Abstract

Human immunodeficiency virus type 1 (HIV-1)–infected patients develop a spectrum of lymphoproliferative disorders ranging from nonneoplastic lymphadenopathies to B-cell lymphomas. Although evidence suggests that Epstein-Barr virus (EBV) might be involved, its molecular profile and expression pattern in HIV-1–related lymphoproliferations remain to be defined. Using polymerase chain reaction–based techniques, we studied EBV types and variants in 28 lymphadenopathy lesions and in 20 lymphomas (15 large cell and 5 Burkitt-like). EBV was detected in 89% of lymphadenopathies and in 80% of lymphomas; viral DNA content was significantly higher in the latter. EBNA2 and LMP1 gene analysis indicated that half of the EBV+ lymphadenopathies were coinfected with both EBV type 1 and 2 strains and/or multiple type 1 variants. Conversely, all but one lymphoma carried a single viral variant, consistently type 1 in large cell lymphomas, and type 2 in Burkitt-like tumors. Most lymphomas, but no lymphadenopathies, showed monoclonal Ig heavy-chain rearrangement. Analysis of 5 large cell lymphomas and 9 lymphadenopathies for EBV transcripts identified LMP1 mRNA in most samples, and the EBNA2 transcript in all tumors. These findings provide evidence of a heterogeneous EBV population in lymphadenopathy lesions, strengthen the notion that lymphomas arise from clonal expansion of EBV+ cells, and suggest different roles for EBV types 1 and 2 in HIV-1–related lymphoproliferations.

PATIENTS INFECTED with human immunodeficiency virus type 1 (HIV-1) develop a wide spectrum of lymphoproliferative disorders, ranging from nonneoplastic lymphadenopathy to high-grade B-cell non-Hodgkin's lymphoma (NHL).1 Two main histologic types of NHL are recognized, Burkitt-like lymphoma and large cell lymphoma.2 Although lymphadenopathy usually appears as an early manifestation of HIV-1 infection, lymphomas arise at a relatively late stage of infection, and the onset of large cell lymphoma is invariably associated with a low CD4+ cell count and an immunocompromised patient status.3 The finding that a significant proportion of HIV-1–infected subjects with lymphoma have a previous history of lymphadenopathy,4 together with the presence of monoclonal or oligoclonal Ig gene rearrangements in some of these lesions,5,6 suggests that lymphadenopathy might represent a lymphomatous lesion precursor.

Although the pathogenesis of HIV-1–related lymphoproliferative disorders is far from being fully elucidated, there is evidence that Epstein-Barr virus (EBV) may be involved. EBV sequences and/or gene products are detectable in up to 80% of large cell lymphomas, and in about 40% of Burkitt-like lymphomas.7 Moreover, the presence of EBV in lymphadenopathy lesions correlates with a higher risk of developing lymphoma over time,4 thus suggesting that EBV might constitute an early promoter in HIV-1–related lymphomagenesis.

EBV is a ubiquitous human herpesvirus that is able to immortalize B cells in vitro and is associated with a variety of human malignancies.8 EBV isolates can be distinguished into two types by major sequence divergence in the genes coding for the EBV nuclear antigens (EBNA 2, 3A, 3B, 3C), and into distinct strains by specific nucleotide sequence variability within the EBNA2 and latent membrane protein 1 (LMP1) genes.9-11 Furthermore, distinct EBV variants can be distinguished on the basis of the length and number of repeat sequences in the third exon of the LMP1 gene.10,12 The observation that EBV type 1 transforms B cells in vitro more efficiently than EBV type 213 suggests type-specific differences in oncogenic activity in vivo. Although healthy white subjects usually harbor a single EBV strain, usually of type 1, HIV-1–infected subjects may be infected with either type 1 or type 2; moreover, either type 1 or 2 has been found in HIV-1–related lymphomas,14,15 thus suggesting that both types may play an oncogenic role in the context of a weakened immune system. Furthermore, coinfection with EBV types 1 and 2 has been reported in HIV-1–infected subjects,16-18 but very little information is currently available on the genomic heterogeneity of EBV in HIV-1–related lymphadenopathies.4,19 

Although in vitro EBV-immortalized B cells express all the latent proteins of EBV, including the six nuclear antigens (EBNA1, 2, 3A, 3B, 3C, LP) and the three latent membrane proteins (LMP1, 2A, 2B), different patterns of EBV latent protein expression have been described in EBV-related malignancies in vivo. Whereas the selective expression of EBNA1 protein is usually found in Burkitt lymphoma cells, expression of EBNA1, LMP1, and LMP2A and/or LMP2B is frequently detected in nasopharyngeal carcinoma and Hodgkin's disease, and all EBNA and LMP proteins have been detected in posttransplant lymphomas.8 The question of EBV expression in HIV-1–related lymphomas has yet to be fully resolved. Although selective expression of the EBNA 1 has been consistently reported in EBV+ Burkitt-like lymphoma, heterogeneous expression of EBV latent proteins has been described in large cell lymphoma.7,15,20 Moreover, little information concerning EBV gene expression in lymphadenopathy lesions is available; to date the only study in this field was conducted by immunohistochemical analysis of paraffin-fixed biopsy samples and it failed to detect EBNA2 and/or LMP1 expression.19 

Table 1.

