Antisense oligodeoxyribonucleotides (ODNs) are now being extensively investigated in an attempt to achieve cell growth suppression through specific targeting of genes related to cell proliferation, despite increasing evidence of non-antisense cytotoxic effects. In the context of anti-BCR/ABL antisense strategies in chronic myeloid leukemia, we have re-examined the antiproliferative effect of phosphodiester and phosphorothioate ODNs on the leukemic cell line BV173 and on CD34+ bone marrow cells in liquid culture. The 3′ sequences of the ODNs determine their effect. At concentrations of 10 μmol/L (for phosphorothioate ODNs) or 25 μmol/L (for phosphodiester ODNs), all the tested ODNs exert an antiproliferative activity, except those that contain a cytosine residue at either their two most terminal 3′ positions. We show that this antiproliferative effect is due to the toxicity of the d-NMPs (5′ monophosphate deoxyribonucleosides), the enzymatic hydrolysis products of the ODNs in culture medium. The toxicity of the d-NMPs on hematologic cells depends on their nature (d-CMP [2′deoxycytidine 5′-monophosphate] is not cytotoxic), on their concentration (d-GMP [2′-deoxyguanosine 5′-monophosphate], TMP [thymidine 5′-monophosphate], and d-AMP [2′-deoxyadenosine 5′-monophosphate] are cytotoxic at concentrations between 5 and 10 μmol/L), and on the coincident presence of other d-NMPs in the culture medium (d-CMP neutralizes the toxicity of d-AMP, d-GMP, or TMP). The antiproliferative activity of ODNs is thus restricted to conditions where the 3′ hydrolysis process by exonucleases generates significant amounts of d-NMPs with a low proportion of d-CMP. Our results reveal a novel example of a nonantisense effect of ODNs, which should be taken into account when performing any experiment using assumed antisense ODNs.

AN INCREASING number of publications are now pointing out the difficulty in interpreting the oligodeoxyribonucleotides (ODN)-mediated antisense studies.1-6 Many biological effects of ODNs cannot be attributed to sequence-specific inhibition of genetic expression. The aptameric properties of ODNs (sequence-specific interactions between ODNs and molecules other than nucleic acids) may be responsible for some biological effects.7-9 The non-sequence-specific binding of ODNs, which are polyanions, to proteins may disturb important physiological processes.10,11 The degradation products of the ODNs may also induce effects.2 

We recently analyzed12 the effect of antisense phosphodiester ODNs,13-33 complementary to the junctional region of the BCR/ABL mRNA,34-39 on the proliferation of leukemic cells and cell lines. Using numerous control ODNs (sense, mismatched, scrambled, and random control sequences), we have shown that the ODN induced antiproliferative result is a sequence-specific but non-antisense effect. We have further observed that this effect is not leukemia-specific. A “TAT” triplet at the 3′ end of the ODN sequences was found to be sufficient to induce an antiproliferative effect, regardless of the remaining bases.

In this study, we analyzed the mechanism responsible for this sequence-specific effect of phosphodiester ODNs on the leukemic BV173 cell line and on CD34+ bone marrow cells in tissue culture. We also examined whether, under similar experimental conditions, the reported antiproliferative effect of anti-BCR/ABL phosphorothioate ODNs21 can also be assigned to their terminal 3′ sequences.

MATERIALS AND METHODS

Chemicals.d-AMP (2′-deoxyadenosine 5′-monophosphate), d-CMP (2′-deoxycytidine 5′-monophosphate), d-GMP (2′-deoxyguanosine 5′-monophosphate) and TMP (thymidine 5′-monophosphate), all for laboratory use (purity 98%), were obtained from Sigma Chemical Co (St Louis, MO). Sodium chloride (analysis grade), tris-hydroxymethylaminomethane (for molecular biology) and acetonitrile (for chromatography) were purchased from Merck (Darmstadt, Germany). Ammonium hydroxide (28% to 30% wt/vol, analysis grade) was purchased from Acros Organics (Geel, Belgium). Absolute ethyl alcohol (analysis grade) was obtained from UCB (Leuven, Belgium). RPMI 1640 culture medium and fetal calf serum (FCS), both for cell culture, were from GIBCO-BRL (Scotland, UK). Normal human serum (NHS) was obtained from the blood of healthy donors.

ODNs.Phosphodiester, phosphorothioate, and chimeric phosphodiester/phosphorothioate ODNs were synthesized on an automated DNA synthesizer (Cyclone Plus DNA synthesizer or Expedite 8909 DNA/RNA synthesizer, MilliGen/Biosearch, Millipore, Burlington, MA) using the β-cyanoethyl phosphoramidite chemistry, according to the manufacturer's protocols. After synthesis, the ODNs were cleaved from their solid support and deblocked in 30% ammonium hydroxide at 55°C for 16 hours. The phosphodiester and chimeric ODNs were purified by anion exchange chromatography40 (column MONO Q HR 5/5; Pharmacia, Uppsala, Sweden) or Protein-Pack Q 8HR, Waters, Milford, MA) and desalted (NAP columns; Pharmacia Biotech, Uppsala, Sweden). Phosphodiester and chimeric phosphodiester/phosphorothioate ODNs were evaluated from analytical high-performance liquid chromatography (HPLC) (see conditions below) to be >95% full-length material. Phosphorothioate ODNs were purified on reverse phase column (column pep RPC, Pharmacia) via DMT-ON (5′-O-dimethoxytrityl-on) procedure, according to the manufacturer's protocol. Fully deprotected phosphorothioate ODNs were then precipitated twice from a 0.5 mol/L NaCl solution with 2.5 volumes ethanol, and then desalted (NAP columns; Pharmacia Biotech). Purified phosphorothioate ODNs were greater than 95% full-length material as determined by polyacrylamide gel electrophoresis. Some of the ODNs were kindly supplied by GENSET (Paris, France) or EUROGENTEC (Liège, Belgium) and were purified by the procedures described above. The ODNs were stored in water at −20°C. Different batches of ODNs from different origins were used to avoid effects due to a particular synthesis and/or purification.

HPLC analysis.HPLC analyses were performed on a Waters instrument, equipped with a 625 PEEK solvent delivery system, a 717 autosampler, a 486 UV detector set to 260 nm, and a Digital Celebris FP 590 computer (Maynard, MA). The Millenium 2.1 software (Waters) was used to drive the instruments and to analyze the chromatograms. The chromatography of the ODN samples was performed on an anion exchange column (NucleoPac PA-100 and NucleoPac PA-100 Guard columns; Dionex, Sunnyvale, CA) using a gradient of NaCl (10 mmol/L NaCl/min) in 25 mmol/L Tris-HCl, pH 8.0, with a flow of 1.5 mL/min. The duration of the gradient (typically 20 minutes) and the salt concentration at the start of elution (typically 300 mmol/L NaCl) were adapted to the test samples.

Kinetics of ODN degradation in cell culture media.Phosphodiester or chimeric phosphodiester/phosphorothioate ODNs were incubated at 37°C at a concentration of 25 μmol/L in RPMI 1640 medium containing 2.5% NHS or 10% FCS. Samples were collected at various time intervals during incubation. After addition of an internal standard (a 23-mer phosphodiester ODN), the samples were stored immediately at −20°C. Before HPLC analysis (see conditions above), the crude samples were filtrated on low-binding regenerated cellulose Ultrafree-MC units (10,000 NMWL Filter Unit; Millipore). The area of each chromatographic signal (measured at 260 nm) was normalized to the area of the internal standard.

