• We describe a novel homozygous mutation in exon 2 of the VHL gene causing congenital polycythemia.

  • We demonstrate the VHLP138L effect on the augmentation of erythropoiesis, along with structural and functional studies of this mutation.

Germline von Hippel–Lindau (VHL) gene mutations underlie dominantly inherited familial VHL tumor syndrome comprising a predisposition for renal cell carcinoma, pheochromocytoma/paraganglioma, cerebral hemangioblastoma, and endolymphatic sac tumors. However, recessively inherited congenital polycythemia, exemplified by Chuvash polycythemia, has been associated with 2 separate 3′ VHL gene mutations in exon 3. It was proposed that different positions of loss-of-function VHL mutations are associated with VHL syndrome cancer predisposition and only C-terminal domain-encoding VHL mutations would cause polycythemia. However, now we describe a new homozygous VHL exon 2 mutation of the VHL gene:(c.413C>T):P138L, which is associated in the affected homozygote with congenital polycythemia but not in her, or her-heterozygous relatives, with cancer or other VHL syndrome tumors. We show that VHLP138L has perturbed interaction with hypoxia-inducible transcription factor (HIF)1α. Further, VHLP138L protein has decreased stability in vitro. Similarly to what was reported in Chuvash polycythemia and some other instances of HIFs upregulation, VHLP138L erythroid progenitors are hypersensitive to erythropoietin. Interestingly, the level of RUNX1/AML1 and NF-E2 transcripts that are specifically upregulated in acquired polycythemia vera were also upregulated in VHLP138L granulocytes.

The von Hippel-Lindau (VHL) tumor suppressor gene encodes a multifunctional protein that interacts with diverse partners and promotes degradation of hypoxia-inducible transcription factors (HIFs) by facilitating their ubiquitinization and eventual proteasomal degradation. Germline dominantly inherited mutations in VHL predispose patients to highly vascularized malignant tumors, including renal cell carcinoma of the clear-cell type, hemangioblastoma, and pheochromocytoma/paraganglioma.1,2  Less frequently, VHL mutations have been associated with benign tumors, including those of the inner ear (endolymphatic sac tumor), pancreas (pancreatic cysts, serous cystadenoma, and pancreatic neuroendocrine tumors), and testes (epididymal cystadenomas).2  The incidence of VHL disease is thought to be about 1 in 36 000 births with an estimated de novo mutation rate of 4.4 × 10−6 gametes per generation.3  VHL tumors generally develop after age of 124  and have more than 90% penetrance in the highest age classes (96% at 51–60 years of age, 99% at 61–70 years of age).3 

Polycythemia (also known as erythrocytosis) is characterized by an increased red cell blood mass. Polycythemias can be primary or secondary. Primary polycythemias are caused by somatic or germline mutations leading to changes within the erythroid progenitors causing an augmented response to erythropoietin (EPO). Secondary polycythemias are caused by either an appropriate or inappropriate increase in the red cell mass as a result of augmented levels of EPO. In Chuvash polycythemia, the first known congenital disorder of hypoxia-sensing,5  erythroid progenitors in in vitro cultures are hypersensitive to EPO; thus, Chuvash polycythemia shares features of both primary and secondary polycythemia.6 

Because different positions of loss-of-function mutations of the VHL gene are associated with different type of cancers, it has been proposed that only C-terminal domain–encoding VHL mutations would cause polycythemia.7  There are 2 known homozygous VHL gene mutations causing polycythemia that are not associated with any VHL syndrome malignant or benign tumors; these are the VHLR200W mutation, constituting the disorder of augmented hypoxia-sensing in normoxia (ie, Chuvash polycythemia5 ) and the VHLH191D mutation found in a Croatian subject.8  Both are located in the distal portion of exon 3 of the VHL gene in its C-terminal domain. In addition, there are several reports of compound heterozygotes associated with congenital polycythemia, 3 in combination with VHLR200W mutation, and others employing different exon 3 VHL missense mutations (Table 1).9,,,-13  It has been suggested that the genomic configuration of the 3′ region of VHL exon 3 gene has a specific erythropoiesis-promoting effect independent of EPO by Janus Kinase-2 (JAK2) hyperactivation, because JAK2 is the crucial component of intracellular activation of EPO/EPO receptor signaling.14  Compatible with this report, to date no congenital polycythemia associated with VHL homozygous or compound heterozygous mutations outside of VHL exon 3 have been described. We now challenge this premise by reporting a family with congenital polycythemia with a new homozygous VHL mutation in exon 2 along with structural and functional studies of the mutation (Figure 1).