PCR Primers and Probes Used for EBV Detection and Expression Analysis

Primers/Probes B95.8 Coordinates Sequence (bp) Annealing Temperature (°C) MgCl2 Concentration (mmol/L) 
 (5′-3′ )    
DNA-PCR: 
EBNA2 5′ 48162-48181 5′-AGGCTGCCCACCCTGAGGAT-3′ 62 1.5 
EBNA2 3′ 48330-48311 5′-GCCACCTGGCAGCCCTAAAG-3′   
EBNA2-type 1/2 probe 48253-48271 5′-GTTGCCGCCAGGTGGCAGC-3′   
EBNA3C 5′ 99939-99958 5′-AGAAGGGGAGCGTGTGTTGT-3′ 58 1.5 
EBNA3C 3′ 100091-100072 5′-GGCTCGTTTTTGACGTCGGC-3′   
EBNA3C-type 1 probe 100002-100021 5′-GAAGATTCATCGTCAGTGTC-3′   
EBNA3C-type 2 probe  5′-CCGTGATTTCTACCGGGAGT-3′   
RT-PCR: 
EBNA2 5′ 47940-47959 5′-GCGCCAATCTGTCTACATAG-3′ 50 0.5 
EBNA2 3′ 48534-48515 5′-CCCCATGTAACGCAAGATAG-3′   
EBNA2 probe 48473-48454 5′-CGGGTGCTTAGAAGGTTGTT-3′   
LMP1 5′ 168813-168833 5′-CAACCAATAGAGTCCACCAGT-3′ 50 0.75 
LMP1 3′ 169263-169243 5′-TCTTCAGAAGAGACCTTCTCT-3′   
LMP1 probe 168888-168908 5′-GGAAGAAGGCCAAAAGCTGCC-3′   
LMP2A 5′ 166820-166840 5′-GATTGCAACACGACGGGAATG-3′ 50 1.0 
LMP2B 5′ 169819-169839 5′-CAGTGTAATCTGCACAAAGAG-3′ 50 0.5 
LMP2A/LMP2B 3′ 271-251 5′-AAGTGACAACCGCAGTAAGCA-3′   
LMP2A/LMP2B probe 229-249 5′-AAACTGCTGACACCGGTGACA-3′   
BZLF 5′ 102478-102498 5′-GCCACCCGATTCTTGTATCGC-3′ 55 1.5 
BZLF 3′ 103063-103042 5′-AGTCTATCAGGACCTGGGAGGG-3′   
BZLF probe 102853-102873 5′-TTCCCAGTCTCCGACATAACC-3′  
Primers/Probes B95.8 Coordinates Sequence (bp) Annealing Temperature (°C) MgCl2 Concentration (mmol/L) 
 (5′-3′ )    
DNA-PCR: 
EBNA2 5′ 48162-48181 5′-AGGCTGCCCACCCTGAGGAT-3′ 62 1.5 
EBNA2 3′ 48330-48311 5′-GCCACCTGGCAGCCCTAAAG-3′   
EBNA2-type 1/2 probe 48253-48271 5′-GTTGCCGCCAGGTGGCAGC-3′   
EBNA3C 5′ 99939-99958 5′-AGAAGGGGAGCGTGTGTTGT-3′ 58 1.5 
EBNA3C 3′ 100091-100072 5′-GGCTCGTTTTTGACGTCGGC-3′   
EBNA3C-type 1 probe 100002-100021 5′-GAAGATTCATCGTCAGTGTC-3′   
EBNA3C-type 2 probe  5′-CCGTGATTTCTACCGGGAGT-3′   
RT-PCR: 
EBNA2 5′ 47940-47959 5′-GCGCCAATCTGTCTACATAG-3′ 50 0.5 
EBNA2 3′ 48534-48515 5′-CCCCATGTAACGCAAGATAG-3′   
EBNA2 probe 48473-48454 5′-CGGGTGCTTAGAAGGTTGTT-3′   
LMP1 5′ 168813-168833 5′-CAACCAATAGAGTCCACCAGT-3′ 50 0.75 
LMP1 3′ 169263-169243 5′-TCTTCAGAAGAGACCTTCTCT-3′   
LMP1 probe 168888-168908 5′-GGAAGAAGGCCAAAAGCTGCC-3′   
LMP2A 5′ 166820-166840 5′-GATTGCAACACGACGGGAATG-3′ 50 1.0 
LMP2B 5′ 169819-169839 5′-CAGTGTAATCTGCACAAAGAG-3′ 50 0.5 
LMP2A/LMP2B 3′ 271-251 5′-AAGTGACAACCGCAGTAAGCA-3′   
LMP2A/LMP2B probe 229-249 5′-AAACTGCTGACACCGGTGACA-3′   
BZLF 5′ 102478-102498 5′-GCCACCCGATTCTTGTATCGC-3′ 55 1.5 
BZLF 3′ 103063-103042 5′-AGTCTATCAGGACCTGGGAGGG-3′   
BZLF probe 102853-102873 5′-TTCCCAGTCTCCGACATAACC-3′  

In this study we have applied polymerase chain reaction (PCR)-based methods to analyze EBV types and variants and EBV gene expression in lymphadenopathies and lymphomas from HIV-1–infected patients. Results showed that lymphadenopathies and lymphomas differ with respect to genomic heterogeneity of EBV and mRNA expression patterns.

Fig. 1.

Sensitivity of DNA-PCR for EBNA2 gene detection. Tenfold serial dilutions of DNA from EBV+ B95.8 or AG876 cells were mixed with 1 μg of DNA from EBV K562 cells and PCR amplified with EBNA2 primers. The amplified products, of 169 bp and 185 bp for EBV types 1 and 2, respectively, were visualized with a radiolabeled probe that detects EBV type 1 (A) and type 2 (B). Regression curves (C and D) were obtained as described in Materials and Methods.

Fig. 1.

Sensitivity of DNA-PCR for EBNA2 gene detection. Tenfold serial dilutions of DNA from EBV+ B95.8 or AG876 cells were mixed with 1 μg of DNA from EBV K562 cells and PCR amplified with EBNA2 primers. The amplified products, of 169 bp and 185 bp for EBV types 1 and 2, respectively, were visualized with a radiolabeled probe that detects EBV type 1 (A) and type 2 (B). Regression curves (C and D) were obtained as described in Materials and Methods.

MATERIALS AND METHODS

Pathologic samples.Lymph node or extralymphatic mass biopsy samples were collected from 28 patients with lymphadenopathy lesions and 20 patients with lymphomas, all with documented HIV-1 infection. Tumors were diagnosed and classified according to the International Working Formulation21 and grouped as Burkitt-like (5 cases) or large cell lymphoma (15 cases). The fraction of malignant cells in the tumor specimens was greater than 80% in most cases as determined by immunohistochemical analysis of cell surface markers. Biopsy samples were stored at −80°C until DNA and RNA extraction.

DNA extraction and Southern blot analysis.High-molecular-weight DNA was prepared by cell lysis, proteinase-K digestion, extraction with phenol-chloroform, and ethanol precipitation. Low-molecular-weight DNA was extracted using a standard procedure22 from 5- to 10-μm–thick sections of paraffin-embedded biopsy speciments. Southern blot analyses for EBV and for IgH gene rearrangements were performed on high-molecular-weight DNA (10 μg) after digestion with appropriate restriction endonucleases, as previously reported.23 

Fig. 2.

EBV types and variants in lymphadenopathy lesions and lymphomas. Representative lymphadenopathy lesions harboring EBV type 1 (no. 17) or EBV types 1 and 2 (no. 24), and lymphoma lesions harboring EBV type 2 (no. 33) or EBV type 1 (no. 47) are shown in (A) and (B). The amplified EBNA2 products were visualized in ethidium bromide–stained acrylamide gels and detected with a radiolabeled probe that detects EBV types 1 and 2 (A); the amplified EBNA 3C products from the same samples were visualized in ethidium bromide–stained gels and detected using two different radiolabeled probes specific for EBV types 1 and 2, respectively (B). (C) LMP1 variant analysis of the same lesions. Two different LMP1 variants were detected in each lymphadenopathy lesion, while a single LMP1 variant was detected in lymphoma samples. Lane “mix” contained a mixture of five amplified LMP1 products, containing 4, 5, 6, or 7 repeats, or 5 repeats (5) with the 15-bp insertion.

Fig. 2.

EBV types and variants in lymphadenopathy lesions and lymphomas. Representative lymphadenopathy lesions harboring EBV type 1 (no. 17) or EBV types 1 and 2 (no. 24), and lymphoma lesions harboring EBV type 2 (no. 33) or EBV type 1 (no. 47) are shown in (A) and (B). The amplified EBNA2 products were visualized in ethidium bromide–stained acrylamide gels and detected with a radiolabeled probe that detects EBV types 1 and 2 (A); the amplified EBNA 3C products from the same samples were visualized in ethidium bromide–stained gels and detected using two different radiolabeled probes specific for EBV types 1 and 2, respectively (B). (C) LMP1 variant analysis of the same lesions. Two different LMP1 variants were detected in each lymphadenopathy lesion, while a single LMP1 variant was detected in lymphoma samples. Lane “mix” contained a mixture of five amplified LMP1 products, containing 4, 5, 6, or 7 repeats, or 5 repeats (5) with the 15-bp insertion.