Cell line.The human leukemia cell line BV17341 was maintained by serial passages (twice weekly) in RPMI 1640 medium supplemented with 10% FCS, 2 mmol/L L-glutamine (GIBCO-BRL), 100 μg/mL streptomycin (Diamant, Compiègne, France) and 100 IU/mL penicillin (Continental Pharma, Brussels, Belgium). Cells were incubated at 37°C in 100-mL tissue culture flasks in a humidified atmosphere with 5% CO2. The cell line was controlled by reverse transcription-polymerase chain reaction for the expression of the normal ABL and BCR genes and of the b2a2 BCR/ABL fusion gene, as previously described.42 

ODN and d-NMP treatment of cell line.Cells in their exponential phase of growth were washed with RPMI 1640 medium, and resuspended in RPMI 1640 containing 2.5% NHS, at a concentration of 105 cells/mL. The cell suspension was distributed into 2-mL aliquots. The lyophilized ODNs (20 nmol for phosphorothioate ODNs and 50 nmol for phosphodiester) were dissolved in cell suspensions, or d-NMPs (20 to 100 μL of 2.5 to 0.1 mmol/L d-NMP solutions in RPMI 1640) were added to the cell suspensions at once, at time 0 of each experiment. No further addition of d-NMPs was made. Viable cell number was determined every 24 hours on 100-μL aliquots using a trypan blue dye exclusion test in a Bürker hemocytometer. The control consisted of cells undergoing the same procedure, without addition of ODNs or d-NMPs.

Separation of normal CD34+ cells.Bone marrow cells from 3 healthy donors were separated by density gradient centrifuging at 600g for 20 minutes using a lymphocyte separation medium (International Medical Belgium, Brussels, Belgium). The samples were enriched in CD34+ cells using a Ceprate LC34 column (CellPro, Bothell, WA), according to the manufacturer's instructions. The CD34+ fractions were resuspended at a cell concentration of 105 cell/mL in RPMI 1640 containing 2.5 % NHS, 2 mmol/L L-glutamine, 50 ng/mL rhu-IL-3 (Sandoz, Basel, Switzerland), 20 ng/mL rhu-SCF (Immunex, Seattle, WA) and 100 ng/mL rhu-IL-6 (Sandoz). The cell suspensions were then distributed into 2-mL aliquots which were used for the ODN and d-NMP incubation experiments after 24 hours of growth. ODNs or d-NMPs were added to the cell suspensions at once. No further addition of d-NMPs was made.

ODN and d-NMP treatment of marrow cells.The lyophilized ODNs (20 nmol for phosphorothioate ODNs and 50 nmol for phosphodiester ODNs) were dissolved in the bone marrow cell suspensions. d-NMPs (20 to 100 μL from 2.5 to 0.1 mmol/L d-NMP solutions in RPMI 1640) were added to the marrow cell suspensions. The cells were counted every 24 hours for 4 days using the trypan blue dye exclusion test. The control consisted of cells undergoing the same procedure, without addition of ODNs or d-NMPs.

RESULTS

Sequence specificity and antiproliferative effect on the BV173 cell line.We incubated the BV173 cell line with the 18 mer phosphodiester ODNs PO1 to PO12 presented in Table 1. The ODN PO1 was synthesized with a sequence complementary to the b2a2 junction of the BCR/ABL mRNA. The ODNs PO2 to PO9 were designed with their sequence identical to PO1 except for a one base change at one of the three last 3′ positions. The ODNs PO10 and PO11 were constructed with the same base composition but not the same sequence as PO1. PO12 had a sequence complementary to PO1. All the experiments were performed at an ODN concentration of 25 μmol/L and in a culture medium supplemented with 2.5% NHS. As previously reported,12 under such conditions, the ODNs containing a TAT at their 3′ end, such as PO1, generated an antiproliferative effect, after 72 hours of incubation with the cells. As reported in Table 2 and in Fig 1, all the tested ODNs showed the same antiproliferative effect, except those containing a cytosine residue at either their two most terminal positions.

Table 1.

ODNs Used in This Study

ODN Sequence (5′-3′) Half-Life (Hour) 
  2.5% NHS 10% FCS 
PO1 GAAGGGCTTCTTCCTTAT 22 ± 3 <1 
PO2 GAAGGGCTTCTTCCTTCT 38 ± 4 <1 
PO3 GAAGGGCTTCTTCCTTGT 19 ± 1  
PO4 GAAGGGCTTCTTCCTTTT 17 ± 1  
PO5 GAAGGGCTTCTTCCTTAA   
PO6 GAAGGGCTTCTTCCTCAT 24 ± 1  
PO7 GAAGGGCTTCTTCCTGAT 29 ± 2  
PO8 GAAGGGCTTCTTCCTTAC 32 ± 1  
PO9 GAAGGGCTTCTTCCTTAG 47 ± 2  
PO10 AGTCTTGCATCGTCTTGA   
PO11 ATTCTGTGAAGTCCTTGC   
PO12 ATAAGGAAGAAGCCCTTC 37 ± 4  
PO13 TTTTTTTTTTTTTTTTTT 12 ± 1  
PO14 CCCCCCCCCCCCCCCCCC >72 
PO/PS1 GAAGGGCTTCTTCCTTA(Ps)T >100 15 ± 1 
PO/PS2 GAAGGGCTTCTTCCTT(pS)AT 23 ± 4 <1 
PO/PS3 GAAGGGCTTCTTCCT(pS)TAT 25 ± 2 <1 
PS1 CGCTGAAGGGCTTCTTCCTTATTGAT 
PS2 ATCAATAAGGAAGAAGCCCTTCAGCG 
PS3 CGCTGAAGGGCTTTTGAACTCTGCTT 
PS4 AAGCAGAGTTCAAAAGCCCTTCAGCG 
PS5 CGCTGAAGGGCTTCTTCCTTATTGCG 
PS6 ATCAATAAGGAAGAAGCCCTTCAGAT 
ODN Sequence (5′-3′) Half-Life (Hour) 
  2.5% NHS 10% FCS 
PO1 GAAGGGCTTCTTCCTTAT 22 ± 3 <1 
PO2 GAAGGGCTTCTTCCTTCT 38 ± 4 <1 
PO3 GAAGGGCTTCTTCCTTGT 19 ± 1  
PO4 GAAGGGCTTCTTCCTTTT 17 ± 1  
PO5 GAAGGGCTTCTTCCTTAA   
PO6 GAAGGGCTTCTTCCTCAT 24 ± 1  
PO7 GAAGGGCTTCTTCCTGAT 29 ± 2  
PO8 GAAGGGCTTCTTCCTTAC 32 ± 1  
PO9 GAAGGGCTTCTTCCTTAG 47 ± 2  
PO10 AGTCTTGCATCGTCTTGA   
PO11 ATTCTGTGAAGTCCTTGC   
PO12 ATAAGGAAGAAGCCCTTC 37 ± 4  
PO13 TTTTTTTTTTTTTTTTTT 12 ± 1  
PO14 CCCCCCCCCCCCCCCCCC >72 
PO/PS1 GAAGGGCTTCTTCCTTA(Ps)T >100 15 ± 1 
PO/PS2 GAAGGGCTTCTTCCTT(pS)AT 23 ± 4 <1 
PO/PS3 GAAGGGCTTCTTCCT(pS)TAT 25 ± 2 <1 
PS1 CGCTGAAGGGCTTCTTCCTTATTGAT 
PS2 ATCAATAAGGAAGAAGCCCTTCAGCG 
PS3 CGCTGAAGGGCTTTTGAACTCTGCTT 
PS4 AAGCAGAGTTCAAAAGCCCTTCAGCG 
PS5 CGCTGAAGGGCTTCTTCCTTATTGCG 
PS6 ATCAATAAGGAAGAAGCCCTTCAGAT 

Phosphodiester (PO1 TO PO14), chimeric phosphodiester/phosphorothioate (PO/PS1 to PO/PS3), and all-phosphorothioate (PS1 to PS6) ODNs used in this study. The position of the phosphorothioate linkage is indicated by “pS” in the chimeric ODN sequences. Half-lives of the full-length ODNs are given in hours and correspond to an incubation of the ODNs at a 25 μmol/L concentration and at 37°C in RPMI 1640 culture media containing 2.5% NHS or 10% FCS. Data are the mean of three experiments ± SD.

