1 4.8 7.4 
WBC initial (×109/L),P = .99/.67 
17 25 
Range 5.6-84.9 2.5-79.4 2.5-96.8 
Median 12.4 13.6 16.4 
Risk factor, P = .80/.87 
13 21 
Range 0.65-1.44 0.47-1.81 0.47-1.82 
Median 1.05 1.07 1.07 
Risk 
<0.8 
≥0.8 11 18 
Coexpression at diagnosis, P = .68/.49 
None 11 15 
1 marker 
2 markers 
Immunophenotype 
Pro-B  
Pre-B 
Common 18 18 
  
Unknown   
WBC relapse (×109/L),P = .88/.74 
22 32 
Range 3.1-12.4 0.8-23.2 0.7-77.5 
Median 5.0 5.7 5.4 
Timepoint of relapse,P = .045/.041 
Very early 11 
Early 
Late 15 
First CR (yr), P = .078/.046 
22 35 
Range 2.1-4.0 0.3-9.4 0.3-9.9 
Median 3.1 2.3 2.3 
Second CR (yr) 
Range 3.2-5.5 0.2-4.2 0.2-4.2 
Median 3.7 2.3 3.0 
Site of first relapse 
BM 11 22 
BM + CNS 
BM + testis  
CNS  
Testis  
Unknown   
Status, P = .31/.24 
Alive 12 17 
CCR  14 
Dead 
Parameter TEL/AML1-Positive TEL/AML1-Negative Pre-B-/c-ALL Total 
 
Sex ratio (M:F), P = .99/.7 5:4 (1.25) 12:10 (1.2) 23:12 (1.9) 
Age at diagnosis (yr),P = .86/.25 
22 35 
Range 3-13.94 0.7-15.6 0.7-16.3 
Median 4.1 4.8 7.4 
WBC initial (×109/L),P = .99/.67 
17 25 
Range 5.6-84.9 2.5-79.4 2.5-96.8 
Median 12.4 13.6 16.4 
Risk factor, P = .80/.87 
13 21 
Range 0.65-1.44 0.47-1.81 0.47-1.82 
Median 1.05 1.07 1.07 
Risk 
<0.8 
≥0.8 11 18 
Coexpression at diagnosis, P = .68/.49 
None 11 15 
1 marker 
2 markers 
Immunophenotype 
Pro-B  
Pre-B 
Common 18 18 
  
Unknown   
WBC relapse (×109/L),P = .88/.74 
22 32 
Range 3.1-12.4 0.8-23.2 0.7-77.5 
Median 5.0 5.7 5.4 
Timepoint of relapse,P = .045/.041 
Very early 11 
Early 
Late 15 
First CR (yr), P = .078/.046 
22 35 
Range 2.1-4.0 0.3-9.4 0.3-9.9 
Median 3.1 2.3 2.3 
Second CR (yr) 
Range 3.2-5.5 0.2-4.2 0.2-4.2 
Median 3.7 2.3 3.0 
Site of first relapse 
BM 11 22 
BM + CNS 
BM + testis  
CNS  
Testis  
Unknown   
Status, P = .31/.24 
Alive 12 17 
CCR  14 
Dead 

P values are given for TEL/AML1-positive v TEL/AML1-negative (pre-B/c-ALL)/TEL/AML1-positive v TEL/AML1-negative (total). The risk factor (RF) used for stratification in the therapy trial ALL-BFM is an estimation of the leukemic cell mass, and is calculated by the equation, RF = 0.2 × log (no. of blasts/μL) + 0.06 × liver (cm*) + 0.04 × spleen (cm*) (*below the costal margin).23 

There were no significant differences in clinical features at diagnosis between BCP patients with and without the TEL/AML1 rearrangement (Table 3). However, the interval for first and also second remission was approximately 1 year longer in TEL/AML1-positive children, and relapse occurred not earlier than 2 years after the start of therapy. These findings were significantly different (P = .046) versus those for the total TEL/AML1-negative group, but not compared with those for BCP patients negative for TEL/AML1 (P = .078). Whereas more than half of the children (59%) with BCP-ALL in the TEL/AML1-negative group relapsed early* or very early, only one of nine children with the rearrangement had an early relapse (P = .045/.041). Nearly 80% of relapses in the latter group involved the bone marrow, and only two involved both bone marrow and the central nervous system (CNS). In contrast, the incidence of CNS or testicular relapse as a single or combined relapse was much higher (50%) among the c-/pre-B-ALL patients negative for the t(12; 21) rearrangement.