PCR analysis.EBV DNA was detected and typed by PCR using primers specific for the EBNA2 and EBNA3C genes as previously reported,24 by using 1 μg of sample DNA and 50 pmol of each primer (listed in Table 1); 35 amplification cycles, each of 40 seconds at 94°C, 1 minute at 62°C for EBNA2 primers and 58°C for EBNA3C primers, and 1 minute at 72°C, were performed in a DNA thermal cycler (Gene Amp PCR system 9600; Perkin Elmer, Foster City, CA). EBNA3C amplified products (30 μL) were electrophoresed in agarose gels and transferred to Nytran filters by Southern blotting; EBNA2 amplified products (20 μL) were electrophoresed in acrylamide gels and transferred to Nytran filters by electroblotting. Filters were hybridized with 5′ end 32P-labeled specific probes (Table 1) and exposed to x-ray film. To control the quality of samples, parallel reactions were run using the primers specific for a 110-bp sequence of the β-globin gene.25 

To assess the sensitivity of the PCR technique and to estimate the relative amount of EBV DNA in the samples, a reference curve was prepared by PCR amplifying DNA extracted from EBV+ B95.8 cells or AG876 cells serially diluted in 1 μg of DNA from EBV K562 cells. A PCR signal was obtained starting with 0.1 pg of B95.8 or AG876 DNA using the EBNA2-specific primers (Fig 1A and B) and with 1 pg using the EBNA3C-specific primers (not shown). As the B95.8 cell line contains about 200 EBV genomes/cell,26 PCR would detect as few as 2 and as many as 20 EBV genomes/1 μg DNA, using the EBNA2 and EBNA 3C primers, respectively. Autoradiographs of the EBNA2-amplified products were evaluated by densitometry (Ultrascan XL, LKB; Pharmacia, Uppsala, Sweden) and the optical density (OD) values were plotted against the dilutions of DNA; a linear correlation between the OD value and the amount of target DNA was observed over a range of 0.1 pg to 100 ng (Fig 1C and D). The relative amount of EBV DNA in the samples was calculated by comparing the OD values of their EBNA2-amplified products to the OD values of the standard controls; EBV DNA content was then expressed on a scale from 1+ (OD values included among those obtained from 0.1 to 1 pg control DNA) to 6+ (OD values included among those obtained from 10 to 100 ng control DNA).

Table 2.

Detection of EBV Types and Variants in HIV-1–Related Lymphadenopathies and Lymphomas

Pathology No. EBV+/No. Tested EBV Type 1 EBV Type 2 EBV Types 1/2 Multiple LMP1 Variants 
Lymphadenopathy 25/28* 17 10 
Burkitt-like lymphoma 4/5 
Large-cell lymphoma 12/15 11 
Pathology No. EBV+/No. Tested EBV Type 1 EBV Type 2 EBV Types 1/2 Multiple LMP1 Variants 
Lymphadenopathy 25/28* 17 10 
Burkitt-like lymphoma 4/5 
Large-cell lymphoma 12/15 11 
*

One case was not typable (see text).

To investigate EBV variants, 1 μg of sample DNA was amplified by PCR as previously described12 using a set of primers (5′-3′ GGCGCACCTGGAGGTGGTCC; TTTCCAGCAGAGTCGCTAGG) that immediately flank a portion of the 33-bp tandem repeats in the LMP1 gene.26 The PCR products were electrophoresed through 6% polyacrylamide/7 mol/L urea/Tris-borate gels, transferred electrophoretically to Hybond-N Plus membranes (Amersham, Buckinghamshire, UK), and hybridized with the internal oligonucleotide probe 5′-3′ TGACAATGGCCCACAGGACCCTG.27 Repeat number was assessed by comparison with a marker containing a mixture of five sequenced amplified products.12 

Seminested PCR for the detection of IgH gene rearrangements was performed as previously described.24 

Semiquantitative reverse transcriptase (RT)-PCR.Frozen specimens were homogenized (Ultraturrax; IKA Werk, Staufen, Germany) and total RNA was extracted using RNAzolB (Biotecx Laboratories, Inc, Houston, TX). First-strand cDNA was made from 16 μg of total RNA in a 160-μL reaction mixture containing 50 mmol/L KCl, 10 mmol/L Tris- HCl pH 8.3, 50 pmol dT oligomer, 1 mmol/L of each dNTP, 50 U of Moloney Murine Leukemia Virus (MuLV) RT, 20 U of RNase inhibitor, and 5 mmol/L MgCl2 . RNA samples were preheated for 10 minutes at 65°C, incubated in the reaction mixture for 60 minutes at 42°C, and then incubated for 10 minutes at 99°C. Twenty microliters of the reverse-transcribed mixture was coamplified with primers specific for each of the viral genes listed in Table 1, and for the β-actin cellular gene. PCR was performed in a final volume of 100 μL containing 50 pmol of each primer specific for the viral gene, 12.5 pmol of primer specific for the β-actin gene, 200 μmol/L of each dNTP, 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L KCl, 0.5 to 1.5 mmol/L MgCl2 , and 2.5 U of Taq DNA polymerase. Forty amplification cycles were performed using the annealing temperature reported in Table 1; 30 μL of each amplified sample was electrophoresed in agarose gels and transferred to Nytran filters by Southern blotting. Filters were hybridized with 5′ end 32P-labeled specific probes (Table 1) and exposed to x-ray films. Autoradiographs of the amplified products were analyzed by densitometry, and the relative amount of viral RNA was calculated as the ratio between the OD value of the amplified viral gene and the OD value of the amplified β-actin gene.

In situ hybridization and immunohistochemistry.Formalin-fixed, paraffin-embedded sections from lymph nodes and tumor samples were hybridized overnight at 37°C with fluorescein isothiocyanate (FITC)-labeled RNA probes specific for EBER-1/2 EBV transcripts (Dako, Golstrup, Denmark). Colorimetric detection was performed by using anti-FITC antibody followed by alkaline phosphatase-conjugated antimouse antibody and nitroblue tetrazolium as substrate. Adjacent sections were incubated with the monoclonal antibody CS1-4 (Dako), which recognizes the LMP1 protein. Detection was performed with the ABC kit (Vectastain; Vector, Burlingame, CA) and diaminobenzidine as substrate.

Table 3.