Table 2.

Effect of Phosphodiester and Phosphorothioate ODNs on BV173

ODN 3′ End Cell Counts After 72 Hours 
  (% of Control ± SD) 
  2.5% NHS 2.5% NHSΔ 10% FCS 
PO1 TAT 35 ± 8 105 ± 7 114 ± 12 
PO2 TCT 81 ± 5   
PO3 TGT 18 ± 5   
PO4 TTT 25 ± 2   
PO5 TAA 37 ± 3   
PO6 CAT 53 ± 5   
PO7 GAT 27 ± 10   
PO8 TAC 118 ± 13   
PO9 TAG 22 ± 8   
PO10 TGA 22 ± 6  97 ± 9 
PO11 TGC 105 ± 7  92 ± 11 
PO12 TTC 119 ± 13 101 ± 11 104 ± 4 
PO13 TTT   2 ± 2 
PO14 CCC   123 ± 1 
PO/PS1 TTA(pS)T 91 ± 14 
PO/PS2 TT(pS)AT 36 ± 6 
PO/PS3 T(pS)TAT 29 ± 4 
ODN 3′ End Cell Counts After 72 Hours 
  (% of Control ± SD) 
  2.5% NHS 2.5% NHSΔ 10% FCS 
PO1 TAT 35 ± 8 105 ± 7 114 ± 12 
PO2 TCT 81 ± 5   
PO3 TGT 18 ± 5   
PO4 TTT 25 ± 2   
PO5 TAA 37 ± 3   
PO6 CAT 53 ± 5   
PO7 GAT 27 ± 10   
PO8 TAC 118 ± 13   
PO9 TAG 22 ± 8   
PO10 TGA 22 ± 6  97 ± 9 
PO11 TGC 105 ± 7  92 ± 11 
PO12 TTC 119 ± 13 101 ± 11 104 ± 4 
PO13 TTT   2 ± 2 
PO14 CCC   123 ± 1 
PO/PS1 TTA(pS)T 91 ± 14 
PO/PS2 TT(pS)AT 36 ± 6 
PO/PS3 T(pS)TAT 29 ± 4 

BV173 cell viability expressed as a percentage of control cell counts 72 hours after a single addition of phosphodiester or chimeric ODN, at a concentration of 25 μmol/L, in RPMI 1640 containing 2.5% NHS, 2.5% NHS heat-treated at 60°C for 30 minutes (NHSΔ), or 10% FCS. Data are expressed as the mean of at least three experiments ± SD.

Fig. 1.

BV173 cell viability (expressed as a percentage of control cell counts) as a function of time (in hours) following a single addition of ODN at a concentration of 25 μmol/L, in RPMI 1640 containing 2.5% NHS. Data are expressed as the mean of at least three experiments ± SD.

Fig. 1.

BV173 cell viability (expressed as a percentage of control cell counts) as a function of time (in hours) following a single addition of ODN at a concentration of 25 μmol/L, in RPMI 1640 containing 2.5% NHS. Data are expressed as the mean of at least three experiments ± SD.

ODN chemistry and antiproliferative effect on BV173.To further investigate the relationship between the 3′ terminal sequences of the ODNs and their biological effect, we constructed the phosphodiester/phosphorothioate chimeric sequences PO/PS1 to PO/PS3 (Table 1). These sequences were identical to PO1, but contained a phosphorothioate linkage instead of a phosphodiester at one of the last three 3′ sugar linkages. At an ODN concentration of 25 μmol/L in culture medium containing 2.5% NHS, PO/PS2 and PO/PS3 were active (Table 2), as their corresponding sequence PO1. On the contrary, PO/PS1 was inactive: a single phosphorothioate chemical transformation of the last 3′ phosphodiester position of PO1 was sufficient to abolish its antiproliferative effect.

26-mer PS ODNs and antiproliferative effect on BV173.26-mer antisense all-phosphorothioate ODN analogues, which target the junctional regions of the BCR/ABL mRNA, were reported to inhibit the proliferation of BV17321 in RPMI 1640 containing 10% FCS. To analyze whether this effect could also be due to the 3′ base sequence of the ODNs only, we incubated BV173 cultured in the same conditions (10% FCS) with the antisense PS1 and PS3 (which target, respectively, the b2a2 or the b3a2 junctional region of BCR/ABL mRNA), with the corresponding sense PS2 and PS4 and with the control ODNs PS5 and PS6 presented in Table 1. PS5 and PS6 were synthesized with their sequence identical to PS1 or PS2, except for their last two 3′ bases: the last two bases of the antisense sequences PS1 and PS2 were transposed. Those experiments were performed at an ODN concentration of 10 μmol/L. As for phosphodiester ODNs, the antiproliferative effect of these ODNs depended on their 3′ sequence (Table 3 and see Fig 2).

Table 3.

Effect of Phosphorothioate ODNs on BV173

ODN 3′ End Cell Counts After 72 Hours 
  (% of Control ± SD) 
  2.5% NHS 10% FCS 
PS1 GAT 83 ± 10 11 ± 1 
PS2 GCG 84 ± 11 59 ± 13 
PS3 CTT  19 ± 6 
PS4 GCG  59 ± 10 
PS5 GCG  59 ± 1 
PS6 GAT  18 ± 0 
ODN 3′ End Cell Counts After 72 Hours 
  (% of Control ± SD) 
  2.5% NHS 10% FCS 
PS1 GAT 83 ± 10 11 ± 1 
PS2 GCG 84 ± 11 59 ± 13 
PS3 CTT  19 ± 6 
PS4 GCG  59 ± 10 
PS5 GCG  59 ± 1 
PS6 GAT  18 ± 0 

BV173 cell viability expressed as a percentage of control cell counts 72 hours after a single addition of phosphorothioate ODN at a concentration of 10 μmol/L, in RPMI 1640 containing 2.5% NHS or 10% FCS. Data are expressed as the mean of at least three experiments ± SD.

Fig. 2.

BV173 cell viability (expressed as a percentage of control cell counts) as a function of time (in hours) following a single addition of ODN at a concentration of 10 μmol/L, in RPMI 1640 containing 10.0% FCS. Data are expressed as the mean of at least three experiments ± SD.

Fig. 2.

