Abstract

Despite increasing knowledge on the regulation of hematopoietic stem/progenitor cell (HSPC) self-renewal and differentiation, in vitro control of stem cell fate decisions has been difficult. The ability to inhibit HSPC commitment in culture may be of benefit to cell therapy protocols. Small molecules can serve as tools to manipulate cell fate decisions. Here, we tested 2 small molecules, valproic acid (VPA) and lithium (Li), to inhibit differentiation. HSPCs exposed to VPA and Li during differentiation-inducing culture preserved an immature cell phenotype, provided radioprotection to lethally irradiated recipients, and enhanced in vivo repopulating potential. Anti-differentiation effects of VPA and Li were observed also at the level of committed progenitors, where VPA re-activated replating activity of common myeloid progenitor and granulocyte macrophage progenitor cells. Furthermore, VPA and Li synergistically preserved expression of stem cell–related genes and repressed genes involved in differentiation. Target genes were collectively co-regulated during normal hematopoietic differentiation. In addition, transcription factor networks were identified as possible primary regulators. Our results show that the combination of VPA and Li potently delays differentiation at the biologic and molecular levels and provide evidence to suggest that combinatorial screening of chemical compounds may uncover possible additive/synergistic effects to modulate stem cell fate decisions.

Introduction

Hematopoietic stem/progenitor cells (HSPCs) have a great clinical potential, but many of their applications are limited by insufficient numbers. Therefore, attempts have been made to define culture conditions, which would amplify stem cells in an uncommitted state and maintain their potential in vivo.1-3  However, so far there has been limited success in preventing HSPC commitment and differentiation in vitro without genetic manipulation (eg, overexpression of HoxB4, Bmi1, β-catenin).4-6  Alternatively, small molecules could be used as new tools for manipulating cell fate decisions. A number of these compounds have been identified to affect developmental processes, stem cell self-renewal and differentiation, or reprogramming efficiency of somatic cells to a pluripotent state.3,7-11  Two of such molecules, valproic acid (VPA) and lithium (Li), have been shown to affect normal and malignant hematopoiesis.12,13 

VPA is a pleiotropic histone deacetylase (HDAC) inhibitor (HDI), which can modulate histone acetylation by preventing its deacetylation.8  During commitment and differentiation, the chromatin structure of stem cells undergoes major epigenetic changes, which affect cellular transcriptional programs. Therefore, factors interfering with chromatin remodeling enzymes, such as HDIs, might modulate the behavior of stem and progenitor cells.14,15  For instance, it has been suggested that VPA can enhance stem cell proliferation, while retaining self-renewal in ex vivo stem cell expansion protocols.16-18  Furthermore, several groups suggested that HDIs can affect multilineage differentiation of hematopoietic cells.19-22  The hematopoietic effects of Li have been described for the first time in psychiatric patients, which included disturbed differentiation into several lineages and increased numbers of CD34+ cells.13,23,24  In vivo and in vitro studies with human and murine BM cells confirmed the stimulatory effects of Li on hematopoiesis.25,26  Furthermore, experimental findings suggest that Li can increase transplantable HSPCs in mice.25  Although the mechanism by which Li affects HSPCs is unclear, multiple molecular targets have been proposed, including glycogen synthase kinase 3β, a negative regulator of Wnt pathway.27  Wnt signaling, as well as epigenetic events, play an important role in control of HSPC fate decisions.6,14  Taken together, data suggest that VPA and Li might serve as chemical regulators of both stem cell maintenance and differentiation.

We hypothesized that combinations of small molecules might be useful to promote maintenance of HSPCs in culture by inhibiting cell commitment. In this study, the combined effects of VPA and Li on HSPC proliferation, differentiation, and self-renewal were investigated. We document potent synergistic effects of both chemical compounds in a variety of in vitro and in vivo assays and showed strong anti-differentiation activity at the level of uncommitted and committed progenitors. Moreover, we identified genetic networks and putative targets that are transcriptionally affected by both compounds. Our data support the notion that chemical compounds may be of use in ex vivo cell therapy protocols.