Table 1

Homozygous and compound heterozygous VHL mutations in individuals with erythrocytosis/polycythemia reported in the literature

VHL genotypeEthnicityNotes
Compound heterozygous VHL genotype    
 235 C→T/586 C→G R79C/L188V Caucasian9   
 376 G→A/548 C→T D126N/S183L British10   
 598 C→T/574 C→T R200W/P192A American (white)11   
 598 C→T/562 C→G R200W/L188V American (white)11   
 598 C→T/388 G→C R200W/V130L American (white)8   
Homozygous VHL genotype    
 598 C→T/598 C→T R200W/R200W Chuvash,5  Italian,12  Danish,11  German,13  Turkish,13  American (white)11  Frequent thrombotic complications 
 571 C→G/571 C→G H191D/H191D Croatian11,27   
 413 C→T/413 C→T P138L/P138L Punjabi  
VHL genotypeEthnicityNotes
Compound heterozygous VHL genotype    
 235 C→T/586 C→G R79C/L188V Caucasian9   
 376 G→A/548 C→T D126N/S183L British10   
 598 C→T/574 C→T R200W/P192A American (white)11   
 598 C→T/562 C→G R200W/L188V American (white)11   
 598 C→T/388 G→C R200W/V130L American (white)8   
Homozygous VHL genotype    
 598 C→T/598 C→T R200W/R200W Chuvash,5  Italian,12  Danish,11  German,13  Turkish,13  American (white)11  Frequent thrombotic complications 
 571 C→G/571 C→G H191D/H191D Croatian11,27   
 413 C→T/413 C→T P138L/P138L Punjabi  
Figure 1

The schematic structure of the VHL gene. Sequencing of the second exon of the VHL gene revealed c.413C>T:P138L homozygous VHL mutation in the propositus, which was inherited from her parents, both VHLP138L heterozygous. UTR, untranslated region.

Figure 1

The schematic structure of the VHL gene. Sequencing of the second exon of the VHL gene revealed c.413C>T:P138L homozygous VHL mutation in the propositus, which was inherited from her parents, both VHLP138L heterozygous. UTR, untranslated region.

Patient samples

The propositus is a 15-year-old girl of Asian Indian extraction (Punjabi ethnicity), who has been known to be polycythemic from infancy. Her parents are hematologically normal and are of the same ethnicity but not known to be related. Peripheral blood of the propositus and her parents was obtained by venipuncture after obtaining a signed Institutional Review Board informed consent in accordance with the Declaration of Helsinki. This study received approval from Institutional Review Board protocol #17665; molecular biology of polycythemia and thrombocytosis. Granulocyte and mononuclear cell fractions were isolated according to a previously published protocol.15 

Mutation screening

Genomic DNA was isolated from granulocytes using Gentra-Puregene Kit (Qiagen, Germantown, MD), and VHL gene was amplified using Hot Star Master Mix (Qiagen) and the following primers: VHL_exon1_F 5′CGAAGACTACGGAGGTC GAC; VHL_exon1_R 5′GGCTTCAGACCGTGCTATCG; VHL_exon2_F 5′GTGTGGCTCTTTAACAACC; VHL_exon2_R 5′CTGTACTTACCACAACAACC; VHL_exon3_F 5′TCCTTGTACTGAGACCCTAG; and VHL_exon3_R 5′AGCTGAGATGAAACAGTCTA. Sequencing was performed using the same amplification primers and protocol established by the University of Utah, Core DNA Sequencing Facility.

In vitro assay of erythroid progenitors’ sensitivity to EPO

In vitro sensitivity of erythroid progenitors to EPO was performed on mononuclear cells isolated from the peripheral blood using Histopaque (Sigma-Aldrich, St. Louis, MO) density gradient centrifugation and plating (2.3 × 105/mL) to methylcellulose media (MethoCult H4531; StemCell Technologies, Vancouver, BC) with addition of various concentrations of EPO (StemCell Technologies), ranging from 0.015 to 3.0 U/mL. Cell cultures were maintained in humidified atmosphere of 5% CO2 at 37°C for 14 days. Erythroid burst-forming unit colonies (BFU-Es) were scored by standard morphologic criteria. The number of BFU-Es grown in individual concentrations of EPO was expressed as a percentage of maximum vs the concentration of EPO. Maximum growth (100%) represents the highest colony number grown in culture. The assay was carried out on erythroid progenitors from a VHLP138L-homozygous patient (n = 1), from patient with heterozygous gain-of-function HIF2αM535V mutation (n = 1), and 8 healthy controls (n = 8). Results for healthy controls are pooled and T bars designate standard deviations.