BV173 cell viability (expressed as a percentage of control cell counts) as a function of time (in hours) following a single addition of ODN at a concentration of 10 μmol/L, in RPMI 1640 containing 10.0% FCS. Data are expressed as the mean of at least three experiments ± SD.

Culture medium and antiproliferative effect on BV173.To analyze the influence of the culture medium on the antiproliferative effect, we incubated BV173 with ODNs, in culture medium containing different sera.

With phosphodiester ODNs (Table 2), the cell growth inhibition induced by the active ODNs was only observed in culture media containing 2.5% NHS. In 10% FCS or 2.5% heat-treated NHS (60°C, 30 minutes), the effect was not observed. However, the homopolymer PO13 (but not PO14) was active in media containing 10% FCS.

With phosphorothioate ODNs (Table 3), the activity observed for PS1, PS3, and PS6 in media containing 10% FCS was abolished on replacement of 10% FCS with 2.5% NHS.

Degradation kinetics of ODNs in culture media.Phosphodiester and chimeric phosphodiester/phosphorothioate ODNs were incubated in culture media containing different sera. The stepwise hydrolysis of the ODN phosphate linkages by 3′ exonucleases was observed, as already reported.43-48 This degradation process was monitored and quantitated using ion exchange chromatography.

In comparison with medium containing 10% FCS, the 2.5% NHS containing medium was at least 10 times less active in terms of ODN 3′ hydrolysis (Table 1).

Heating of NHS before use (60°C, 30 minutes) drastically slowed down the degradation process: no degradation pattern of the ODNs was observed after 72 hours of incubation.

As already reported,47 the stability of the phosphodiester ODNs towards 3′ exonucleases present in NHS was dependent on their last 3′ phosphodiester linkage (Table 1).

The chimeric ODN, PO/PS1, was completely stable in 2.5% NHS containing media. In 10% FCS, an hydrolysis of the phosphorothioate linkage was observed. The half-life of PO/PS1 was about 15 hours. There was no difference between the two diastereoisomers of PO/PS1 (distinguishable using ion exchange chromatography) in terms of stability.

Toxicity of d-NMPs on BV173.The BV173 cell line, cultured in a 2.5% NHS containing medium, was incubated with increasing concentrations of d-NMPs. As illustrated in Table 4 and see Fig 3,10 at a concentration of at least 10 μmol/L, all the d-NMPs except d-CMP inhibited cell growth after 48 hours of incubation. The following decreasing order of effectiveness was found: d-GMP > TMP > d-AMP. The equimolar mixture of the four d-NMPs, at concentrations up to 100 μmol/L each, had no effect. Experiments with the simultaneous presence of two d-NMPs showed furthermore that a coincubation with an equimolar amount of d-CMP strongly diminished the antiproliferative effect of any other d-NMP.

Table 4.

Effect of d-NMPs on BV173

d-NMP Concentration (μmol/L) Cell Counts After 72 Hours 
  (% of Control ± SD) 
  2.5% NHS 2.5% NHSΔ 10% FCS 
d-AMP 108 ± 18   
d-AMP 10 80 ± 7   
d-AMP 25 76 ± 5 90 ± 10 79 ± 3 
d-AMP 100 54 ± 4 
d-CMP 106 ± 6   
d-CMP 10 99 ± 13   
d-CMP 25 114 ± 13 102 ± 18 99 ± 8 
d-CMP 100 119 ± 23 
d-GMP 105 ± 7   
d-GMP 10 37 ± 15   
d-GMP 25 29 ± 4 95 ± 8 37 ± 5 
d-GMP 100 14 ± 2 
TMP 107 ± 10   
TMP 10 71 ± 7   
TMP 25 50 ± 1 97 ± 5 61 ± 13 
TMP 100 41 ± 8 
d-NMPs 100 (400) 94 ± 5 
d-AMP+d-CMP 25 (50) 113 ± 15 
d-AMP+d-GMP 25 (50) 41 ± 11 
d-AMP+TMP 25 (50) 45 ± 7 
d-CMP+d-GMP 25 (50) 59 ± 9 
d-CMP+TMP 25 (50) 113 ± 21 
d-GMP+TMP 25 (50) 17 ± 5 
d-NMP Concentration (μmol/L) Cell Counts After 72 Hours 
  (% of Control ± SD) 
  2.5% NHS 2.5% NHSΔ 10% FCS 
d-AMP 108 ± 18   
d-AMP 10 80 ± 7   
d-AMP 25 76 ± 5 90 ± 10 79 ± 3 
d-AMP 100 54 ± 4 
d-CMP 106 ± 6   
d-CMP 10 99 ± 13   
d-CMP 25 114 ± 13 102 ± 18 99 ± 8 
d-CMP 100 119 ± 23 
d-GMP 105 ± 7   
d-GMP 10 37 ± 15   
d-GMP 25 29 ± 4 95 ± 8 37 ± 5 
d-GMP 100 14 ± 2 
TMP 107 ± 10   
TMP 10 71 ± 7   
TMP 25 50 ± 1 97 ± 5 61 ± 13 
TMP 100 41 ± 8 
d-NMPs 100 (400) 94 ± 5 
d-AMP+d-CMP 25 (50) 113 ± 15 
d-AMP+d-GMP 25 (50) 41 ± 11 
d-AMP+TMP 25 (50) 45 ± 7 
d-CMP+d-GMP 25 (50) 59 ± 9 
d-CMP+TMP 25 (50) 113 ± 21 
d-GMP+TMP 25 (50) 17 ± 5 

BV173 viable cell counts (expressed as a percentage of control cell counts) 72 hours after a single addition of d-NMP (or of d-NMP mixture), at concentrations from 1 to 400 μmol/L in RPMI 1640 containing 2.5% NHS, 2.5% NHS heat-treated at 60°C for 30 minutes (NHSΔ), or 10% FCS. Data are expressed as the mean of at least three experiments ± SD. The d-NMP mixtures are composed of equimolar amounts of each component. The total d-NMP concentration is indicated between brackets.

Fig. 3.

BV173 viable cell counts (expressed as a percentage of control cell counts) after a single addition of one of the four d-NMPs (d-AMP, d-CMP, d-GMP, and TMP) at a concentration of 25 μmol/L or of an equimolar (100 μmol/L of each) mixture of the four d-NMPs in RPMI 1640 supplemented with 2.5% NHS. Data are expressed as the mean of at least three experiments ± SD.

Fig. 3.

BV173 viable cell counts (expressed as a percentage of control cell counts) after a single addition of one of the four d-NMPs (d-AMP, d-CMP, d-GMP, and TMP) at a concentration of 25 μmol/L or of an equimolar (100 μmol/L of each) mixture of the four d-NMPs in RPMI 1640 supplemented with 2.5% NHS. Data are expressed as the mean of at least three experiments ± SD.

In FCS containing media, the results were identical to those obtained in NHS containing ones. On the contrary, in media containing 2.5% heat-treated NHS (60°C, 30 minutes), no antiproliferative effect was observed.

Antiproliferative effects on CD34 positive bone marrow cells.The ODN and the d-NMP induced antiproliferative effects were tested on fresh hematopoietic cells: we performed culture experiments (Table 5) on bone marrow cells, enriched in CD34+ cells, derived from healthy volunteers. Cell counts always displayed profiles similar to those observed, under the same experimental conditions, on BV173.

Table 5.