DISCUSSION

The TEL/AML1 rearrangement has been described as a frequent and specific abnormality associated with childhood BCP-ALL and seems to be correlated with a good prognosis.2-10 Only two reports have described the finding of this abnormality in relapse patients in a very small series, 13 and 16 patients, respectively.8,16 These results are divergent, with the incidence of the TEL/AML1 rearrangement being 31% and 19%, probably due to the small number of patients. In our analysis of bone marrow samples of 49 consecutive children with relapsed ALL, we found a frequency of 19.6%. This incidence is similar to that reported for diagnosis in hitherto retrospective studies, as well as a recent prospective German-Italian analysis.10 

On comparing the clinical features at diagnosis, it became obvious that among TEL/AML1-positive children there were no exceptional distinguishing features. All had BCP-ALL, the age was between 2 and 10 years in eight of nine, and they had a low initial blood WBC count (median, 12.4 × 109/L). There were also no differences when compared with the group of relapsed BCP patients without the TEL/AML1 fusion gene or with the published data.

However, the median remission duration was about 1 year longer in TEL/AML1-positive children, and none of them relapsed earlier than 2 years after diagnosis. In contrast, treatment failures in the TEL/AML1-negative group occurred early or very early in more than half of the patients. The difference between TEL/AML1-positive and -negative children is significant (Table 3), but must be verified in a large series of patients. However, similar findings have been reported by others. In the German-Italian study, two of three relapses occurred late,10 and two patients from another Italian study had events after 22 and 31 months, respectively.22 Another three children analyzed at relapse8 had a remission duration completely concordant with our data. The investigators reported one child who was not adequately treated but nevertheless had a complete remission (CR) of 2.7 years, whereas two others had an EFS time of 4.7 and 6.7 years, respectively. Similarly in our study, there was one girl treated initially for AML, but she obtained a CR and had a disease-free interval of 3.6 years.

To date, contradictory results have been reported concerning the prognosis, ranging between an excellent (100% to 92%)2,3,10 and a normal outcome, versus others where two relapses of 11 patients (18%)22 and seven of 24 (29%)16 have been described. However, in all larger studies,2,3,10 a very good prognosis could be demonstrated, whereas the smaller studies have a higher percentage of treatment failures. All of these studies were performed retrospectively and consequently have undergone selection for several criteria.

The reason for the high incidence of rearrangement of TEL/AML1 among patients with relapse in the present study is not yet clear. Contamination of the PCR was excluded by parallel control experiments by FISH in seven of nine, and the remaining two children showed the fusion gene at diagnosis. It is unlikely that the rearrangement was acquired during treatment, since on earlier samples for five of nine patients a retrospective PCR or FISH analysis could be performed and the fusion gene was detected in all of them.

The high frequency of relapses might also be due to insufficient therapy. However, eight of nine patients in this study were treated in one of the German multicenter trials (Table 3): ALL-BFM-86 (n = 3; EFS of the risk group, 75%),23 ALL-BFM-90 (n = 3; EFS of the standard-risk and medium-risk groups, 75%)24 (M. Schrappe, personal communication, May 1992), and CoALL-05-92 (n = 2; EFS of the low-risk group and high-risk group, 85% and 73%)25 (G. Janka-Schaub, personal communication, May 1992; Table 2). The outcome for children treated by these protocols does not differ much from other successful regimens.26,27 Whether differences in therapy protocols, eg, the treatment intensity or the use of cranial irradiation with its known associated morbidity and controversial late effects,28-32 are responsible for the better outcome of TEL/AML1-positive patients is not yet clear. This will only be clarified by performing large long-term prospective studies, which should be critically analyzed before changes in treatment modalities are considered.