Molecular Profile of EBV in HIV-1–Related Lymphadenopathies

Patient Code Ig (SB) Ig (PCR) EBV (SB) EBV Type (PCR) EBV DNA Amount (PCR)3-150 LMP 
      No. Variants No. Repeats3-151 
Polyclonal − 2+ 
Polyclonal − 1/2 1+/1+ 4, 3 
Polyclonal − 3+ 5 
Polyclonal − 1/2 1+/2+ 
Polyclonal − − − − − 
Polyclonal − NT 2+ 4, 5 
Polyclonal − 1+ 5 
Polyclonal − 1+ 5 
Polyclonal − 1+ 
10 Polyclonal − 1+ 4, 5, 6 
11 Polyclonal − 2+ 
12 Polyclonal − 1+ 5 
13 Polyclonal − 1/2 1+/1+ 4, 3 
14 Polyclonal − − − − − 
15 NA Polyclonal NA − − − − 
16 NA Polyclonal NA 2+ 4 
17 Polyclonal − 2+ 5, 5 
18 Polyclonal − 1+ 7, 5 
19 ND − 1/2 1+/1+ 4, 7 
20 Polyclonal − 2+ 4, 5 
21 Polyclonal − 1+ 4, 5 
22 ND ND ND 1+ ND ND 
23 Polyclonal − 1/2 2+/1+ 
24 Polyclonal − 1/2 3+/3+ 4, 7 
25 NA Polyclonal NA 1+ 5 
26 Polyclonal  —  1+ 4 
27 NA Polyclonal NA 2+ 5 
28 NA Polyclonal NA 1+ 5 
Patient Code Ig (SB) Ig (PCR) EBV (SB) EBV Type (PCR) EBV DNA Amount (PCR)3-150 LMP 
      No. Variants No. Repeats3-151 
Polyclonal − 2+ 
Polyclonal − 1/2 1+/1+ 4, 3 
Polyclonal − 3+ 5 
Polyclonal − 1/2 1+/2+ 
Polyclonal − − − − − 
Polyclonal − NT 2+ 4, 5 
Polyclonal − 1+ 5 
Polyclonal − 1+ 5 
Polyclonal − 1+ 
10 Polyclonal − 1+ 4, 5, 6 
11 Polyclonal − 2+ 
12 Polyclonal − 1+ 5 
13 Polyclonal − 1/2 1+/1+ 4, 3 
14 Polyclonal − − − − − 
15 NA Polyclonal NA − − − − 
16 NA Polyclonal NA 2+ 4 
17 Polyclonal − 2+ 5, 5 
18 Polyclonal − 1+ 7, 5 
19 ND − 1/2 1+/1+ 4, 7 
20 Polyclonal − 2+ 4, 5 
21 Polyclonal − 1+ 4, 5 
22 ND ND ND 1+ ND ND 
23 Polyclonal − 1/2 2+/1+ 
24 Polyclonal − 1/2 3+/3+ 4, 7 
25 NA Polyclonal NA 1+ 5 
26 Polyclonal  —  1+ 4 
27 NA Polyclonal NA 2+ 5 
28 NA Polyclonal NA 1+ 5 

Abbreviations: ND, not done; NA, not applicable because only low-molecular-weight DNA was available; NT, not typable.

F3-150

The relative amount of EBV DNA was estimated by comparing OD values of amplified products to those obtained by amplification of 10-fold serial dilutions of B95.8 or AG876 DNA: 1+ (0.1-1 pg), 2+ (1-10 pg), 3+ (10-100 pg).

F3-151

In boldface are reported LMP1 variants containing the 15-bp insertion in the third repeat element.

RESULTS

Detection of EBV types and variants.Detection and typing of EBV in 28 lymphadenopathy and 20 lymphoma specimens was performed by PCR using primer pairs specific for EBNA2 and EBNA3C sequences (Fig 2A and B). EBV DNA was detected in 25 of the 28 lymphadenopathy samples (89%), in 12 of the 15 large cell lymphomas (80%), and in 4 of the 5 Burkitt-like lymphomas (Table 2). The frequency of EBV type 1 was higher than type 2 in both the lymphadenopathy lesions (17 of 25) and the large cell lymphoma samples (11 of 12). Conversely, type 2 infection was found in 3 of 4 Burkitt-like lymphomas, but in only 1 lymphadenopathy, and was not detected in any of the large cell lymphomas. Coinfection with EBV types 1 and 2 was detected in 6 lymphadenopathies and in 1 large cell lymphoma (Table 2). In all of these cases EBV type 1 and 2 sequences were detected with primer pairs for both EBNA2 and EBNA3C. Only one lymphadenopathy case (no. 6, Table 3) could not be typed, as only EBV type 1 sequences were detected using EBNA2 primers, and only type 2 sequences were evidenced using EBNA3C primers.

Viral variants were distinguished by PCR amplification of the portion of the LMP1 gene containing the 33-bp repeats. This region contains from 3 to 7 repeats; an insertion of 15 bp is also present in one internal repeat in the B95.8 virus prototype and in several other isolates.10,12 Both the number and type of repeat sequences in the samples were assessed by comparison with a marker containing a mixture of five sequenced amplified products (Fig 2C). Multiple LMP1 variants were detected in 10 lymphadenopathy cases, but only in 1 lymphoma sample (Table 2). It has been shown that LMP1 divergence does not correlate with the distinction between types 1 and 2 based on EBNA gene diversity, and different EBV types may have nearly identical LMP1 sequences.10 Accordingly, in 2 of 6 coinfected lymphadenopathy samples, we found a single variant, whereas we detected 2 or 3 LMP1 variants in 6 samples despite the presence of a single EBV type (Table 3). The single lymphoma sample showing multiple LMP1 variants was the only tumor coinfected with both EBV type 1 and type 2 (no. 42, Table 4).

Table 4.

Molecular Profile of EBV in HIV-1–Related NHLs

Patient Code Site Pathology Ig (SB) Ig (PCR) EBV (SB)4-150 EBER (ISH)4-151 EBV Type (PCR) EBV DNA Amount (PCR) LMP 
         No. Variants No. Repeatsρ 
29 Lymph node SNCCL Clonal ND 5+ 
30 Lymph node SNCCL Clonal 20% 6+ 5 
31 Bone marrow SNCCL ND ND − ND − − − − 
32 Stomach SNCCL NA Clonal NA 10% 4+ 
33 Ascites SNCCL Clonal ND 5+ 
34 Brain CNS-LCL Clonal ND 5+ 
35 Brain CNS-LCL NA Clonal NA ND − − − − 
36 Brain CNS-LCL NA Clonal NA 15% 4+ ND ND 
37 Lymph node LCL-IB Clonal − ND 3+ 
38 Stomach LCL-IB ND ND ND ND 1+ ND ND 
39 Lymph node LCL-IBP Polyclonal − ND − − − − 
40 Skin LNCCL NA Clonal NA 30% 1+ 
41 Skin LCL-IBP NA Clonal NA − 2+ 4 
42 Bladder wall LNCCL NA Polyclonal NA − 1/2 1+/2+ 4, 5 
43 Lymph node LNCCL Clonal − − − − − − 
44 Lymph node LCL-IBP Clonal 45% 4+ 
45 Lymph node LNCCL Clonal 20% 5+ 
46 Stomach LCL-IB Clonal 45% 5+ 
47 Nasopharynx LCL-IB ND Clonal ND 4+ 
48 Pleural effusion LCL-IB Clonal − − 3+ 4 
Patient Code Site Pathology Ig (SB) Ig (PCR) EBV (SB)4-150 EBER (ISH)4-151 EBV Type (PCR) EBV DNA Amount (PCR) LMP 
         No. Variants No. Repeatsρ 
29 Lymph node SNCCL Clonal ND 5+ 
30 Lymph node SNCCL Clonal 20% 6+ 5 
31 Bone marrow SNCCL ND ND − ND − − − − 
32 Stomach SNCCL NA Clonal NA 10% 4+ 
33 Ascites SNCCL Clonal ND 5+ 
34 Brain CNS-LCL Clonal ND 5+ 
35 Brain CNS-LCL NA Clonal NA ND − − − − 
36 Brain CNS-LCL NA Clonal NA 15% 4+ ND ND 
37 Lymph node LCL-IB Clonal − ND 3+ 
38 Stomach LCL-IB ND ND ND ND 1+ ND ND 
39 Lymph node LCL-IBP Polyclonal − ND − − − − 
40 Skin LNCCL NA Clonal NA 30% 1+ 
41 Skin LCL-IBP NA Clonal NA − 2+ 4 
42 Bladder wall LNCCL NA Polyclonal NA − 1/2 1+/2+ 4, 5 
43 Lymph node LNCCL Clonal − − − − − − 
44 Lymph node LCL-IBP Clonal 45% 4+ 
45 Lymph node LNCCL Clonal 20% 5+ 
46 Stomach LCL-IB Clonal 45% 5+ 
47 Nasopharynx LCL-IB ND Clonal ND 4+ 
48 Pleural effusion LCL-IB Clonal − − 3+ 4 