Quantitative analysis of HIF target genes expression

RNA was isolated from the patient’s granulocytes using TRI reagent and residual DNA was removed by DNA-free DNase Treatment & Removal Reagents (Ambion, Life Technologies, NY). Gene expression experiments were performed on a FastPCR 7500 instrument using TaqMan Gene Expression assays TFRC (Hs00951083), SLC2A1 (Hs00892681), HK1 (Hs00175976), RUNX1 (Hs00231079), NF-E2 (Hs00232351), and reference genes HPRT (4333768F) and GAPDH (4333764F). All samples were investigated in triplicate. The data represent the mean of 3 independent experiments; T bars designate SEM. The statistical significance of relative expression changes of target mRNA levels was analyzed using REST 2009 software.16 

Cell culture, plasmids, and transfection

The 786-0 renal cell carcinoma cell line was purchased from ATCC (CRL-1932; Manassas, VA) and VHL human cDNA open reading frame clone was obtained from OriGene (RC216151; Rockville, MD). Site-directed mutagenesis was performed using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) and allele-specific oligonucleotides for VHLP138L and VHLH191D mutations. Transfection of mutated and empty plasmids was done using Lipofectamine 2000 reagent (Invitrogen, Life Technologies). Cells were selected 48 hours after transfection using 1 mg/mL G418 (Invitrogen, Life Technologies) and cultured for 21 days. Resistant clones were isolated using 96-well limiting dilution. Thirty single clones were picked up for each VHL construct and tested for expression of VHL(Myc-DDK) by TaqMan Gene Expression assay on demand (Applied Biosystems, Carlsbad, CA).

Determination of pVHL stability

To determine the half-life of protein VHL (pVHL), 786-0 stable transfected clones (VHLwt, VHLP138L, and VHLH191D) were treated with 200 μM cycloheximide (Sigma-Aldrich) and cells were harvested at different time points (0, 2, 4, 6, 8, and 10 hours). Western blot was performed with antibodies VHL (FL-181, Santa Cruz, 1:500) and actin (Sigma-Aldrich, 1:1000). Quantitation of pVHL signals was performed using densitometric analysis by ImageJ software according to the software manual.17  The data represent the mean of 3 independent experiments; T bars designate standard deviations.

Structural and energetic modeling

Computational analysis (molecular graphics, structural manipulations, energy minimization, molecular docking, and molecular dynamics simulations) were carried out using Internal Coordinate Mechanics molecular modeling program (Molsoft, La Jolla, CA). Energy grids representing the active site (van der Waals, hydrogen bonding, electrostatics, and hydrophobic interactions) were calculated with 0.5 Å grid spacing, and protein ligand docking experiments were performed using the defined site map–binding pocket with the application of our docking workflow.18 

Immunoprecipitation assay

HIF1α ubiquitination and pVHL binding was determined through immunoprecipitation assay as previously described.19,20  Briefly, 786-0 cells were co-transfected with VHL plasmids (VHLwt, VHLP138L, VHLH191D, and VHLR200W) together with hemagglutinin (HA)-tagged HIF1α plasmid using Lipofectamine 2000 (Invitrogen; Life Technologies). Cells were lysed in either NP40 lysis buffer for pVHL binding or radio-immunoprecipitation assay lysis buffer supplemented with 1% sodium dodecyl sulfate for ubiquitination assay. Lysate was immunoprecipitated using Protein G Dynabeads co-immunoprecipitation kit (Invitrogen, Life Technologies) and anti-HA antibody (Covance, Gaithersburg, MD). Bound protein was eluted in loading buffer supplemented with 1% sodium dodecyl sulfate. Eluents were subsequently analyzed by western blot and quantitation of signals was performed using densitometric analysis by ImageJ software.