The high incidence of TEL/AML1-positive children among relapse patients may imply that the appearance of the TEL/AML1 fusion gene per se is not a good prognostic factor. However, there are no clinical features to identify the patients at risk of relapse. Since relapses in this group appear to be late events, these children should be studied for minimal residual disease using PCR to monitor disease development and consequently to identify relapse at an early stage.5,8,11,22 

Nevertheless, if about 20% of all ALL relapses are positive for the TEL/AML1 rearrangement, more long-term prospective studies including a substantial number of patients at diagnosis and relapse are urgently needed. Only after more prognostic information is available should possible changes in treatment strategies for these children be discussed.

ACKNOWLEDGMENT

For excellent technical assistance, we are indebted to Andrea Richter and Christina Böth for the molecular genetics and to Andrea Kretschmann for help with the data management. We thank Dr Rosalyn Slater, Rotterdam, The Netherlands, for critically reviewing the manuscript, and Dr Martin Zimmermann, Hannover, Germany, for the statistical analyses. Finally, we are very grateful to our colleagues from many pediatric oncologic centers outside of Giessen who supplied us with bone marrow samples from their patients.

Supported by the Deutsche Krebshilfe-Mildred-Scheel-Stiftung, Forschungshilfe Station Peiper, and Parents Initiative Giessen.

Address reprint requests to F. Lampert, MD, Department of General Pediatrics/Hematology and Oncology, Justus-Liebig University Giessen, Feulgenstr. 12, D-35392 Giessen, Germany.