Abbreviations: SNCCL, small noncleaved cell Burkitt-like lymphoma; CNS-LCL, central nervous system-large cell lymphoma; LCL-IB, large cell immunoblastic lymphoma; LCL-IBP, large cell immunoblastic lymphoma with plasmacytoid differentiation; ND, not done; NA, not applicable because only low-molecular-weight DNA was available.

F4-150

Single genome dominance.

F4-151

% of positive cells.

The relative amount of EBV DNA was estimated by comparing OD values of amplified products to those obtained by amplification of 10-fold serial dilutions of B95.8 or AG876 DNA: 1+ (0.1-1 pg), 2+ (1-10 pg), 3+ (10-100 pg), 4+ (100 pg-1 ng), 5+ (1-10 ng), 6+ (10-100 ng).

ρ In boldface are reported LMP1 variants containing the 15-bp insertion in the third repeat element.

The relative amount of EBV DNA in the EBV+ samples was estimated by comparing the OD values of their amplified EBNA2 products to the OD values obtained using standard reference samples, as detailed in Materials and Methods. As shown in Table 3, most of the EBV+ lymphadenopathy samples had very low levels of EBV DNA (ie, scored either 1+ or 2+) and accordingly, none of the analyzed lymphadenopathy specimens was found to be EBV+ by Southern blot analysis. Three cases were analyzed by in situ hybridization with EBER probes; 1 (no. 20) showed viral sequences in 2% to 3% of cells (Fig 3), and 2 (nos. 21 and 23) were negative. Interestingly, in 4 of 6 coinfected lymphadenopathy cases, the amounts of type 1 and type 2 EBV DNA were equivalent, while either type 1 or 2 predominated in the 2 remaining cases (Table 3).

Fig. 3.

In situ hybridization with EBER probes. In a representative lymphadenopathy case (no. 20), rare EBER+ cells are seen, mainly in the interfollicular areas (A and B). In a representative lymphoma case (no. 46) nearly half of the cells are EBER+ (C and D). Original magnification: ×130 (A and C) and ×260 (B and D).

Fig. 3.

In situ hybridization with EBER probes. In a representative lymphadenopathy case (no. 20), rare EBER+ cells are seen, mainly in the interfollicular areas (A and B). In a representative lymphoma case (no. 46) nearly half of the cells are EBER+ (C and D). Original magnification: ×130 (A and C) and ×260 (B and D).

Twelve of the 16 EBV+ lymphoma samples scored from 3+ to 6+ for EBV DNA content (ie, 102- to 105-fold higher than that found in the majority of the lymphadenopathy samples), and most were also positive by Southern blot analysis (Table 4). Seven of 11 tested samples were also positive for viral sequences by in situ hybridization with EBER probes (Table 4). Although the high content of EBV in these tumors strongly indicated that they arose from the proliferation of EBV+ cells, 4 large cell lymphomas contained consistently low levels of EBV DNA, a finding that might reflect either a dilution effect by nonneoplastic EBV cells in the analyzed samples, or the presence of few infiltrating reactive EBV+ B cells.

Detection of B-cell clonal expansion.B-cell clonal expansion in lymphadenopathy and lymphoma biopsies was investigated by PCR amplification of the IgH VDJ region. All lymphadenopathy specimens analyzed disclosed a ladder of multiple bands indicative of reactive polyclonal B-cell proliferation (Table 3). In contrast, 16 of the 18 lymphoma samples studied showed a monoclonal rearrangement of the Ig heavy chain, suggesting a clonal B-cell expansion (Table 4). Interestingly, the only polyclonal tumor among the EBV+ lymphoma samples was case 42, which was positive for both EBV types (Table 4). Southern blot analysis of IgH gene rearrangements invariably confirmed the PCR results, as reported in Tables 3 and 4.

EBV gene expression.The profile of EBV gene expression was studied by RT-PCR in 5 large cell lymphomas and 9 lymphadenopathy cases for which cryopreserved material for RNA extraction was available. To detect and quantify the relative amount of viral RNA in the samples, the cDNAs were coamplified with a primer pair specific for a viral gene along with a primer pair specific for the β-actin cellular gene. The sensitivity of the assay with the different primer pairs was assessed using serial dilutions of RNA extracted from EBV+ B95.8 cells. The sensitivity was such that a positive signal was obtained starting from 10 pg of RNA using EBNA2-specific primers, 100 pg using the LMP1-specific primers, and 1 ng using LMP2A- and LMP2B-specific primers (Fig 4).

Fig. 4.

Sensitivity of semiquantitative RT-PCR. Tenfold dilutions of B95.8 RNA were mixed with 1 μg of RNA from EBV K562 cells. Multiplex RT-PCR was performed using primer pairs specific for the β-actin cellular gene and either EBNA2, LMP1, LMP2A, or LMP2B gene. Hybridization was performed with radiolabeled probes specific for each gene. The lengths of the amplified products are shown on the left.

Fig. 4.

Sensitivity of semiquantitative RT-PCR. Tenfold dilutions of B95.8 RNA were mixed with 1 μg of RNA from EBV K562 cells. Multiplex RT-PCR was performed using primer pairs specific for the β-actin cellular gene and either EBNA2, LMP1, LMP2A, or LMP2B gene. Hybridization was performed with radiolabeled probes specific for each gene. The lengths of the amplified products are shown on the left.