Methods

Mice

Female B6.SJL (CD45.1) mice, originally purchased from The Jackson Laboratory and bred in our local animal facility, and female wild-type B6 (CD45.2) mice (Harlan) were used as a source of donor HSPCs. In the transplantation settings, we used female B6.SJL donors, female wild-type B6 (Harlan) BM as competitors, and female F1:B6xB6.SJL (CD45.1/2) as recipients. All animal experiments were approved by the local animal ethical committee of the University of Groningen.

Stem/progenitor cell isolation

Mice were anesthetized and killed by cervical dislocation. Unfractionated BM cells were obtained by crushing femora, tibia, and pelvic bones. Cell suspensions were filtered through a 100-μm cell strainer (BD Biosciences) to remove debris, and the cells were counted on a Medonic CA620 analyzer (A. Menarini Diagnostics). After erythrocyte lysis cells were stained with lineage cocktail (A700-Mac1, A700-Gr1, A700-Ter119, A700-CD3, A700-B220), Pacific Blue-Sca1, PE-ckit, FITC-CD34, and PECy7-CD16/32 (Biolegend). After staining, the cells were resuspended in propidium iodide (PI) solution (1 μg/mL) and uncommitted (LinSca1+ckit+ [LSK]) and committed (common myeloid progenitor [CMP], LSK+CD34+CD16/32mid; granulocyte macrophage progenitor [GMP], LSK+CD34+CD16/32high) hematopoietic stem/progenitor subpopulations were sorted by a MoFlo XDP cell sorter (Dako Cytomation).

Stem/progenitor cell differentiation

Freshly isolated uncommitted and committed hematopoietic progenitor subpopulations were differentiated in a liquid or semisolid medium in the presence of FCS (10% or 30% FCS, respectively), murine SCF (mSCF; 100 ng/mL; Amgen), and recombinant mGM-CSF (10 ng/mL or 20 ng/mL, respectively; R&D Systems). Cells in liquid cultures were plated at a density of 2000 cells/mL in a 6-well plate (Costar) and cultured in StemSpan medium (StemCell Technologies). Cells in semisolid medium were plated in various concentrations. The cells were cultured for 7 days at 37°C in a humidified atmosphere and 5% CO2 in air with or without 1mM VPA (Sigma-Aldrich) or 5mM LiCl (J. T. Baker), or the combination. Both compounds were dissolved in PBS solution (PAA Laboratories GmbH).

Cell analysis

After liquid cultures, cells were harvested; total cell number and cell viability were determined by trypan blue and/or PI exclusion. Cultured cells were centrifuged for cytospin preparations (800 rpm; Shandon cytospin III cytocentrifuge; Thermo Fisher Scientific BV,) and stained with May-Grünwald-Giemsa staining. Cytospins were analyzed with light microscopy by counting ≥ 200 cells per experimental condition. Cells were classified as immature (blast-like) or differentiated on the basis of nucleus and cytoplasm morphology. To analyze the immunophenotype of 7-day differentiated LSK cells, cells were stained with a cocktail of Abs as described earlier and analyzed on the LSR-II (BD Bioscience). Data analyses were performed with FlowJo PC Version 7.6.5 software (TreeStar)

Clonogenic assays

The CFU assay was performed to assess the potential of cells to form granulocyte/macrophage colonies (CFU-GM). Briefly, either freshly isolated hematopoietic progenitor subpopulations or cells differentiated for 7 days were plated in a methylcellulose medium, and after 6 or 7 days colonies with granuloid and/or macrophage cells were scored. Colonies derived from single cells of freshly isolated progenitors were replated, and secondary GM colonies were scored after another 7 days of semisolid culture. To assess the number of hematopoietic progenitor cells or more primitive stem cells cobblestone area–forming cell (CAFC) assays were performed in the population of 7-day differentiated cells. Both assays were performed as described previously.28 

In vivo transplantation assays

Seven-day cultured cells (CD45.1) alone or mixed with 0.5 × 106 of freshly isolated BM competitor cells (CD45.2) were injected into the retro-orbital sinus of lethally irradiated (9.5 Gy) mice (CD45.1/2). In transplantations without competitors, recovery of peripheral blood counts was determined up to 32 days by automatic cell counting of blood samples (Medonic CA 620 analyzer). Long-term repopulation potential of cells transplanted in the presence of competitors was monitored by calculation of the percentage of CD45.1, CD45.2, and CD45.1/2-derived cells in the blood. Data were acquired with an LSR-II (BD Bioscience) and analyzed with FlowJo PC Version 7.6.5 software (TreeStar)