REFERENCES

REFERENCES
1
Romana
SP
Le Coniat
M
Berger
R
t(12; 21): A new recurrent translocation in acute lymphoblastic leukemia.
Genes Chromosomes Cancer
9
1994
186
2
McLean
TW
Ringold
S
Neuberg
D
Stegmaier
K
Tantravahi
R
Ritz
J
Koeffler
HP
Takeuchi
S
Janssen
JWG
Seriu
T
Bartram
CR
Sallan
SE
Gilliland
DG
Golub
TR
TEL/AML-1 dimerizes and is associated with a favourable outcome in childhood acute lymphoblastic leukemia.
Blood
88
1996
4252
3
Shurtleff
SA
Buijs
A
Behm
FG
Rubnitz
JE
Raimondi
SC
Hancock
ML
Chan
GCF
Pui
CH
Grosveld
G
Downing
JR
TEL/AML1 fusion resulting from a cryptic t(12; 21) is the most common genetic lesion in pediatric ALL and defines a subgroup of patients with an excellent prognosis.
Leukemia
9
1995
1985
4
Raynaud
S
Cavé
H
Baens
M
Bastard
C
Cacheux
V
Grosgeorge
J
Guidal-Giroux
C
Guo
C
Vilmer
E
Marynen
P
Grandchamp
B
The 12; 21 translocation involving TEL and deletion of the other TEL allele: Two frequently associated alterations found in childhood acute lymphoblastic leukemia.
Blood
87
1996
2891
5
Cayuela
JM
Baruchel
A
Orange
C
Madani
A
Auclerc
MF
Daniel
MT
Schaison
G
Sigaux
F
TEL/AML1 fusion RNA as a new target to detect minimal residual disease in pediatric B-cell precursor acute lymphoblastic leukemia.
Blood
88
1996
302
6
Liang
DC
Chou
TB
Chen
JS
Shurtleff
SA
Rubnitz
JE
Downing
JR
Pui
CH
Shih
LY
High incidence of TEL/AML1 fusion resulting from a cryptic t(12; 21) in childhood B-lineage acute lymphoblastic leukemia in Taiwan.
Leukemia
10
1996
991
7
Kobayashi
H
Satake
N
Maseki
N
Sakashita
A
Kaneko
Y
The der(21)t(12; 21) chromosome is always formed in a 12; 21 translocation associated with childhood acute lymphoblastic leukaemia.
Br J Haematol
94
1996
105
8
Nakao
M
Yokota
S
Horiike
S
Taniwaki
M
Kashima
K
Sonoda
Y
Koizumi
S
Takaue
Y
Matsushita
T
Fujimoto
T
Misawa
S
Detection and quantification of TEL/AML1 fusion transcripts by polymerase chain reaction in childhood acute lymphoblastic leukemia.
Leukemia
10
1996
1463
9
Fears
S
Vignon
C
Bohlander
SK
Smith
S
Rowley
JD
Nucifora
G
Correlation between the ETV6/CBFA2 (TEL/AML1) fusion gene and karyotypic abnormalities in children with B-cell precursor acute lymphoblastic leukemia.
Genes Chromosomes Cancer
17
1996
127
10
Borkhardt A, Cazzangia G, Ludwig W-D, Mangioni S, Burci L, Schrappe M, Valsecchi MG, Riehm H, Lampert F, Basso G, Masera G, Harbott J, Biondi A: Does the TEL/AML1 expression define a subgroup of good prognosis? The results of the German (BFM) and Italian (AIEOP) ALL study group. Blood 88:451a, 1996 (abstr, suppl 1)
11
Chambost H, Michel G, Thuret I, Toiron Y, Brunet C, Capodano AM, Sainty D, Maraninchi D, Gabert J: TEL/AML1 transcript in childhood acute lymphoblastic leukemia: A new candidate for minimal residual disease study rather than a new prognosis factor? Br J Haematol 93:55, 1996 (abstr)
12
Rubnitz JE, Shuster JJ, Land VJ, Link MP, Pullen DJ, Camitta BM, Pui C-H, Downing JR, Behm FG: Case-control study of children with acute lymphoblastic leukemia confirms the favorable impact of TEL gene rearrangements: A Pediatric Oncology Group Study. Blood 88:450a, 1996 (abstr, suppl 1)
13
Romana
SP
Poirel
H
Leconiat
M
Flexor
M-A
Mauchauffé
M
Jonveaux
P
Macintyre
EA
Berger
R
Bernard
OA
High frequency of t(12; 21) in childhood B-lineage acute lymphoblastic leukemia.
Blood
86
1995
4263
14
Raynaud
S
Mauvieux
L
Cayuela
JM
Bastard
C
Bilhou-Nabera
C
Debuire
B
Bories
D
Boucheix
C
Charrin
C
Fière
D
Gabert
J
TEL/AML1 fusion gene is a rare event in adult acute lymphoblastic leukemia.
Leukemia
10
1996
1529
15
Shih
LY
Chou
TB
Liang
DC
Tzeng
YS
Rubnitz
JE
Downing
JR
Pui
CH
Lack of TEL/AML1 fusion transcript resulting from a cryptic t(12; 21) in adult B lineage acute lymphoblastic leukemia in Taiwan.
Leukemia
10
1996
1456
16
Chambost H, Michel G, Thuret I, Toiron Y, Brunet C, Capodano AM, Perrimond H, Gabert J: TEL/AML1 transcript may not be an independent prognostic factor in childhood acute lymphoblastic leukemia. Blood 88:72a, 1996 (abstr, suppl 1)
17
van der Does-van den Berg A
Bartram
CR
Basso
G
Benoit
Y
Biondi
A
Debatin