All 5 large cell lymphoma samples expressed the EBNA2 gene, and in 4 of 5 cases LMP1 mRNA was also detected. Both the EBNA2 and LMP1 mRNAs were also detected in 3 of 9 lymphadenopathy samples, whereas 2 additional cases showed positivity only for LMP1 (Fig 5). The relative amounts of EBNA2 and LMP1 mRNAs varied as assessed by comparison with the cellular β-actin transcript, but were consistently higher in lymphomas than in lymphadenopathy samples (Table 5). The detection of LMP1 protein in only 2 specimens (Table 5) may reflect the lower sensitivity of the immunohistochemical analysis, or that the LMP1 mRNA is not always translated, as reported for nasopharyngeal carcinomas.28 Interestingly, LMP2A and LMP2B gene expression was detected only in lymphoma samples. Because the promoters of the LMP2A and LMP2B genes contain the EBNA2-responsive element, their expression may partially reflect differences in EBNA2 expression. Although the LMP2A and LMP2B genes apparently play a nonessential role in in vitro EBV transformation, LMP2A has been suggested to interfere with B-cell signal transduction,29 and LMP2B mRNA was found to be expressed in rare EBV+ peripheral T-cell lymphomas.30 

Fig. 5.

Detection of EBNA2 and LMP1 transcripts in lymphadenopathy lesions and lymphomas. Multiplex-PCR was performed using primers specific for the β-actin gene and either EBNA2 (A) or LMP1 gene (B); the amplified products of 117 bp, 209 bp, and 296 bp, respectively, were stained with ethidium bromide and hybridized with probes specific for EBNA2 or LMP1 and β-actin genes. M, molecular-weight marker φx 174/HaeIII.

Fig. 5.

Detection of EBNA2 and LMP1 transcripts in lymphadenopathy lesions and lymphomas. Multiplex-PCR was performed using primers specific for the β-actin gene and either EBNA2 (A) or LMP1 gene (B); the amplified products of 117 bp, 209 bp, and 296 bp, respectively, were stained with ethidium bromide and hybridized with probes specific for EBNA2 or LMP1 and β-actin genes. M, molecular-weight marker φx 174/HaeIII.

Table 5.

EBV Gene Expression in HIV-1–Related NHLs and Lymphadenopathies

Patient Code EBV-RNA5-150 ICH LMP-1 
 EBNA2 LMP1 LMP2A LMP2B BZLF  
Large cell lymphoma 
44 5.040 3.851 3.200 2.246 0.160 10% 
45 <0.05 0.108 <0.05 <0.05 <0.05  —  
46 1.010 2.081 <0.05 <0.05 5.865  —  
47 2.390 1.000  —   —  <0.05  —  
48 <0.05  —   —   —   —   —  
Lymphadenopathy 
20 <0.05 <0.05  —   —  0.075  —  
21 1.880 <0.05  —   —   —  1-2% 
22 <0.05 <0.05  —   —  ND ND 
23  —  <0.05  —   —   —   —  
24  —  <0.05  —   —  0.209 ND 
25  —   —   —   —   —  ND 
26  —   —   —   —   —  ND 
27  —   —   —   —   —  ND 
28  —   —   —   —   —  ND 
Patient Code EBV-RNA5-150 ICH LMP-1 
 EBNA2 LMP1 LMP2A LMP2B BZLF  
Large cell lymphoma 
44 5.040 3.851 3.200 2.246 0.160 10% 
45 <0.05 0.108 <0.05 <0.05 <0.05  —  
46 1.010 2.081 <0.05 <0.05 5.865  —  
47 2.390 1.000  —   —  <0.05  —  
48 <0.05  —   —   —   —   —  
Lymphadenopathy 
20 <0.05 <0.05  —   —  0.075  —  
21 1.880 <0.05  —   —   —  1-2% 
22 <0.05 <0.05  —   —  ND ND 
23  —  <0.05  —   —   —   —  
24  —  <0.05  —   —  0.209 ND 
25  —   —   —   —   —  ND 
26  —   —   —   —   —  ND 
27  —   —   —   —   —  ND 
28  —   —   —   —   —  ND 

Abbreviation: ND, not done.

F5-150

The amount of viral RNA was calculated as the ratio between OD values obtained for the specific EBV amplification product and that of the β-actin amplification product.

BZLF mRNA was detected in both lymphadenopathy and lymphoma specimens (Table 5). Not surprisingly, expression of the BZLF gene, a transactivator of EBV lytic genes, did not correlate with EBV latent gene expression. The detection of BZLF1 mRNA in our cases is in agreement with the finding of antibodies to the BZLF1-encoded protein ZEBRA in about 30% of HIV-1 seropositive subjects31 and the presence of ZEBRA protein in a small proportion of neoplastic cells in NHLs arising in HIV-1–infected subjects.32 

DISCUSSION

Our analysis of HIV-1–associated lymphadenopathy and lymphoma cases showed that 89% of the lymphadenopathy lesions and 80% of lymphomas tested harbored EBV. Analyses of EBNA2 and LMP1 genes in the EBV+ samples disclosed that all but one lymphoma harbored a single EBV variant, whereas 12 of 25 lymphadenopathy lesions evidenced coinfection with multiple EBV variants. These findings confirm and extend previous data concerning the association of EBV with lymphoproliferative disorders in HIV-1+ subjects,4,7,14,15 and for the first time document the presence of multiple EBV strains and variants differing in EBNA2 and LMP1 genes in a single lymphadenopathy lesion.

Although the detection of both EBV types 1 and 2 in the lymphadenopathies is highly suggestive of exogenous reinfection by different strains, LMP1 variants differing in the number of 33-bp repeats could alternatively be generated by intrastrain homologous recombination during viral replication.10 However, in three cases we found coinfection with two LMP1 variants that differed both in the number of repeats and for the presence or absence of the 15-bp insertion; one of these cases also gave discordant results upon EBNA2 and EBNA3C gene analysis, suggesting that these variants arose from interstrain recombination. Interstrain and intrastrain EBV recombinants were recently documented in EBV+ oral hairy leukoplakia lesions, leading to the proposal that recombination might lead to the generation of more pathogenic variants.33 Intertypic EBV recombinants have also been isolated from blood of HIV-1–infected subjects34; thus, a functional role of the heterogeneous EBV population in the pathogenesis of lymphadenopathy lesions might be proposed as well.

Unlike some reports,5,6 but in agreement with others19 and consistent with the detection of multiple EBV variants, all the lymphadenopathy lesions showed a polyclonal rearrangement of the Ig heavy chain genes. Conversely, all but one EBV+ lymphoma harbored a single EBV variant, thus implying a selective expansion of a single EBV+ cell clone. Indeed, in agreement with other studies,15,35 analysis of Ig heavy chain gene rearrangements confirmed a monoclonal proliferation in most of the lymphomas we studied; moreover, Southern blot detection of only a single episomal form of EBV in these cases strongly indicated that EBV infection preceded transformation.

Although type 2 variants were detected in approximately one third of the EBV+ lymphadenopathies (7 of 25) and mostly in association with EBV type 1 variants, it is noteworthy that 3 of 4 EBV+ Burkitt-like lymphomas, but none of the large cell lymphomas, carried a single EBV type 2 variant. This finding disagrees with previous reports of either type 1 or type 2 in both types of neoplastic lesions.14,15 Given that EBV type 2 transforms B lymphocytes less efficiently than type 1,13,36 it has been proposed that an immunodeficient status in the host might improve its oncogenic potential. Although possible differences in the study groups might explain this variance, it is noteworthy that all of our patients with large cell lymphoma had less than 200 CD4+ cells/μL.