Effect of d-NMPs and ODNs on CD34+ Bone Marrow Cells

d-NMP or ODN 3′ End Concentration (μmol/L) Cell Counts After 72 Hours 
   (% of Control ± SD) 
   2.5% NHS 10% FCS 
 
d-AMP  25 80 ± 2  
d-CMP  25 106 ± 1  
d-GMP  25 24 ± 6  
TMP  25 53 ± 21  
d-NMP  25 (100) 92 ± 3  
PO1 TAT 25 42 ± 5  
PO12 TTC 25 104 ± 3  
PS1 GAT 10  38 ± 7 
PS2 GCG 10  84 ± 5 
PS3 CTT 10  30 ± 4 
PS4 GCG 10  86 ± 11 
PS5 GCG 10  83 ± 4 
PS6 GAT 10  45 ± 1 
d-NMP or ODN 3′ End Concentration (μmol/L) Cell Counts After 72 Hours 
   (% of Control ± SD) 
   2.5% NHS 10% FCS 
 
d-AMP  25 80 ± 2  
d-CMP  25 106 ± 1  
d-GMP  25 24 ± 6  
TMP  25 53 ± 21  
d-NMP  25 (100) 92 ± 3  
PO1 TAT 25 42 ± 5  
PO12 TTC 25 104 ± 3  
PS1 GAT 10  38 ± 7 
PS2 GCG 10  84 ± 5 
PS3 CTT 10  30 ± 4 
PS4 GCG 10  86 ± 11 
PS5 GCG 10  83 ± 4 
PS6 GAT 10  45 ± 1 

CD34+ bone marrow cell counts expressed as a percentage of control cells 72 hours after a single addition of d-NMP, d-NMP mixture or ODN, at concentrations from 25 to 100 μmol/L (for d-NMPs) or 10 to 25 μmol/L (for phosphorothioate or phosphodiester ODNs), in RPMI 1640 containing 2.5% NHS or 10% FCS. Data are expressed as the mean of three experiments (each on a different bone marrow) ± SD.

DISCUSSION

We have previously shown that phosphodiester ODNs with a “TAT” motif at their 3′ end inhibit the growth of normal and leukemic CD34+ hematopoietic cells as well as leukemic cell lines BV173 and KCL22. The results presented here further show that the “TAT” sequence is not the only one inducing an antiproliferative effect. All tested phosphodiester ODNs were active, except those containing a “C” at one of their two most terminal 3′ positions. These observations are also applicable to phosphorothioate ODNs. Considering that 50% of ODNs of random sequence are devoid of “C” at one of their two most terminal 3′ positions, 50% of random ODNs will therefore inhibit hematologic cell growth.

The absence of a “C” at one of the two most terminal 3′ positions of an ODN is necessary but not sufficient to induce the antiproliferative effect. The phosphodiester ODNs without “C” were only active in medium containing 2.5% NHS where their half-lives were of about 24 hours. When NHS was heat-treated, the antiproliferative effect and the ODN degradation process disappeared. The chimeric phosphodiester/phosphorothioate ODN, PO/PS1, containing only one phosphorothioate linkage (and no “C”) at its 3′ end, was inactive in 2.5% NHS, in which it was very stable (half-life >100 hours). The all-phosphorothioate ODNs were inactive and stable in 2.5% NHS. In 10% FCS, the phosphorothioate ODNs were partially hydrolyzed, with half-lives of about 24 hours,48 and, under such experimental conditions, all the ODNs without a “C” exerted an effect on the cells, as phosphodiester ODNs in 2.5% NHS. We conclude that the antiproliferative effect is only observed in culture media in which the ODNs are degraded by the 3′ exonucleases present in the sera. However, the absence of a “C” and the extracellular instability of ODNs do not sufficiently explain all our experimental data. In media containing 10% FCS, the phosphodiester ODNs, despite of half-lives shorter than 1 hour, were all inactive. The 18-mer poly-T homopolymer PO13 was an exception, with an half-life of a few minutes and an effect on cell growth. Thus, it appears (with the exception of the PO13 behavior) that the ODN degradation kinetics control the antiproliferative effect: to observe the antiproliferative effect, the ODNs have to be hydrolyzed but not too rapidly.

To explain this paradoxical effect, we analyzed the cytotoxicity of d-NMPs, the monomeric degradation products of the phosphodiester ODNs. At concentrations around 10 μmol/L, the cytotoxicity of the different d-NMPs was not identical. Not only d-CMP was inactive on the cells but it also suppressed (or diminished) the toxic effect of other d-NMPs. The mixture of the four d-NMPs, each at a concentration of 100 μmol/L (as a model of the d-NMP concentrations released by ODNs in 10% FCS), was not toxic. Similar observations were already published on hematologic cells or cell lines.50,51 

We conclude that the antiproliferative activity of the phosphodiester (and most probably phosphorothioate) ODNs is due to the stepwise release of d-NMPs under the effect of serum exonucleases. The effect is restricted to experimental culture conditions in which the 3′ hydrolysis generates a significant amount of d-NMPs other than d-CMP.

All our experimental data regarding the phosphodiester or phosphodiester/phosphorothioate chimeric ODNs conforms with this explanation.

The toxic doses of d-NMPs on the cells are compatible with the d-NMP concentrations released by the ODNs as a function of time. As deduced from Fig 4,10 PO1, incubated at a concentration of 25 μmol/L in a culture medium containing 2.5% NHS, will generate by its 3′ hydrolysis, after 24 hours, a 12.5 μmol/L TMP concentration and a 1.0 μmol/L d-AMP concentration. Forty-eight hours later, an antiproliferative effect can be observed on the cells. On the contrary, PO2, incubated at a concentration of 25 μmol/L in a culture medium containing 2.5% NHS, will generate (see Fig 5) by its 3′ hydrolysis, after 24 hours, a 5.0 μmol/L TMP concentration and a d-CMP concentration lower than 1.0 μmol/L. Forty-eight hours later, no antiproliferative effect is observed on the cells. This low TMP concentration will not induce an inhibition of the cell growth 48 hours later.

Fig. 4.

Kinetics curves (relative ODN concentrations as a function of time) of the 3′ hydrolysis of a 25 μmol/L solution of PO1 on incubation at 37°C in RPMI 1640 containing 2.5% HS. PO1-1, PO1-2, and PO1-3 represent, respectively, the PO1 sequence minus 1, 2, and 3 deoxyribonucleotides at the 3′ end. PO1 half-life (22 hours) is indicated by the position of the two arrows. The dashed curve (symmetrical to the PO1 curve) indicates the theoretical TMP relative concentration generated by hydrolysis of the PO1 3′ last linkage. The PO1-2 curve represents also the maximal d-AMP relative concentration generated by hydrolysis of the PO1-1 3′ last position.

Fig. 4.

Kinetics curves (relative ODN concentrations as a function of time) of the 3′ hydrolysis of a 25 μmol/L solution of PO1 on incubation at 37°C in RPMI 1640 containing 2.5% HS. PO1-1, PO1-2, and PO1-3 represent, respectively, the PO1 sequence minus 1, 2, and 3 deoxyribonucleotides at the 3′ end. PO1 half-life (22 hours) is indicated by the position of the two arrows. The dashed curve (symmetrical to the PO1 curve) indicates the theoretical TMP relative concentration generated by hydrolysis of the PO1 3′ last linkage. The PO1-2 curve represents also the maximal d-AMP relative concentration generated by hydrolysis of the PO1-1 3′ last position.

Fig. 5.