K
Haas
OA
Harbott
J
Kamps
WA
Köller
U
Lampert
F
Ludwig
W-D
Niemeyer
CM
van Wering
ER
Minimal demands for the diagnosis, the classification and the evaluation of treatment results of childhood acute lymphoblastic leukemia (ALL) in the “BFM-Family” Co-operative Group.
Med Pediatr Oncol
20
1992
497
18
Chomczynski
P
Sacchi
N
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162
1987
156
19
Sambrock J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989
20
Schlieben
S
Borkhardt
A
Reinisch
I
Ritterbach
J
Janssen
JWG
Ratei
R
Schrappe
M
Repp
R
Zimmermann
M
Kabisch
H
Janka-Schaub
G
Bartram
CR
Ludwig
WD
Riehm
H
Lampert
F
Harbott
J
Incidence and clinical outcome of children with BCR/ABL-positive acute lymphoblastic leukemia (ALL). A prospective RT-PCR study based on 673 patients enrolled in the German pediatric multicenter therapy trials ALL-BFM-90 and CoALL-05-92.
Leukemia
10
1996
957
21
Mann
HB
Whitney
DR
On a test of whether one of two random variables is stochastically larger than the other.
Ann Math Stat
18
1947
50
22
Lanza C, Volpe G, Basso G, Gottardi E, Barisone E, Perfetto F, Madon E, Saglio G: Reappearance of the TEL/AML1 transcript during molecular follow-up of t(12; 21) ALL is predictive of clinical relapse. Blood 88:72a, 1996 (abstr, suppl 1)
23
Reiter
A
Schrappe
M
Ludwig
W-D
Hiddemann
W
Sauter
S
Henze
G
Zimmermann
M
Lampert
F
Havers
W
Niethammer
D
Odenwald
E
Ritter
J
Mann
G
Welte
K
Gadner
H
Riehm
H
Chemotherapy in 998 unselected childhood acute lymphoblastic leukemia patients. Results and conclusions of the multicenter trial ALL-BFM 86.
Blood
84
1994
3122
24
Schrappe
M
Reiter
A
Sauter
S
Ludwig
W-D
Wörmann
B
Harbott
J
Bender-Götze
C
Dörffel
W
Dopfer
R
Frey
E
Havers
W
Henze
G
Kühl
J
Richter
R
Ritter
J
Treuner
J
Zintl
F
Odenwald
E
Welte
K
Riehm
H
Conception and interim analysis of trial ALL-BFM 90 for the treatment of children and adolescents with acute lymphoblastic leukemia: Significance of therapy response in peripheral blood and bone marrow.
Klin Padiatr
206
1994
208
25
Janka-Schaub
G
Harms
D
Goebel
U
Graubner
U
Gutjahr
P
Haas
RJ
Jürgens
H
Spaar
HJ
Winkler
K
Randomized comparison of rotational chemotherapy in high-risk acute lymphoblastic leukemia of childhood — Follow-up after 9 years.
Eur J Pediatr
155
1996
640
26
Niemeyer
CM
Reiter
A
Riehm
H
Donnelly
M
Gelber
RD
Sallan
SE
Comparative results of two intensive treatment programs for childhood lymphoblastic leukemia: The Berlin-Frankfurt-Münster and Dana-Farber Cancer Institute protocols.
Ann Oncol
2
1991
745
27
Schorin
MA
Blattner
S
Gelber
RD
Tarbell
NJ
Donnelly
M
Dalton
V
Cohen
HJ
Sallan
SE
Treatment of childhood acute lymphoblastic leukemia: Results of Dana-Farber Cancer Institute/Children's Hospital Acute Lymphoblastic Leukemia Consortium Protocol 85-01.
J Clin Oncol
12
1994
740
28
Ueberall
MA
Wenzel
D
Hertzberg
H
Langer
T
Meier
W
Berger-Jones
K
Huk
WJ
Neuhäuser
G
Lampert
F
Beck
JD
Korinthenberg
R
for the German Late Effects Working Group
CNS late effects after therapy in childhood. II. Conventional EEG recordings in asymptomatic long-term survivors of childhood ALL — An evaluation of the interferences between neurophysiology, neurology, psychology, and CNS morphology.
Med Pediatr Oncol
29
1997
121
29
Brouwers
P
Poplack
D
Memory and learning sequelae in long-term survivors of acute lymphoblastic leukemia: Association with attention deficits.
Am J Pediatr Hematol Oncol
12
1990
174
30
Chessells
JM
Cox
TC
Kendall
B
Cavanagh
NP
Jannoun
L
Richards
S
Neurotoxicity in lymphoblastic leukaemia: Comparison of oral and intramuscular methotrexate and two doses of radiation.
Arch Dis Child
65
1990
416
31
Ochs
J
Mulhern
R
Long-term sequelae of therapy for childhood acute lymphoblastic leukaemia.
Baillieres Clin Haematol
7
1994
365
32
Ochs
J
Mulhern
R
Fairclough
D
Parvey
L
Whitaker
J
Ch'ien
L
Mauer
A
Simone
J
Comparison of neuropsychologic functioning and clinical indicators of neurotoxicity in long-term survivors of childhood leukemia given cranial radiation or parenteral methotrexate: A prospective study.
J Clin Oncol
9
1991
145