VHLP138L mutation

We report a novel homozygous variant of the VHL gene located in the middle of exon 2: c.413C>T, VHLP138L. The propositus is a 15-year-old Punjabi female with congenital polycythemia (hemoglobin 19-20 g/dL), elevated EPO at 40 mIU/mL, no evidence of high-affinity hemoglobin mutations or 2,3-DPG deficiency as determined by a normal p50,21  and absence of JAK2V617F or exon 12 JAK2 mutations. Her parents were found to be VHLP138L heterozygous. No VHL syndrome malignant or benign tumors have been encountered in the propositus’ parents or in their extended family.

In vitro analysis of VHLP138L native erythroid progenitors

We then analyzed the VHLP138L propositus early erythroid progenitors in BFU-E assay and found them to be hypersensitive to EPO (a feature of primary polycythemias), as shown in Figure 2.

Figure 2

Response of BFU-E erythroid progenitors to EPO. EPO dose–response curves derived from the homozygous VHLP138L patient (▵), patient with heterozygous gain-of-function HIF2αM535V mutation (□), and healthy controls (●; n = 8, T bars = SD). VHLP138L-affected erythroid progenitors display hypersensitivity to low concentration of EPO (15–60 mU/mL). There was a relatively higher number of BFU-Es in comparison with healthy controls (number of colonies ± SD) in all analyzed EPO concentrations. The assays of VHLP138L and HIF2αM535V erythroid progenitors were not done concomitantly.

Figure 2

Response of BFU-E erythroid progenitors to EPO. EPO dose–response curves derived from the homozygous VHLP138L patient (▵), patient with heterozygous gain-of-function HIF2αM535V mutation (□), and healthy controls (●; n = 8, T bars = SD). VHLP138L-affected erythroid progenitors display hypersensitivity to low concentration of EPO (15–60 mU/mL). There was a relatively higher number of BFU-Es in comparison with healthy controls (number of colonies ± SD) in all analyzed EPO concentrations. The assays of VHLP138L and HIF2αM535V erythroid progenitors were not done concomitantly.

The effect of VHLP138L mutation on HIFs signaling

The accumulation of transcripts of HIF-regulated target genes, including those for glucose transporter-1 (SLC2A1), transferrin receptor (TFRC), and hexokinase-1 (HK1), was measured in the propositus’ granulocytes. As shown in Figure 3A, the transcripts of these HIF-regulated genes were significantly increased.

Figure 3

Relative expression of HIF target genes induced by hypoxia and AML1/RUNX1 and NF-E2 genes. (A) Expression of TFRC, SLC2A1, and HK1 genes and (B) AML1/RUNX1 and NF-E2 genes was evaluated by quantitative polymerase chain reaction in granulocytes isolated from homozygous patient for VHLP138L mutation (grey columns), and normal controls (n = 8, white columns). Data are normalized to HPRT and GAPDH reference genes. T bars = SEM. *P < .01.

Figure 3

Relative expression of HIF target genes induced by hypoxia and AML1/RUNX1 and NF-E2 genes. (A) Expression of TFRC, SLC2A1, and HK1 genes and (B) AML1/RUNX1 and NF-E2 genes was evaluated by quantitative polymerase chain reaction in granulocytes isolated from homozygous patient for VHLP138L mutation (grey columns), and normal controls (n = 8, white columns). Data are normalized to HPRT and GAPDH reference genes. T bars = SEM. *P < .01.

RUNX1/AML1 transcript levels in granulocytes

The upregulation of RUNX1/AML1 transcript levels was reported in erythroid progenitors and granulocytes and claimed to be specific for an acquired polycythemic disorder (ie, polycythemia vera [PV]) and to be responsible for PV EPO hypersensitivity.22,23  However, we considered the possibility that the increased transcripts of these genes may be a feature associated with other primary polycythemic states with increased EPO sensitivity.8  We thus analyzed RUNX1/AML1 and NF-E2 transcripts in the propositus and found them to be increased (Figure 3B).

In vitro analysis of VHLP138L effect in VHL-null 786-0 renal carcinoma cells

We analyzed the effect of homozygosity of VHLP138L on pVHL stability. Renal carcinoma cells 786-0, which do not express a detectable pVHL, were stably transfected with plasmids expressing VHLwt, VHLP138L, and VHLH191D proteins. Mutant and wild-type cell lines were treated with cycloheximide (CHX) for different lengths of time and pVHL levels were determined by western blot. We show a decreased stability of both mutated VHL peptides (VHLP138L and VHLH191D) in the transfected cells (Figure 4).