Gene expression analysis

Global gene expression was assessed in 7-day cultured cells (growth factor [GF] only, Li, VPA, Li + VPA). All samples were analyzed in independent biologic triplicates. Total RNA was isolated with the RNeasy kit (QIAGEN), according to manufacturer's protocol. RNA concentration, quality, and integrity were measured with the Experion Automated Electophoresis System (Bio-Rad). RNA was amplified with the Illumina TotalPrep RNA Amplification Kit (Ambion/Applied Bioscience) and hybridized to Mouse Ref-8_V2 expression platform (Illumina) according to the manufacturer's instruction. Scanning was performed on the iScan System (Illumina). Image analyses and extraction of raw expression data were performed with BeadStudio Version 3.2 software (Illumina) with default settings, no background subtraction, and no normalization. The raw data were thresholded at 1, log2-transformed and quantile-normalized with the use of GeneSpring-GX11.0 (Agilent). From the starting probe list (25 697 probes) probes not expressed in any replicate of the 4 conditions were excluded. The filtered list represented 20 586 probes. Probes differentially expressed between drug-treated and control sample (GFs only) were defined by Welch t test with Benjamini-Hochberg correction and false discovery rate < 0.05. Next, a 1.5-fold differential expression cutoff was applied. Gene expression analyses of 4 distinct primary cell subsets (LSK, LSK+, Gr1+, Ter119+), as described previously,29  were used for comparison of VPA and Li effects with the physiologic hematopoietic differentiation program. Finally, data were subjected to relevance network analyses as described in Voy at al.30  Networks were visualized in Gephi Version 0.8 beta software with the use of the Yifan-Hu and Fruchterman-Reingold force-directed layout algorithm.31  All raw data were deposited in the NCBI Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/) as accession number GSE34088.

ChIP assay

The ChIP assay was performed to determine histone acetylation at promoter regions of specific genes with the use of the method described by Frank et al.32  In brief, 5 × 106 cells were fixed with 1% formaldehyde for 10 minutess at RT. After cell lysis, cross-linked chromatin was fragmented by sonication to obtain ∼ 200- to 600-bp fragments. Precleared chromatin was precipitated with anti–acetyl-Histone4 (Millipore) Ab. The immunoprecipitated chromatin was washed subsequently with washing buffers.32  For reverse cross-linking, samples were incubated overnight at 65°C in 1% SDS, 0.1M NaHCO-containing buffer, followed by treatment with Rnase A (Roche) and proteinase K (Fermentas Gmbh). DNA was isolated by ethanol/chloroform/isopropanol precipitation. The promoter regions of genes of interest were amplified by quantitative PCR (Bio-Rad) with the use of gene-specific primer pairs for β-actin (fwd, GGCAGTGTCCACAAGGGCGG; rev, TTGAGGAAGAGGATGAAGAGTTTTGGCG), HoxA7 (fwd, GCCAGTCTTCCAGCATGGCCTG; rev, CTCTGCTGCCCAACGCTCTCTG), and HoxB4 (fwd, GGGAGGGGTAGAGAAGGGGAAATAAACC; rev, GCCACCCGGCCTGCGATTC).

Results

VPA and Li preserve the immature phenotype of HSPCs during myeloid differentiation in vitro

In vitro differentiation cultures are a convenient model to study the effects of new compounds on cell proliferation and differentiation. Purified HSPCs, defined by a LSK phenotype, were differentiated into the granulocyte/macrophage lineage by stimulation with SCF and GM-CSF in the presence or absence of VPA with or without Li. After a 7-day liquid culture the effect of both compounds on cytokine-induced HSPC differentiation was studied with respect to cell proliferation and differentiation.