It is generally agreed that Burkitt-like lymphomas express only EBNA1 protein4,7,15,20 (and our unpublished observations, 1996). In contrast, the data regarding EBV expression in large cell lymphomas are discordant. Although some workers reported LMP1 but not EBNA2 expression,19,37 we found both LMP1 and EBNA2 transcripts, in agreement with others.7 EBNA2 constitutes the principal determinant of the biologic difference that enables type 1 strains to transform B cells in vitro more efficiently than type 2 strains.38 Therefore, the different distribution of EBV types in the Burkitt-like and large cell lymphomas, combined with the detection of EBNA2 expression in the neoplastic samples mostly infected by EBV type 1, strongly suggests that the two EBV types play different roles in HIV-1–related malignancies, and that EBNA2 expression contributes to the oncogenic process in large cell lymphomas.

Although LMP1 protein is not significantly different in the two EBV types, it is thought to play a central role in B-cell transformation. The LMP1 gene product promotes B-cell proliferation39 and protects B cells from apoptosis.40 We detected LMP1 gene expression not only in large cell lymphomas, but also in half of the lymphadenopathy cases, albeit at lower levels, with or without coexpression of the EBNA2 gene. Because the detection and amounts of the mRNAs did not correlate with the amount of EBV DNA, the different patterns of EBV expression in these lesions probably represent a selective rather than a merely quantitative process. The inability to detect EBNA2 and LMP1 proteins in lymphadenopathies by immunohistochemical analysis19 had brought into question the role of EBV in these lesions and as a risk factor for the subsequent development of lymphoma. HIV-1 is known to actively and persistently infect lymph nodes, and it has been advanced that chronic antigenic stimulation by the virus might drive development of lymphadenopathy syndrome.41 The detection of EBV transcripts in half of the lymphadenopathies that we tested suggests that EBV also plays an important role in the polyclonal proliferations that characterize lymphadenopathy lesions, either directly, by promoting B-cell survival and proliferation, or indirectly, by inducing EBV-mediated antigenic stimulation. Overall, our findings not only strengthen the notion that lymphomas arise from a clonal expansion of EBV+ cells, but also suggest different roles for EBV types 1 and 2 in HIV-1–related lymphoproliferative disorders.

ACKNOWLEDGMENT

We thank Sandra Cargnin, Monica Quaggio, and Daniela Zullato for technical assistance, Pierantonio Gallo for artwork, and Patricia Segato and Donna D'Agostino for help in preparing the manuscript.

Supported by grants from AIRC (1995 and 1996), and by grants from Istituto Superiore di Sanità, Progetto AIDS (1995 and 1996). The Oncology Section participated in the Human Capital and Mobility Research Network (ERBCHRXCT940651).

Address reprint requests to Anita De Rossi, PhD, Department of Oncology and Surgical Sciences, Oncology Section, University of Padova, Via Gattamelata 64, 35128 Padova, Italy.