Figure 4

CHX assay measuring pVHL stability, showing mutant VHL proteins decreased half-life in vitro. The 786-0 cells were stably transfected with plasmids expressing VHLwt, VHLP138L, and VHLH191D mutants. Clones were treated with cycloheximide (CHX, 200 μM) for 0, 2, 4, 6, 8, and 10 hours, and lysates were subjected to western blot as indicated. Actin was used as the loading control. (Right) The relative quantitation of pVHL.

Figure 4

CHX assay measuring pVHL stability, showing mutant VHL proteins decreased half-life in vitro. The 786-0 cells were stably transfected with plasmids expressing VHLwt, VHLP138L, and VHLH191D mutants. Clones were treated with cycloheximide (CHX, 200 μM) for 0, 2, 4, 6, 8, and 10 hours, and lysates were subjected to western blot as indicated. Actin was used as the loading control. (Right) The relative quantitation of pVHL.

Molecular dynamics simulation study of VHLP138L mutation effect

Molecular dynamics simulation showed that the VHLP138L mutation, which lies in the catalytic HIF1α peptide ligand–binding region, perturbs HIF1α/pVHL interaction because of the conformational effect on the Trp117 and Ser111 residues (Figure 5A-B), both within 2.8 to 4.3 Å distance from the mutated Leu138. The effect of this single mutation on overall structure was calculated as a shift of 1.9 Å root mean square deviation from the wild-type complex structure. Our model also predicted that HIF1α binding energy would change from −34.86 kcal/mol to −29.84 kcal/mol, mainly from the loss of 2 ligand hydrogen-bonding interactions within the residues Ser111 and Arg107.

Figure 5

Molecular dynamics simulations study of pVHL–ElonginC–ElonginB complex and interaction with HIF1α. (A) Superimposition of wild-type (wt; grey) and mutated pVHL (green) is shown. The wt P138 (violet) and mutated L138 (green) sites and the critical active site residues for the HIF1α peptide (PDB:1LM8)-binding region are depicted. The P138L mutation perturbs pHIF1α interactions with pVHL because of the conformational effect on the W117 and S111 residues (orange) at 2.8 to 4.3 Å distance from mutated L138. (B) Detail superimposition of wt and P138L pVHL in the interaction with HIF1α.

Figure 5

Molecular dynamics simulations study of pVHL–ElonginC–ElonginB complex and interaction with HIF1α. (A) Superimposition of wild-type (wt; grey) and mutated pVHL (green) is shown. The wt P138 (violet) and mutated L138 (green) sites and the critical active site residues for the HIF1α peptide (PDB:1LM8)-binding region are depicted. The P138L mutation perturbs pHIF1α interactions with pVHL because of the conformational effect on the W117 and S111 residues (orange) at 2.8 to 4.3 Å distance from mutated L138. (B) Detail superimposition of wt and P138L pVHL in the interaction with HIF1α.

Immunoprecipitation assay of HIF1α ubiquitination and pVHL binding

To determine the effect of the Pro138Leu substitution on pVHL function, we carried out an in vitro ubiquitination assay. The level of HIF1α ubiquitination was markedly decreased in cells expressing all 3 mutant proteins (P138L, H191D, and R200W), with the highest reduction associated with pVHLP138L (Figure 6A). To further investigate the impact of the VHLP138L mutation on HIF1α signaling, we analyzed the binding of mutated pVHL to the HIF1α peptide. Radioactively labeled VHLP138L protein showed decreased affinity to HIF1α peptide (Figure 6B), with only 26.6% of the VHL protein bound. By comparison, the wild-type VHL protein (100%) and also proteins with other homozygous polycythemic mutations (H191D, R200W) have much stronger affinity for the HIF1α peptides, with 49.0% and 62.2% of the bound VHL protein, respectively. These data indicate that the P138L mutation specifically reduced the affinity of pVHL for HIF1α, resulting in a reduced rate of ubiquitination under nonhypoxic conditions.