The addition of Li, either alone or in combination with VPA, led to lower numbers of nucleated cells, whereas this effect was not observed on VPA exposure (Figure 1A). Despite decreased proliferation, the combination of VPA + Li resulted in a significantly higher proportion of viable cells as measured by PI exclusion, used as a marker for dead cells (Figure 1B). Because the cultures were initiated with purified LSK cells, after 7 days of differentiation Lineage, Sca-1, and c-kit marker expression was reanalyzed by flow cytometry. Combined drug treatment (VPA + Li) resulted in a significantly higher (8-fold) number of cells with a LSK phenotype compared with control cells grown with GFs only. On VPA exposure a 6-fold increase in number of phenotypically defined LSK cells was observed, whereas Li had only a marginal (1.5-fold) effect (Figure 1C-D). The immature cell phenotype as measured by flow cytometry was in the agreement with morphology of the cells (Figure 1E-F). Quantification of the percentage of cells with blast-like morphology showed that cells treated with VPA + Li contained 7.5-fold more cells with immature morphology. VPA treatment lead to a 4.5-fold increase, whereas the addition of Li resulted in only 2.5-fold more cells with blast-like morphology over control conditions (Figure 1E-F). These data indicate that VPA and Li treatment preserved the HSPC phenotype and morphology after strong differentiation-inducing cultures.

Figure 1

Preserved immature phenotype of hematopoietic progenitor cells after in vitro myeloid differentiation culture. HSPCs (LSK cells) were differentiated in vitro into the myeloid lineage for 7 days in the presence or absence of VPA and/or Li. (A) Effects of VPA + Li treatment on cell proliferation. The number of viable cells was scored with trypan blue exclusion. Shown is the mean ± SD (n = 5-7). (B) The proportion of cells that excludes PI after 7 days of differentiation culture. Shown is the mean ± SD (n = 5-7). The proportion of cells excluding PI was in agreement with the proportion of dead cells stained with trypan blue (data not shown). (C) Representative flow cytometric analysis of LSK expression on cells cultured for 7 days with or without VPA + Li. Cells in the graphs were pregated for viable (PI) cells. An equal number of events were collected for each sample. (D) Absolute number of cells with preserved LSK phenotype, quantified on the basis of on FACS data, presented as number of LSK cell per well. Error bars represent SD of the mean (n = 3-7). (E) Percentage of cells with preserved blast-like morphology after 7-day differentiation culture. Shown is the mean ± SD (n = 3-6). (F) Representative cell morphology of cells cultured with or without VPA + Li. Cytospin preparations were stained with May-Grünwald-Giemsa and viewed under a light microscope (original magnification ×100). The differences between groups were evaluated by Welch t test, **P < .01 and ***P < .001.

Figure 1

Preserved immature phenotype of hematopoietic progenitor cells after in vitro myeloid differentiation culture. HSPCs (LSK cells) were differentiated in vitro into the myeloid lineage for 7 days in the presence or absence of VPA and/or Li. (A) Effects of VPA + Li treatment on cell proliferation. The number of viable cells was scored with trypan blue exclusion. Shown is the mean ± SD (n = 5-7). (B) The proportion of cells that excludes PI after 7 days of differentiation culture. Shown is the mean ± SD (n = 5-7). The proportion of cells excluding PI was in agreement with the proportion of dead cells stained with trypan blue (data not shown). (C) Representative flow cytometric analysis of LSK expression on cells cultured for 7 days with or without VPA + Li. Cells in the graphs were pregated for viable (PI) cells. An equal number of events were collected for each sample. (D) Absolute number of cells with preserved LSK phenotype, quantified on the basis of on FACS data, presented as number of LSK cell per well. Error bars represent SD of the mean (n = 3-7). (E) Percentage of cells with preserved blast-like morphology after 7-day differentiation culture. Shown is the mean ± SD (n = 3-6). (F) Representative cell morphology of cells cultured with or without VPA + Li. Cytospin preparations were stained with May-Grünwald-Giemsa and viewed under a light microscope (original magnification ×100). The differences between groups were evaluated by Welch t test, **P < .01 and ***P < .001.