REFERENCES

REFERENCES
1
Levine
AM
AIDS-related malignancies: The emerging epidemic.
J Natl Cancer Inst
85
1993
1382
2
Harris
NL
Jaffe
ES
Stein
H
Banks
PM
Chan
JKC
Cleary
M
Delsol
G
De Wolf-Peeters
C
Falini
B
Gatter
KC
Grogan
TM
Isaacson
PC
Knowles
DM
Mason
DY
Muller-Harmelink
HK
Pileri
SA
Piris
MA
Ralfkiaer
E
Warnke
RA
A revised European-American classification of lymphoid neoplasms: A proposal from the International Lymphoma Study Group.
Blood
84
1994
1361
3
Beral
V
Petterman
T
Berkelman
R
Jaffe
H
AIDS-associated non-Hodgkin lymphoma.
Lancet
337
1991
805
4
Shibata
M
Wiess
LM
Nathwani
BN
Brynes
RK
Levine
AM
Epstein-Barr virus in benign lymph node biopsies from individuals infected with the human immunodeficiency virus is associated with concurrent or subsequent development of non-Hodgkin's lymphoma.
Blood
77
1991
1527
5
Pelicci
PG
Knowles
DM
Arlin
ZA
Wieczorek
R
Luciw
P
Dina
D
Basilico
C
Dalla
Favera R
Multiple monoclonal B cell expansions and c-myc oncogene rearrangements in acquired immunodeficiency syndrome-related lymphoproliferative disorders. Implication for lymphomagenesis.
J Exp Med
164
1986
2049
6
Saglio
G
Foa
R
Guerrasio
A
Di Celle
PF
Palestro
G
Sinicco
A
Gobbi
M
Gavosto
F
Immunoglobulin and myc gene structure in lymph node biopsies from HIV-positive patients with LAS and lymphoma.
Cancer Detect Prev
14
1990
359
7
Hamilton-Dutoit
SJ
Raphael
M
Audouin
J
Diebold
J
Lisse
I
Pedersen
C
Oksenhendler
E
Marelle
L
Pallesen
G
In situ demonstration of Epstein-Barr virus small RNAs (EBER1) in acquired immunodeficiency syndrome-related lymphomas: Correlation with tumor morphology and primary site.
Blood
82
1993
619
8
Rickinson AB, Kieff E: Epstein-Barr virus, in Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, Roizman B, Straus SE (eds): Virology, vol 2. Philadelphia, PA, Lippincott-Raven, 1996, p 2397
9
Dambaugh
T
Hennessy
K
Chamnankit
L
Kieff
E
U2 region of Epstein-Barr virus DNA may encode Epstein-Barr nuclear antigen 2.
Proc Natl Acad Sci USA
81
1984
7632
10
Miller
WE
Edwards
RH
Walling
DM
Raab
Traub N
Sequence variation in the Epstein-Barr virus latent membrane protein 1.
J Gen Virol
75
1994
2729
11
Walling
DM
Perkins
AG
Webster-Cyriaque
J
Resnick
L
Raab-Traub
N
The Epstein-Barr virus EBNA-2 gene in oral hairy leukoplakia: Strain variation, genetic recombination, and transcriptional expression.
J Virol
68
1994
7918
12
Menin
C
Ometto
L
Veronesi
A
Roncella
S
Corneo
B
Montagna
M
Coppola
V
Veronese
ML
Indraccolo
S
Amadori
A
De Rossi
A
Ferrarini
M
Chieco-Bianchi
L
D'
Andrea E
Analysis of Epstein-Barr virus (EBV) type and variant in spontaneous lymphoblastoid cells and hu-scid mouse tumors.
Mol Cell Probes
10
1995
443
13
Rickinson
AB
Young
LS
Rowe
M
Influence of the Epstein-Barr virus nuclear antigen EBNA2 on the growth phenotype of virus transformed B cells.
J Virol
61
1987
1310
14
Boyle
MJ
Sewell
WA
Sculley
TB
Apolloni
A
Turner
JJ
Swanson
CE
Penny
R
Cooper
DA
Subtypes of Epstein-Barr virus in human immunodeficiency virus-associated non-Hodgkin lymphoma.
Blood
78
1991
3004
15
Shibata
M
Wiess
LM
Hernandez
AM
Nathwani
BN
Bernstein
L
Levine
AM
Epstein-Barr virus associated non-Hodgkin's lymphoma in patients with the human immunodeficiency virus.
Blood
81
1993
2102
16
Sculley
TB
Apolloni
A
Hurren
L
Moss
DJ
Cooper
DA
Coinfection with A- and B-type Epstein-Barr virus in human immunodeficiency virus-positive subjects.
J Infect Dis
162
1990
643
17
Buisson
M
Morand
P
Genoulaz
O
Bourgeat
MJ
Micoud
M
Seigneurin
JM
Changes in the dominant Epstein-Barr virus type during human immunodeficiency virus infection.
J Gen Virol
75
1994
431
18
Yao
QY
Tierney
RJ
Croom-Carter
D
Dukers
D
Cooper
GM
Ellis
CJ
Rowe
M
Rickinson
AB
Frequency of multiple Epstein-Barr virus infections in T-cell-immunocompromised individuals.
J Virol
70
1996
4884
19
Dolcetti
R
Gloghini
A
De Vita
S
Vaccher
E
De Re
V
Tirelli
U
Carbone
A
Boiocchi
M
Characteristics of EBV-infected cells in HIV-related lymphadenopathy: Implications for the pathogenesis of EBV-associated and EBV-unrelated lymphomas of HIV-seropositive individuals.
Int J Cancer
63
1995
652
20
Carbone
A
Tirelli
U
Gloghini
A
Volpe
R
Boiocchi
M
Human immunodeficiency virus-associated systemic lymphomas may be subdivided into two main groups according to Epstein-Barr viral latent gene expression.
J Clin Oncol
11
1993
1674
21
The
Non-Hodgkin's Lymphoma Pathologic Classification Project
National Cancer Institute sponsored study of classifications of non-Hodgkin's lymphomas.
Cancer
49
1982
2112
22
Kallio
P
Syrjanen
S
Tervahauta
A
Syrjanen
K
A simple method for isolation of DNA from formalin-fixed paraffin-embededd samples for PCR.
J Virol Methods
35
1991
39
23
Veronesi
A
Coppola
V
Veronese
ML
Menin
C
Bruni
L
D'Andrea
E
Mion
M
Amadori
A
Chieco-Bianchi
L
Lymphoproliferative disease in human peripheral-blood-mononuclear-cell-injected SCID mice. II. Role of host and donors factors in tumor generation.
Int J Cancer
59
1994
676
24
Menin
C
Ometto
L
Veronesi
A
Montagna
M
Coppola
V
Veronese
ML
Indraccolo
S
Bruni
L
Corneo
B
Amadori
A
De Rossi
A
Chieco-Bianchi
L
D'Andrea
E
Dominance of a single Epsterin-Barr virus strain in SCID-mouse tumors induced by injection of peripheral blood mononuclear cells from healthy human donors.
Virus Res
36
1995
215
25
Ometto
L
Zanotto
C
Maccabruni
A
Caselli
D
Truscia
D
Giaquinto
C
Ruga
E
Chieco-Bianchi
L
De Rossi
A
Viral phenotype and host-cell susceptibility to HIV-1 infection as risk factors for mother-to-child HIV-1 transmission.
AIDS
9
1995
427
26
Miller
G
Coope
D
Niederman
J
Pagano
J
Biological properties and viral surface antigens of Burkitt lymphoma and mononucleosis-derived strains of Epstein-Barr virus related from transformed marmoset cells.
J Virol
18
1976
1071
27
Fenwald
S
van Santen
V
Kieff
E
Nucleotide sequence of an mRNA transcribed in latent growth transforming virus infection indicates that it may encode a membrane protein.
J Virol
51
1984
411
28
Brooks
L
Yao
QY
Rickinson
AB
Young
LS
Epstein-Barr virus latent gene transcription in nasopharyngeal carcinoma cells: Coexpression of EBNA1, LMP1, and LMP2 transcripts.
J Virol
66
1992
2689
29
Longnecker
R
Miller
CL
Regulation of Epstein-Barr virus latency by latent membrane protein 2.
Trends Microbiol
4
1996
38
30
Chen
CL
Sadler
RH
Walling
DM
Su
IJ
Hsieh
HC
Raab-Traub
N
Epstein-Barr virus (EBV) gene expression in EBV-positive peripheral T-cell lymphomas.
J Virol
67
1993
6303
31
Joab
J
Triki
H
De Saint
Martin J
Perricaudet
M
Nicolas
JC
Detection of anti-Epstein-Barr virus transactivator (ZEBRA) antibodies in sera from patients with the human immunodeficiency virus.
J Infect Dis
163
1991
53
32
Brousset
P
Drouet
E
Schlaifer
D
Icart
J
Payen
C
Meggetto
F
Marchou
B
Massip
P
Delsol
G
Epstein-Barr virus (EBV) replicative gene expression in tumour cells of AIDS-related non-Hodgkin's limphoma in relation to CD4 cell number and antibody titres to EBV.
AIDS
8
1994
583
33
Walling
DM
Clark
NM
Markovitz
DM
Frank
TS
Braun
DK
Eisenberg
E
Krutchkoff
DJ
Felix
DH
Raab-Traub
N
Epstein-Barr virus coinfection and recombination in non-human immunodeficiency virus-associated oral hairy leukoplakia.
J Infect Dis
171
1995
1122
34
Yao
QY
Tierney
RJ
Croom-Carter
D
Cooper
GM
Ellis
CJ
Rowe
M
Rickinson
AB
Isolation of intertypic recombinants of Epstein-Barr virus from T-cell immunocompromised individuals.
J Virol
70
1996
4895
35
Neri
A
Barriga
F
Inghirami
G
Knowles
DM
Neequaye
J
Magrath
IT
Dalla
Favera R
Epstein-Barr virus infection precedes clonal expansion in Burkitt's and acquired immunodificiency associated-lymphoma.
Blood
77
1991
1092
36
Rowe
M
Young
LS
Crocker
J
Stokes
H
Henderson
S
Rickinson
AB
Epstein-Barr virus (EBV)-associated lymphoproliferative disease in the SCID mouse model: Implications for the pathogenesis of EBV positive lymphomas in man.
J Exp Med
173
1991
147
37
Hernandez
AM
Shibata
D
Epstein-Barr virus-associated non-Hodgkin's lymphoma in HIV-infected patients.
Leuk Lymphoma
16
1995
217
38
Cohen
J
Wang
F
Mannick
J
Kieff
E
Epstein-Barr virus nuclear protein 2 is a key determinant of lymphocyte transformation.
Proc Natl Acad Sci USA
86
1989
9558
39
Mosialos
G
Birkenbach
M
VanArsdale
T
Ware
C
Yalamanchili
R
Kieff
E
The Epstein-Barr virus transforming protein LMP1 engages signaling proteins for the tumor necrosis factor receptor family.
Cell
80
1995
389
40
Henderson
S
Rowe
M
Gregory
C
Croom-Carter
D
Wang
F
Longnecker
R
Kieff
E
Rickinson
A
Induction of bcl-2 expression by Epstein-Barr virus latent membrane protein-1 protects infected B cells from programmed cell death.
Cell
65
1991
1107
41
Pantaleo G, Graziosi C, Fauci AS: The role of lymphoid organs in the immunopathogenesis of HIV infection. AIDS 7:S19, 1993 (suppl)