Figure 6

Immunoprecipitation assay of HIF1α ubiquitination and VHL binding. The 786-0 cells were cotransfected with plasmids expressing pVHL (pCMV6 denotes empty plasmid without VHL open reading frames) and HA-tagged HIF1α. Total protein was extracted from cells and HIF1α was precipitated with magnetic beads coupled with anti-HA antibody. pVHL binding and HIF1α ubiquitination was then tested by western blot. Samples were run on the same gel but were noncontiguous, as indicated by white spaces.

Figure 6

Immunoprecipitation assay of HIF1α ubiquitination and VHL binding. The 786-0 cells were cotransfected with plasmids expressing pVHL (pCMV6 denotes empty plasmid without VHL open reading frames) and HA-tagged HIF1α. Total protein was extracted from cells and HIF1α was precipitated with magnetic beads coupled with anti-HA antibody. pVHL binding and HIF1α ubiquitination was then tested by western blot. Samples were run on the same gel but were noncontiguous, as indicated by white spaces.

We describe a new homozygous VHL exon 2 mutation, VHLP138L, which is associated in the affected homozygote with congenital polycythemia but not in her parents or her relatives, with cancer or other VHL syndrome tumors. This contrasts with reports of other heterozygous VHL mutations encoding the same amino acid residue (VHL P138R, P138T) that have been reported in VHL syndrome and renal cancer.24,-26  We also show that this mutation is not only associated with elevated EPO levels but also with a hallmark of primary polycythemia (ie, EPO hypersensitivity).

This novel, polycythemia-associated germline homozygosity for the hypomorphic VHLP138L allele, albeit present in a different domain of the VHL protein, has a similar erythropoiesis-stimulating effect to the Chuvash VHLR200W mutation in regard to EPO levels and BFU-Es EPO hypersensitivity (Table 2). It has been suggested that these features are due to a conformational change of SOCS1’s binding groove encoded by VHL gene’s exon 3. SOCS1 is a negative regulator of JAK2, and it has been suggested that the impaired interaction of VHLR200W and VHLH191D with SOCS1 is a cause of EPO hypersensitivity.9  However, this putative mechanism is contradicted by our data of EPO-hypersensitive VHLP138L erythroid progenitors (Figure 2) and also by the fact that VHLH191D native erythroid progenitors are not EPO hypersensitive,27  even though VHLH191D is located in the SOCS1’s binding groove.9  Further, our data reveal that some HIF2α gain-of-function mutation (c.1603A>G:M535V)28  also have EPO-hypersensitive erythroid progenitors. We conclude that the molecular mechanisms of EPO-hypersensitive stimulation of erythroid proliferation (a feature of primary polycythemia) remain unexplained and await further studies.

Table 2

Characteristics of patients with VHL homozygous mutation (adjusted to age)

VHL mutationAge, ySexHct, %MCV, (fL)EPO, (mIU/mL)In vitro assay
VHLP138L 15 Female 59.2 88.1 40 Hypersensitive 
VHLH191D Female 53.1 63.1 201.6 Normal27  
VHLR200W 16 Male 53.4 81.2 31 Hypersensitive27  
VHL mutationAge, ySexHct, %MCV, (fL)EPO, (mIU/mL)In vitro assay
VHLP138L 15 Female 59.2 88.1 40 Hypersensitive 
VHLH191D Female 53.1 63.1 201.6 Normal27  
VHLR200W 16 Male 53.4 81.2 31 Hypersensitive27  

We show that the loss of function of the VHLP138L mutation (as well as VHLH191D) is at least in part from decreased stability of VHL protein (Figure 4). Similar protein instability was previously shown for the Chuvash VHLR200W mutation.29  Further, our computer modeling of the pVHLP138L structure predicted significant interference with binding of the α subunit of the HIF1 peptide, which was confirmed by HIF1α ubiquitination and a pVHL-binding assay (Figure 6). These functional abnormalities would be expected to prolong the half-life of HIF1 or HIF2, essential transcriptional factors regulating hypoxia sensing. Indeed, this assumption is directly confirmed by the enhanced expression of HIF-regulated genes SLC2A1, TFRC, and HK-1 (Figure 3A). These data suggest that the impaired stability, together with reduced affinity for the HIF α subunit of the polycythemic pVHL mutants, are common features resulting in the delayed ubiquitinization and degradation of HIFs.30 

We also demonstrate that granulocytes from the VHLP138L subject have increased transcripts of RUNX1 and NF-E2 genes (Figure 3B). It was reported that increased transcription of NF-E2 is specific for the acquired primary polycythemic disorder, PV.22,23  Our results contradict this assumption. The nonspecificity of increased transcripts of these genes in PV is further supported by our unpublished data in the study of HIF2α germline gain-of-function mutation. These data suggest that the activation of RUNX1 and NF-E2 genes is likely secondary to augmented erythropoiesis in polycythemia and not a candidate “driver” of PV augmented erythropoiesis. It remains to be shown if the increased transcripts of these genes in PV may be due to augmentation of the hypoxia sensing pathway, also possibly present in PV.