Kinetics curves (relative ODN concentrations as a function of time) of the 3′ hydrolysis of a 25 μmol/L solution of PO2 on incubation at 37°C in RPMI 1640 containing 2.5% HS. PO2-1, PO2-2, and PO2-3 represent, respectively, the PO2 sequence minus 1, 2, and 3 deoxyribonucleotides at the 3′ end. PO2 half-life (38 hours) is indicated by the position of the two arrows. The dashed curve (symetrical to the PO2 curve) indicates the theoretical TMP relative concentration generated by hydrolysis of the PO2 3′ very last linkage. The PO2-2 curve represents also the maximal d-CMP relative concentration generated by hydrolysis of the PO2-1 3′ very last position.

Fig. 5.

Kinetics curves (relative ODN concentrations as a function of time) of the 3′ hydrolysis of a 25 μmol/L solution of PO2 on incubation at 37°C in RPMI 1640 containing 2.5% HS. PO2-1, PO2-2, and PO2-3 represent, respectively, the PO2 sequence minus 1, 2, and 3 deoxyribonucleotides at the 3′ end. PO2 half-life (38 hours) is indicated by the position of the two arrows. The dashed curve (symetrical to the PO2 curve) indicates the theoretical TMP relative concentration generated by hydrolysis of the PO2 3′ very last linkage. The PO2-2 curve represents also the maximal d-CMP relative concentration generated by hydrolysis of the PO2-1 3′ very last position.

In media containing 10% FCS, the unstable phosphodiester ODNs, with half-lives of about a few minutes, are inactive because of the presence of d-CMP in the d-NMP mixture resulting from their rapid 3′ hydrolysis. On the contrary, the homopolymer PO13 is still active in 10% FCS because of the toxicity of its monomer TMP and the absence of “C ” in its sequence.

In contrast to the behavior of PO/PS1, the chimeric ODNs PO/PS2 and PO/PS3 are active in 2.5% NHS because, unlike PO/PS1, they release TMP at a concentration of at least a 10 μmol/L after 24 hours of incubation.

It is noticeable that the type of the culture medium is also important for the activity of the d-NMPs: no effect is observed in heat-treated NHS containing media. We hypothesize that one or several metabolic products of the d-NMPs (such as deoxyribonucleosides), may be involved in the cytotoxicity and that the heat-treatment of NHS inactivates key enzymes of this metabolism. This point, under current investigation, is already strongly supported by several published data.52-59 

The toxicity of 5′ phosphorothioate deoxyribonucleosides has still to be examined to fully show the extension of our conclusions to phosphorothioate ODNs.

The degradation kinetics of ODNs in various media has been and is still being studied by several groups.43-48 The putative cellular effects of the ODN degradation products have already been pointed out.49 The biological activity of d-NMPs on hematologic cells has been also reported in the literature.50-59 However, our work shows, for the first time, that the 3′ sequence of an ODN is responsible for its biological activity via its stepwise hydrolysis.

Different groups reported an antiproliferative effect of anti-BCR/ABL ODNs on leukemic cells and cell lines. This effect, sometimes reported as an antisense effect, was suspected by different groups to be not junction specific, not leukemia specific and even not ODN sequence specific. To show an antisense effect, the direct measurement of the target protein level, as compared with that of internal controls, is virtually mandatory. A selective downregulation of the BCR/ABL protein, in an experimental system consisting of plain incubation of cells with ODNs, would of course be an indication of a possible specific antisense effect. However, such a selective inhibition, in these experimental conditions, has not been shown and protein measurement are sometimes difficult to perform in cells dying because of the effect induced by ODNs. To tackle this confusing situation, we decided to use many control ODNs to investigate the antiproliferative effect. After analysis of the degradation kinetics of the ODNs under our cell culture conditions, we are now able to interpret this effect: this antiproliferative activity of anti-BCR/ABL ODNs on CML cells should be re-interpreted as an example of non-antisense, but sequence-specific, cellular toxicity. This antiproliferative effect of the ODNs is programmed in their 3′ sequences, but is only executed if their degradation generates an “active” d-NMP mixture in the culture medium. The sensitivity of normal CD34+ bone marrow cells shows that the mechanism of this effect is not leukemia-specific. Since our goal was to understand this mechanism, and see whether it applied also to normal cells, we have performed no dose-effect relationship on normal and leukemic CD34+ cells. Therefore, we may not exclude a difference of sensitivity to cytotoxic d-NMPs between normal and leukemic cells. As a result, we may not exclude that dNMPs could be used for bone marrow purging if there were a preferential toxic effect on malignant cells. Anyhow the use of phosphodiester or phosphorothioate ODNs for purging purposes is questionable, at least in experimental conditions under which d-NMPs are produced in the μmol/L concentration range by the extracellular degradation of the ODNs. Nevertheless, our results do not preclude the validity of other approaches using different methods to introduce ODNs inside the cells. The question of whether the BCR/ABL mRNA, could be a good target for an antisense approach in CML is still under study in several groups and deserves further investigations.60-63 

Finally, our results also raise the question of whether other antisense experiments, using ODNs aimed at different targets, performed in conditions allowing extracellular production of d-NMPs, and leading to cell growth inhibition or, maybe, to other biological effects, should be reexamined using more stringent degradation controls. Our results clearly show that the commonly used control ODNs3 (sense, scrambled, random, mismatched) are not optimal controls for ODN degradation. When these control ODNs are hydrolyzed step by step during incubation time, they do not produce the same d-NMP mixture as the antisense ODN. This makes the use of at least another control ODN with the same 3′ sequence as the antisense mandatory in any experiment where a substantial extracellular 3′ degradation of the ODNs can be anticipated. Because the nuclease content of a particular serum is not constant but depends on the serum batch, on storage conditions and heat treatment,47 the ODN degradation processes should be examined, before performing any antisense experiment, for each particular incubation medium. The toxicity of the d-NMP mixtures produced at the concentrations predicted by the ODN degradation kinetics should then be assayed. The use of serum free or heat-treated serum media47 could minimize the degradation-induced toxicity.

ACKNOWLEDGMENT

We thank Drs Bernard Lebleu (Université de Montpellier I, CNRS, Montpellier, France), Nicole Straetmans (Université de Louvain, Hematologie, Brussels, Belgium), and Marc Lemaı̂tre (Eurogentec, Liège, Belgium) for critical reading of the manuscript.

Supported in part by the Fonds National de la Recherche Scientifique (FNRS, Brussels, Belgium) Grant No. 3.4576.94 and the EUROGENTEC Co. (Liège, Belgium). P.M. is a qualified investigator of the FNRS.

Address reprint requests to J.L. Vaerman, PhD, Laboratoire de Biologie Moléculaire Hématologique, Cliniques St Luc, Université Catholique de Louvain, Clos Chapelle-aux-champs 30/3052, 1200, Brussels, Belgium.