Enhanced in vitro functional potential of cells exposed to VPA and Li

To test whether cells exposed to VPA and Li retained stem/progenitor function, in vitro assays for hematopoietic cell activity were performed. Progenitor potential of 7-day cultured cells was determined with semisolid CFU assay, whereby cells were stimulated into granulocyte/macrophage colonies with GM-CSF and SCF. Cells treated with VPA alone or with a combination of VPA + Li gave rise to a higher number of colonies than control cells (45-fold and 81-fold more, respectively). However, treatment with Li did not significantly influence colony-forming capacity (Figure 2A). To test the functional activity of more primitive cells after 7 days of differentiation culture, we performed CAFC assays. In this assay, progenitor activity is measured by early appearing CAFCs (day-7) and stem cell activity by late appearing CAFCs (day 35). Cells exposed to the combination of both compounds (VPA + Li) showed a 30-fold increase in absolute numbers of early- and a 3.5-fold increase in absolute numbers of late-appearing CAFCs (P < .05) compared with control cells (GFs only). Cells treated with VPA alone showed 7-fold and 2-fold more early and late CAFC activity (P < .05), respectively. In contrast, for Li-treated cells no enhancement of early or late CAFC activity was observed (Figure 2B). As shown by these 2 independent assays, the in vitro functional potential of stem and progenitor cells was significantly enhanced by VPA and VPA + Li treatment, but the combination of both compounds most efficiently preserved HSPC function.

Figure 2

Enhanced in vitro function of cells differentiated in the presence of Li and VPA. Cells differentiated in vitro with or without VPA and/or Li were assayed for progenitor/stem cell activity. (A) CFU-GM data showing effect of the compound treatment on the total number of colonies. Shown is the mean ± SD. (B) CAFC data showing progenitor (day −7) and stem cells (day −35) activity of 7-day cultured cells. The differences between groups were evaluated by Welch t test, *P < .05 and **P < .01.

Figure 2

Enhanced in vitro function of cells differentiated in the presence of Li and VPA. Cells differentiated in vitro with or without VPA and/or Li were assayed for progenitor/stem cell activity. (A) CFU-GM data showing effect of the compound treatment on the total number of colonies. Shown is the mean ± SD. (B) CAFC data showing progenitor (day −7) and stem cells (day −35) activity of 7-day cultured cells. The differences between groups were evaluated by Welch t test, *P < .05 and **P < .01.

VPA and Li improve survival, blood cell recovery, and short-time engraftment after BM transplantation

To confirm the functional activity observed with in vitro assays, the in vivo reconstitution properties of cells differentiated in the presence of VPA and/or Li were examined. The progeny of 2000 LSK cells, cultured for 7 days with GM-CSF with or without VPA and Li, was transplanted into lethally irradiated mice. At days 10, 14, 21, 28, and 32 after transplantation survival and recovery of peripheral blood counts were analyzed. Mice that received a transplant with cells exposed to VPA + Li had significantly (P < .05) improved survival (12 of 14 mice survived) compared with control mice that received cells cultured with GFs only (6 of 14 mice survived; Figure 3A). In addition, blood cell counts showed that the red blood cell numbers and platelet numbers recovered faster in recipients of VPA + Li-treated cells compared with control mice, confirming more progenitor cell activity in the transplanted cell population (Figure 3B-C). In contrast, mice reconstituted with cells cultured in the presence of a single drug, either VPA or Li, did not show improved survival or blood recovery over mice that received a transplant with cells differentiated with GFs only (supplemental Figure 1, available on the Blood Web site; see the Supplemental Materials link at the top of the online article). These data strongly indicate that the combination of VPA + Li most potently preserved immature, radioprotective hematopoietic progenitor cells.

Figure 3

Improved radioprotection and short-time engraftment on BM transplantation with cells exposed to VPA + Li. LSK cells cultured for 7 days with GM-CSF and SCF in the presence or absence of VPA + Li were transplanted into lethally irradiated recipients with or without competitors. (A) Survival of the recipients was screened for 40 days after noncompetitive transplantations. Significance was calculated with Mantel-Cox test (P = .043) and Gehan-Breslow-Wilcoxon test (P = .0394). (B) Platelet counts in the peripheral blood of recipient mice at 10 to up to 40 days after transplantation. Error bars represent SEM. (C) Red blood cell counts in the peripheral blood of recipient mice at 10 to up to 40 days after transplantation. Error bars represent SEM. (D) LSK cells cultured for 7 days were competitively transplanted with fresh BM cells into lethally irradiated recipients. Percentage of donor cells in the peripheral blood of recipient mice up to 28 weeks after transplantation. Error bars represent SEM (n = 5). The differences between groups were evaluated by Welch t test, *P < .05.