This report provides further evidence for the heterogeneity of clinical phenotypes of VHL mutations resulting in cancers1  or in augmented erythropoiesis. The molecular basis of these differences remains unclear at this time. One can only speculate that the relatively small VHL peptide comprising 213 codons yet encoded by a large >11.2-kb VHL gene may have multiple functions, possibly from interactions with other modifying factors, which await future clarification. We submit that descriptions of families with congenital disorders and unique phenotypes resulting from VHL mutations provide an attractive opportunity for structure-function relationship analyses of VHL protein and lead to an enhanced understanding of polycythemic disorders and diseases of hypoxia sensing.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 USC section 1734.

This work was supported by the Czech Science Foundation (project P301/12/1503), the European Structural Funds (project CZ.1.07/2.3.00/20.0164) and by grant LF_2012_016 (L.L. and V.D.).

Contribution: L.L. designed the research, performed the research, analyzed data, and wrote the paper; F.L. performed the research and reviewed the paper; C.Y. performed the immunoprecipitation assay and wrote the paper; H.V. performed molecular dynamics simulations study and wrote the paper; R.D. recruited study subjects and reviewed the manuscript; V.D. analyzed data and reviewed the manuscript; and J.T.P. conceived the project, designed the study, and wrote the paper.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Josef T. Prchal, Division of Hematology, 30N 1900E, 5C402 SOM, University of Utah, Salt Lake City, UT 84132; e-mail: josef.prchal@hsc.utah.edu.