REFERENCES

REFERENCES
1
Woolf
TM
Melton
DA
Jennings
CGB
Specificity of antisense oligonucleotides in vivo.
Proc Natl Acad Sci USA
89
1992
7305
2
Stein
CA
Krieg
AM
Problems in interpretation of data derived from in vitro and in vivo use of antisense oligodeoxynucleotides.
Antisense Res Dev
3
1994
67
3
Wagner
RW
Gene inhibition using antisense oligodeoxynucleotides.
Nature
372
1994
333
4
Stein
CA
Cheng
YC
Antisense oligonucleotides as therapeutic agents -is the bullet really magical?
Science
261
1993
1004
5
Yamamoto
S
Yamamoto
T
Kataoka
T
Kuramoto
E
Yano
D
Tokunaga
T
Unique palindromic sequences in synthetic oligonucleotides are required to induce INF and augment INF-mediated natural killer activity.
J Immunol
148
1992
4072
6
Kuramoto
E
Yano
O
Kimura
Y
Baba
U
Makino
T
Yamamoto
S
Yamamoto
T
Kataoka
T
Tokunaga
T
Oligonucleotide sequences required for natural killer cell activation.
Jpn J Cancer Res
83
1992
1128
7
Bergan
R
Connell
Y
Fahmy
B
Kyle
E
Neckers
L
Aptameric inhibition of p210 bcr-abl tyrosine kinase autophosphorylation by oligodeoxynucleotides of defined sequence and backbone structure.
Nucleic Acids Res
22
1994
2150
8
Bergan
R
Kyle
E
Connell
Y
Neckers
L
Inhibition of protein-tyrosine kinase activity in intact cells by the aptameric action of oligodeoxynucleotides.
Antisense Res Dev
5
1995
33
9
Bock
LC
Griffin
LC
Latham
JA
Vermaas
EH
Toole
JJ
Selection of single-stranded DNA molecules that bind and inhibit human thrombin.
Nature
355
1992
564
10
Yakubov
L
Khaled
Z
Zhang
LM
Truneh
A
Vlassov
V
Stein
CA
Mode of interaction of oligodeoxynucleotides with recombinant sCD4.
J Biol Chem
268
1993
18818
11
Stein
CA
Cleary
A
Yakubov
L
Lederman
S
Phosphorothioate oligodeoxynucleotides bind to the third variable loop domain (v3) of HIV-1 gp120.
Antisense Res Dev
3
1993
19
12
Vaerman
JL
Lammineur
C
Moureau
P
Lewalle
P
Deldime
F
Blumenfeld
M
Martiat
P
BCR-ABL antisense oligodeoxyribonucleotides suppress the growth of leukemic and normal hematopoietic cells by a sequence-specific but nonantisense mechanism.
Blood
86
1995
3891
13
Taj
AS
Martiat
P
Dhut
S
Chaplin
D
Dowding
C
Th'ng
KH
Goldstein
I
Daley
GQ
Goldman
JM
Inhibition of P210 BCR-ABL expression in K562 cells by electroporation with an antisense oligonucleotide.
Leuk Lymphoma
3
1990
201
14
Szczylik
C
Skorski
T
Nicolaides
NC
Manzella
L
Malaguarnera
L
Venturelli
D
Gewirtz
AM
Calabretta
B
Selective inhibition of leukemia cell proliferation by BCR-ABL antisense oligodeoxynucleotides.
Science
253
1991
562
15
Skorski
T
Szczylik
C
Malaguarnera
L
Calabretta
B
Gene-targeted specific inhibition of chronic myeloid leukemia cell growth by BCR-ABL antisense oligodeoxynucleotides.
Folia Histochem Cytobiol
29
1991
85
16
Mahon
FX
Belloc
F
Reiffers
J
Antisense oligomers in chronic myeloid leukaemia.
Lancet
341
1993
566
17
Kirkland
MA
O'Brien
SG
McDonald
C
Davidson
RJ
Cross
NCP
Goldman
JM
BCR-ABL antisense purging in chronic myeloid leukaemia.
Lancet
342
1993
614
18
Maekawa T, Murakami A, Kimura S, Inazawa J, Hirakawa K, Abe T, Makino K: Clonal suppression of human leukemia cell growth by antisense oligodeoxynucleotide phosphorothioates. J Cell Biochem 17E:197, 1993 (suppl)
19
Skorski
T
Nieborowska
Skorska M
Barletta
C
Malaguarnera
L
Szczylik
C
Chen
ST
Lange
B
Calabretta
B
Highly efficient elimination of Philadelphia leukemic cells by exposure to bcr/abl antisense oligodeoxynucleotides combined with mafosfamide.
J Clin Invest
92
1993
194
20
Vaerman JL, Lewalle P, Martiat P: Antisense inhibition of p210 bcr-abl in chronic myeloid leukemia. Stem Cells 11:89, 1993 (suppl 3)
21
De Fabritiis
P
Amadori
S
Calabretta
B
Mandelli
F
Elimination of clonogenic Philadelphia-positive cells using BCR-ABL antisense oligodeoxynucleotides.
Bone Marrow Transplant
12
1993
261
22
Smetsers
TFCM
Skorski
T
Van de Locht
LTF
Wessels
HMC
Pennings
AHM
De Witte
T
Calabretta
B
Mensink
EJBM
Antisense BCR-ABL oligonucleotides induce apoptosis in the Philadelphia chromosome positive cell line BV173.
Leukemia
1
1994
129
23
Skorski
T
Nieborowska-Skorska
M
Nicolaides
NC
Szczylik
C
Iversen
P
Iozzo
RV
Zon
G
Calabretta
B
Suppression of Philadelphia leukemia cell growth in mice by bcr-abl antisense oligodeoxynucleotides.
Proc Natl Acad Sci USA
91
1994
4504
24
Okabe
M
Kunieda
Y
Miyagishima
T
Kobayashi
M
Kurosawa
M
Itaya
T
Sakurada
K
Miyazaki
T
BCR-ABL oncoprotein-targeted antitumor activity of antisense oligonucleotides complementary to BCR/ABL mRNA and Herbimycin A, an antagonist of protein tyrosine kinase: Inhibitory effects on in vitro growth of Ph1-positive leukemia cells and BCR/ABL oncoprotein-associated transformative cells.
Leuk Lymphoma
10
1993
307
25
Bedi
A
Zehnbauer
BA
Barber
JP
Sharkis
SJ
Jones
RJ
Inhibition of apoptosis by BCR-ABL in chronic myeloid leukemia.
Blood
83
1994
2038
26
Thomas
M
Kosciolek
B
Wang
N
Rowley
P
Capping of bcr-abl antisense oligonucleotides enhances antiproliferative activity against chronic myeloid leukemia cell lines.
Leuk Res
18
1994
401
27
McGahon
A
Bissonnette
R
Schmitt
M
Cotter
KM
Green
DR
Cotter
TG
BCR-ABL maintains resistance of chronic myelogenous leukemia cells to apoptotic cell death.
Blood
83
1994
1179
28
Tari
AM
Tucker
SD
Deisseroth
A
Lopez-Berestein
G
Liposomal delivery of methylphosphonate antisense oligonucleotides in chronic myelogenous leukemia.
Blood
84
1995
601
29
O'Brien
SG
Kirkland
MA
Melo
JV
Rao
MH
Davidson
RJ
McDonald
C
Goldman
JM
Antisense BCR-ABL oligomers cause non-specific inhibition of chronic myeloid leukemia cell lines.
Leukemia
8
1994
2156
30
Smetsers
TFCM
van de Locht
LTF
Pennings
AHM
Wessels
HMC
de Witte
TM
Mensink
EJBM
Phosphorothioate BCR-ABL antisense oligonucleotides induce cell death, but fail to reduce cellular bcr-abl protein levels.
Leukemia
9
1995
118
31
Mahon
FX
Ripoche
J
Piegonnier