Figure 3

Improved radioprotection and short-time engraftment on BM transplantation with cells exposed to VPA + Li. LSK cells cultured for 7 days with GM-CSF and SCF in the presence or absence of VPA + Li were transplanted into lethally irradiated recipients with or without competitors. (A) Survival of the recipients was screened for 40 days after noncompetitive transplantations. Significance was calculated with Mantel-Cox test (P = .043) and Gehan-Breslow-Wilcoxon test (P = .0394). (B) Platelet counts in the peripheral blood of recipient mice at 10 to up to 40 days after transplantation. Error bars represent SEM. (C) Red blood cell counts in the peripheral blood of recipient mice at 10 to up to 40 days after transplantation. Error bars represent SEM. (D) LSK cells cultured for 7 days were competitively transplanted with fresh BM cells into lethally irradiated recipients. Percentage of donor cells in the peripheral blood of recipient mice up to 28 weeks after transplantation. Error bars represent SEM (n = 5). The differences between groups were evaluated by Welch t test, *P < .05.

To evaluate the effects of VPA + Li treatment on long-term repopulating capacity, the cultured progeny of 2000 LSK cells was transplanted into lethally irradiated recipients together with freshly isolated BM competitor cells. Recipient mice transplanted with cells cultured in the presence of VPA + Li displayed higher chimerism levels through the entire time course of the experiment compared with mice that received a transplant with cells cultured in the presence of GFs only. However, the differences between the 2 groups decreased over time (Figure 3D). The percentage of chimerism was significantly higher in the VPA + Li group up to 13 weeks after transplantation, suggesting robust preservation of short-term repopulating stem/progenitor cells. Furthermore, 28 weeks after transplantation only 2 of 5 recipients transplanted with cells cultured with GFs only reached chimerism levels > 1%, whereas > 1% of donor cell contribution was observed for all mice (5 of 5) in the VPA + Li group. Chimerism levels remained stable and distinguishable between the 2 groups until 36 weeks (supplemental Figure 1). In addition, treatment with VPA + Li did not influence the multilineage capacity of the cells because all mature blood types were found in comparable ratios (supplemental Figure 1). Collectively, these data strongly indicate that addition of VPA + Li to differentiation-inducting cultures preserved cells with in vivo repopulation potential.

VPA increases proliferation and self-renewal of committed myeloid progenitors

Since our results indicate that VPA and Li enhanced short-term repopulating progenitor cells, the effects of the compound treatment on distinct progenitor cell subsets were characterized. To address this question we isolated by flow cytometry uncommitted (LSK) and committed myeloid (CMP and GMP) cell subsets and performed methylcellulose assays for each sorted cell population (Figure 4A). Cells were stimulated to differentiate with SCF and GM-CSF in the presence of VPA and/or Li. VPA and VPA + Li decreased colony-forming activity of LSK cells, showed no effect on clonogenic activity of CMP cells, but displayed strong potentiating effect on colony-forming ability of the GMP cell population (Figure 4A). GMPs had a limited colony-forming ability (∼ 40 colonies per 1000 cells), which increased in the presence of VPA and VPA + Li by almost 8-fold. Li, as a single agent, showed no effect on colony-forming ability of the tested progenitor cell populations.

Figure 4

Increased proliferation and induction of replating activity of committed myeloid progenitors on VPA and VPA + Li treatment. Primary myeloid progenitor subpopulations were sorted by flow cytometry, and the effect of VPA + Li exposure on proliferation, colony-forming ability, and self-renewal potential was tested. (A) Influence of VPA and/or Li on CFU-GM activity of distinct myeloid subpopulations. Data are presented as colony forming cells per 10 000 cells. Shown is the mean ± SD. (B) Single-cell proliferation potential of distinct myeloid progenitor subpopulations in liquid culture with SCF and GM-CSF in the presence or absence of VPA and Li. After 7 days of culture, the number of wells with dead cells and the size of clones derived from single cells were scored. Clone size was classified as small (1-100 cells), medium (101-30 000 cells), or large (30 000 to < 150 000; n = 192-288). Cell death, defined by the percentage of wells with dead cells, was not significantly different from control conditions (GFs only) on the compound treatment in any of the tested cell populations (Welch t test, LSK + Li, P = .8; LSK + VPA, P = .13; LSK + VPA + Li, P = .13). (C) Effects of the adding compounds on single-cell colony-plating efficiency of distinct myeloid progenitors. Data are shown as the percentage of cells with colony-forming ability. (D) Ability of distinct myeloid progenitors to generate secondary CFU-GM colonies derived from a single cell (n = 20-48). The bars represent the percentage of single cell–derived primary colonies that gave rise to secondary CFU-GM colonies. The individual colors in the bars indicate the number of secondary CFU-GM colonies derived from the single cell. The differences between groups were evaluated by Welch t test, *P < .05, **P < .01, and ***P < .001.