1
Bader
HL
Hsu
T
Systemic VHL gene functions and the VHL disease.
FEBS Lett
2012
586
11
1562
1569
2
Maher
ER
Neumann
HP
Richard
S
von Hippel-Lindau disease: a clinical and scientific review.
Eur J Hum Genet
2011
19
6
617
623
3
Maher
ER
Iselius
L
Yates
JR
et al
Von Hippel-Lindau disease: a genetic study.
J Med Genet
1991
28
7
443
447
4.
Nichols
K
Zelley
K
Hereditary Cancer Predisposition Program at the Cancer Center. Von Hippel-Lindau (VHL) syndrome. http://www.chop.edu/service/oncology/our-programs/hereditary-cancer-predisposition-program/genetic-syndromes-with-cancer-risks/von-hippel-lindau-syndrome.html. Accessed February 18, 2013
5
Ang
SO
Chen
H
Hirota
K
et al
Disruption of oxygen homeostasis underlies congenital Chuvash polycythemia.
Nat Genet
2002
32
4
614
621
6
Prchal
JT
Kaushansky
KLM
Kipps
TJ
Beutler
E
Seligsohn
U
Prchal
JT
Clinical manifestations and classification of erythrocyte disorders.
Williams Hematology
2010
New York, NY
McGraw Hill
455
463
7
Richards
FM
Molecular pathology of von Hippel-Lindau disease and the VHL tumour suppressor gene.
Expert Rev Mol Med
2001
2001
1
27
8
Pastore
YD
Jelinek
J
Ang
S
et al
Mutations in the VHL gene in sporadic apparently congenital polycythemia.
Blood
2003
101
4
1591
1595
9
Bento
MC
Chang
KT
Guan
Y
Liu
E
Caldas
G
Gatti
RA
Prchal
JT
Congenital polycythemia with homozygous and heterozygous mutations of von Hippel-Lindau gene: five new Caucasian patients.
Haematologica
2005
90
1
128
129
10
Bond
J
Gale
DP
Connor
T
et al
Dysregulation of the HIF pathway due to VHL mutation causing severe erythrocytosis and pulmonary arterial hypertension.
Blood
2011
117
13
3699
3701
11
Pastore
Y
Jedlickova
K
Guan
Y
et al
Mutations of von Hippel-Lindau tumor-suppressor gene and congenital polycythemia.
Am J Hum Genet
2003
73
2
412
419
12
Perrotta
S
Nobili
B
Ferraro
M
et al
Von Hippel-Lindau-dependent polycythemia is endemic on the island of Ischia: identification of a novel cluster.
Blood
2006
107
2
514
519
13
Cario
H
Schwarz
K
Jorch
N
et al
Mutations in the von Hippel-Lindau (VHL) tumor suppressor gene and VHL-haplotype analysis in patients with presumable congenital erythrocytosis.
Haematologica
2005
90
1
19
24
14
Russell
RC
Sufan
RI
Zhou
B
et al
Loss of JAK2 regulation via a heterodimeric VHL-SOCS1 E3 ubiquitin ligase underlies Chuvash polycythemia.
Nat Med
2011
17
7
845
853
15
Prchal
JT
Throckmorton
DW
Carroll
AJ
III
Fuson
EW
Gams
RA
Prchal
JF
A common progenitor for human myeloid and lymphoid cells.
Nature
1978
274
5671
590
591
16
Pfaffl
MW
Horgan
GW
Dempfle
L
Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR.
Nucleic Acids Res
2002
30
9
e36
17
ImageJ User Guide
IJ1.46. http://rsbweb.nih.gov/ij/docs/guide/index.html. Accessed February 18, 2013
18
Abagyan
R
Totrov
M
Kuznetsov
D
ICM—A new method for protein modeling and design–applications to docking and structure prediction from the distorted native conformation.
J Comput Chem
1994
15
5
488
506
19
Zhuang
Z
Yang
C
Lorenzo
F
et al
Somatic HIF2A gain-of-function mutations in paraganglioma with polycythemia.
N Engl J Med
2012
367
10
922
930
20
Yang
C
Sun
MG
Matro
J
et al
Novel HIF2A mutations disrupt oxygen sensing leading to polycythemia, paragangliomas and somatostatinomas.
Blood
2013
121
13
2563
2566
21
Beutler
E
The “ascorbate” effect on 2,3-DPG is known to be due to oxalate.
Vox Sang
2004
86
3
199
author reply 200
22
Mutschler
M
Magin
AS
Buerge
M
et al
NF-E2 overexpression delays erythroid maturation and increases erythrocyte production.
Br J Haematol
2009
146
2
203
217
23
Wang
W
Schwemmers
S
Hexner
EO
Pahl
HL
AML1 is overexpressed in patients with myeloproliferative neoplasms and mediates JAK2V617F-independent overexpression of NF-E2.
Blood
2010
116
2
254
266
24
Leonardi
E
Martella
M
Tosatto
SC
Murgia
A
Identification and in silico analysis of novel von Hippel-Lindau (VHL) gene variants from a large population.
Ann Hum Genet
2011
75
4
483
496
25
Gnarra
JR
Tory
K
Weng
Y
et al
Mutations of the VHL tumour suppressor gene in renal carcinoma.
Nat Genet
1994
7
1
85
90
26
Young
AC
Craven
RA
Cohen
D
et al
Analysis of VHL gene alterations and their relationship to clinical parameters in sporadic conventional renal cell carcinoma.
Clin Cancer Res
2009
15
24
7582
7592
27
Ljubas Tomasic
N
Piterkova
L
Huff
C
et al
Polycythemia due to Croatian homozygous VHL (571C>G:H191D) mutation has a different phenotype than Chuvash polycythemia (VHL 598C>T:R200W).
Haematologica
2013
98
4
560
567
28
Prchal
JT
Kaushansky
KLM
Kipps
TJ
Beutler
E
Seligsohn
U
Prchal
JT
Secondary polycythemia (erythrocytosis).
Williams Hematology
2010
New York, NY
McGraw Hill
823
839
29
Hickey
MM
Lam
JC
Bezman
NA
Rathmell
WK
Simon
MC
von Hippel-Lindau mutation in mice recapitulates Chuvash polycythemia via hypoxia-inducible factor-2alpha signaling and splenic erythropoiesis.
J Clin Invest
2007
117
12
3879
3889
30
Semenza
GL
Hypoxia-inducible factors in physiology and medicine.
Cell
2012
148
3
399
408