V
Jazwiec
B
Pigneux
A
Moreau
JF
Reiffers
J
Inhibition of chronic myelogenous leukemia cells harboring a BCR-ABL B3A2 junction by antisense oligonucleotides targeted at the B2A2 junction.
Exp Hematol
23
1995
1606
32
de Fabritiis
P
Amadori
S
Petti
MC
Mancini
M
Montefusco
E
Picardi
A
Geiser
T
Campbell
K
Calabretta
B
Mandelli
F
In vitro purging with BCR-ABL antisense oligodeoxynucleotides does not prevent haematologic reconstitution after autologous bone marrow transplantation.
Leukemia
9
1995
662
33
Nichols
GL
Antisense oligodeoxynucleotides as therapeutic agents for chronic myelogenous leukemia.
Antisense Res Dev
5
1995
67
34
de Klein
A
Geurts van Kessel
A
Grosveld
G
Bartram
CR
Hagemeijer
A
Bootsma
D
Spurr
N
Heisterkamp
N
Groffen
J
Stephenson
JR
A cellular oncogene is translocated to the Philadelphia chromosome in chronic myelocytic leukemia.
Nature
300
1982
765
35
Shtivelman
E
Lifshitz
B
Gale
RP
Canaani
E
Fused transcripts of abl and bcr genes in chronic myeloid leukemia.
Nature
315
1985
550
36
Konopka
JB
Watanabe
SM
Witte
ON
An alteration of the human c-abl protein in K562 leukemia cells unmasks associated tyrosine kinase activity.
Cell
37
1984
1035
37
Daley
GQ
Van Etten
RA
Baltimore
D
Induction of chronic myelogenous leukemia in mice by the P210 bcr/abl gene of the Philadelphia chromosome.
Science
247
1990
824
38
Elefanty
AG
Cory
S
Bcr-abl, the hallmark of chronic myeloid leukemia in man, induces multiple hematologic neoplasms in mice.
EMBO J
9
1990
1069
39
Heisterkamp
N
Jenster
G
ten Hoeve
J
Zovich
D
Pattengale
PK
Groffen
J
Acute leukemia in bcr-abl transgenic mice.
Nature
344
1990
251
40
Vaerman
JL
Moureau
P
Larondelle
Y
Martiat
P
Philippe
M
Prediction of oligodeoxyribonucleotides eluting salt conditions on anion exchange column.
Nucleic Acids Res
20
1992
3522
41
Pegorado
L
Matera
L
Ritz
J
Levis
A
Palumbo
A
Biagini
G
Establishment of a Ph1 positive human cell line (BV173).
J Natl Cancer Inst
70
1983
447
42
Martiat
P
Maisin
D
Philippe
M
Ferrant
A
Michaux
JL
Cassiman
JJ
Van den Berghe
H
Sokal
G
Detection of residual BCR/ABL transcripts in chronic myeloid leukaemia patients in complete remission using the polymerase chain reaction with nested primers.
Br J Haematol
75
1990
355
43
Wickstrom
E
Oligodeoxynucleotide stability in subcellular extracts and culture media.
J Biochem Biophys Methods
13
1986
97
44
Eder
PS
DeVine
RJ
Dagle
JM
Walder
JA
Substrate specificity and kinetics of degradation of antisense oligonucleotides by a 3′ exonuclease in plasma.
Antisense Res Dev
1
1991
141
45
Pompon
A
Lefebvre
I
Imbach
JL
On-line internal surface reverse-phase cleaning: The direct HPLC analysis of crude biological samples. Application to the kinetics of degradation of oligonucleotides in cell culture medium.
Biochem Pharmacol
43
1992
1769
46
Fisher
TL
Terhorst
T
Cao
X
Wagner
RW
Intracellular disposition and metabolism of fluorescently labeled unmodified and modified oligonucleotides microinjected into mammalian cells.
Nucleic Acids Res
21
1993
3857
47
Vichier-Guerre
S
Pompon
A
Levebvre
I
Imbach
JL
New insights into the resistance of α-oligonucleotides to nucleases.
Antisense Res Dev
4
1994
9
48
Spitzer
F
Eckstein
F
Inhibition of deoxyribonucleases by phosphorothioate groups in oligodeoxyribonucleotides.
Nucleic Acids Res
16
1988
11691
49
Milligan
J
Matteucci
M
Martin
J
Current concepts in antisense drug design.
J Med Chem
36
1993
1923
50
Theiss
JC
Morris
NR
Fischer
GA
Pyrimidine nucleotide metabolism in L5178Y murine leukemia cells: Deoxycytidine protection from deoxyguanosine toxicity.
Cancer Biochem Biophys
1
1976
211
51
Fox
RM
Tripp
EH
Tattersall
MHN
Mechanism of deoxycytidine rescue of thymidine toxicity in human T-leukemic lymphocytes.
Cancer Res
40
1980
1718
52
Wilkinson
YA
McKenna
PG
The effects of thymidine on deoxyribonucleotide pool level, cytotoxicity and mutation induction in Friend Mouse erythroleukaemia cells.
Leuk Res
13
1989
615
53
Tattersall
MHN
Slowiaczek
P
De Fazio
A
Regional variation in human extracellular purine levels.
J Lab Clin Med
102
1983
411
54
Tanaka
Y
Yoshihara
K
Tsuyuki
M
Kamiya
T
Apoptosis induced by adenosine in human leukemia HL-60 cells.
Exp Cell Res
213
1994
242
55
Fox
RM
Kefford
RF
Tripp
EH
Taylor
IW
G1-phase arrest of cultured human leukemic T-cells induced by deoxyadenosine.
Cancer Res
41
1981
5141
56
Ross
DD
Akman
SA
Schrecker
AW
Bachur
NR
Effects of deoxynucleosides on cultured human leukemia cell growth and deoxynucleotide pools.
Cancer Res
41
1981
4493
57
Kefford
RF
Fox
RM
Purine deoxynucleoside toxicity in nondividing human lymphoid cells.
Cancer Res
42
1982
324
58
De Fouw
NJ
Ma
DDF
Michalevicz
R
Gray
DA
Hoffbrand
AV
Differential cytotoxicity of deoxyguanosine and 8-aminoguanosine for human leukemic cell lines and normal bone marrow progenitor cells.
Hematol Oncol
2
1984
189
59
Russel
NH
Hoffbrand
AV
Bellingham
AJ
Potential use of purine nucleosides and enzyme inhibitors for selective depletion of Thy-lymphoblasts from human bone marrow.
Leuk Res
10
1986
325
60
Gilles
RV
Spiller
DG
Green
JA
Clark
RE
Tidd
DM
Optimisation of antisense oligodeoxynucleotides structure for targeting bcr-abl mRNA.
Blood
86
1995
744
61
Spiller
DG
Tidd
DM
Nuclear delivery of antisense oligodeoxynucleotides through reversible permeabilization of human leukemia cells with streptolysin O.
Antisense Res Dev
5
1995
13
62
Giles
RV
Spiller
DG
Tidd
DM
Detection of ribonuclease H-generated mRNA fragments in human leukemia cells following reversible membrane permeabilization in the presence of antisense oligodeoxynucleotides.
Antisense Res Dev
5
1995
23
63
Giles
RV
Ruddell
CJ
Spiller
DG
Green
JA
Tidd
DM
Single base discrimination for ribonuclease H-dependent antisense effects within intact human leukaemia cells.
Nucleic Acids Res
23
1995
954