Figure 4

Increased proliferation and induction of replating activity of committed myeloid progenitors on VPA and VPA + Li treatment. Primary myeloid progenitor subpopulations were sorted by flow cytometry, and the effect of VPA + Li exposure on proliferation, colony-forming ability, and self-renewal potential was tested. (A) Influence of VPA and/or Li on CFU-GM activity of distinct myeloid subpopulations. Data are presented as colony forming cells per 10 000 cells. Shown is the mean ± SD. (B) Single-cell proliferation potential of distinct myeloid progenitor subpopulations in liquid culture with SCF and GM-CSF in the presence or absence of VPA and Li. After 7 days of culture, the number of wells with dead cells and the size of clones derived from single cells were scored. Clone size was classified as small (1-100 cells), medium (101-30 000 cells), or large (30 000 to < 150 000; n = 192-288). Cell death, defined by the percentage of wells with dead cells, was not significantly different from control conditions (GFs only) on the compound treatment in any of the tested cell populations (Welch t test, LSK + Li, P = .8; LSK + VPA, P = .13; LSK + VPA + Li, P = .13). (C) Effects of the adding compounds on single-cell colony-plating efficiency of distinct myeloid progenitors. Data are shown as the percentage of cells with colony-forming ability. (D) Ability of distinct myeloid progenitors to generate secondary CFU-GM colonies derived from a single cell (n = 20-48). The bars represent the percentage of single cell–derived primary colonies that gave rise to secondary CFU-GM colonies. The individual colors in the bars indicate the number of secondary CFU-GM colonies derived from the single cell. The differences between groups were evaluated by Welch t test, *P < .05, **P < .01, and ***P < .001.

To investigate whether the observed effects on clonogenic activity were caused by either proliferation or cell death (or both), single-cell proliferation assay was performed. Single cells of each distinct progenitor population (LSK, CMP, GMP) were sorted into 96-well plates in liquid differentiation medium containing SCF and GM-CSF and were cultured in the presence or absence of VPA and/or Li for 7 days. Cell death was not significantly affected by drug treatment in any of the tested cell populations (Welch t test, P > .05; Figure 4B). Cell proliferation was quantified by scoring the size of the clone grown from a single cell. Clone size was classified as small, medium, or large. Less than 40% of GMPs at the single-cell level were able to grow into medium or large colonies, whereas on addition of VPA and VPA + Li > 80% of colonies grow into larger (medium + large) colonies. The enhancing effect of VPA and VPA + Li on cell proliferation was also apparent at the level of CMPs, however, to a lesser extent. Surprisingly, VPA and VPA + Li decreased proliferative capacity of the LSK cells. At the single-cell level Li alone showed no effects on the proliferation of distinct hematopoietic cell populations (Figure 4B). These data indicate that VPA displayed a major effect on cell proliferation, which was potentiated in the presence of Li.

Next, the effect of VPA treatment on plating efficiency of distinct cell progenitor populations was tested with the use of single-cell CFU assay. Single cells of each of the 3 progenitor populations were sorted into 96-well plate in semisolid medium with SCF and GM-CSF and cultured with or without VPA and/or Li. VPA and VPA + Li decreased the plating efficiency of LSK cells, did not influence CMP plating efficiency, but significantly increased the plating efficiency of GMP at the single-cell level (in accordance with Figure 4A). Strikingly, whereas ∼ 10% of purified GMPs were able to produce colonies in the presence of GFs only, the addition of VPA or VPA + Li increased clonogenic activity of GMPs to 60% (Figure 4C). Next, the self-renewal potential of compound-exposed cells was determined by replating colonies derived from a single cell. From each group, ∼ 30 individual colonies were harvested and replated to new methylcellulose cultures in the presence or absence of VPA and/or Li. In the presence of GF only ∼ 50% of individual colonies formed by single LSK cells were able to generate secondary colonies, whereas on exposure to VPA and VPA + Li 100% of the replated colonies derived from single LSK cells gave rise to secondary colonies. Furthermore, VPA and VPA + Li not only enhanced LSK replating efficiency of individual colonies but also increased the total number of secondary colonies derived from a single cell. Strikingly, although CMP and GMP cells did not show any replating activity by themselves, the addition of VPA and VPA + Li induced replating activity of these progenitor populations, resulting in ∼ 60% and ∼ 35% of secondary colonies, respectively. The addition of Li to primary or secondary single-cell cultures did not affect cell (re-)plating efficiencies (Figure 4D).

Summarizing, the effect of VPA or the combination of VPA + Li on colony-forming ability varied, depending on the differentiation status of the cell. VPA and VPA + Li inhibited proliferation and colony-forming ability of LSK cells but increased its self-renewal potential measured by replating. Although proliferation and clonogenic activity of CMPs were not significantly influenced, VPA and VPA + Li induced replating capacity of this population. GMPs were specifically sensitive to VPA or the combination treatment, because the compounds not only strongly increased clonogenic activity, plating efficiency, and proliferation of this population but also induced their self-renewal capacity.

VPA and Li synergistically preserve HSPC gene expression profile

To identify molecular events by which VPA and/or Li are able to inhibit differentiation, we performed expression arrays on 7-day differentiated LSK cells in the presence or absence of VPA with or without Li. RNA samples were harvested at the time when in vitro and in vivo assays were initiated. Differential expression analyses (for details, see “Gene expression analysis”) showed distinct effects of Li and VPA on gene expression. Although no differentially expressed genes could be identified on Li treatment compared with GFs only (Figure 5A), VPA significantly affected 60 genes, of which 10 were up-regulated and 50 down-regulated. Strikingly, an obvious more than additive effect was observed when Li was added to VPA in our differentiation cultures. The combined treatment of VPA + Li resulted in differential expression of 360 genes (110 up-regulated and 250 down-regulated), showing a strong synergistic effect (Figure 5A). The lists of all genes differentially expressed on the compounds treatment is presented in supplemental Table 1.

Figure 5

Stem/progenitor cell gene expression profile synergistically preserved by VPA + Li. (A) Venn diagram representation of significantly differentially expressed genes on Li, VPA, or VPA + Li treatment. Venn diagram were created with Venny.49  (B) Rank-based heat maps of expression levels of genes up-regulated or down-regulated by VPA + Li in 4 freshly isolated cell types, stem (LSK), progenitor (LSK+), myeloid (Gr1+), and erythroid (Ter119+) cells. Heat maps were created with Genesis Version 1.7.6 software.50  (C) Graphic representation of gene networks affected by VPA + Li. For similarity measure, Pearson correlation was used with a threshold of > 0.85 (FDR P < .1).30  The network consists of nodes (genes) and edges (biologic relations between nodes). Size of nodes correspond to amount of connection of a particular node with other nodes. Nodes are color-coded according to their expression abundance in 4 distinct cells types, green nodes refer to genes that are preferentially expressed in stem cells (LSK), yellow nodes shows genes active in progenitors (LSK+), blue nodes are prevalent in mature myeloid cells (Gr1+), and purple nodes are expressed in mature erythroid cells (Ter119+). Lines represent correlations of particular genes with others, blue lines represents negative correlations, and red lines indicate positive correlations. Nodes with < 1 connection were removed. (D) TF networks significantly changed by VPA + Li treatment. This graph shows essentially the same data as those in panel C, but now only for transcriptional regulators. All network visual representation were performed with Gephi Version 0.8 beta software.31  (E) Acetylation status of histone H4 at promoter regions of HoxA7 and HoxB4 genes. β-actin was used as a housekeeping gene control for ChIP experiments.

Figure 5

Stem/progenitor cell gene expression profile synergistically preserved by VPA + Li. (A) Venn diagram representation of significantly differentially expressed genes on Li, VPA, or VPA + Li treatment. Venn diagram were created with Venny.49  (B) Rank-based heat maps of expression levels of genes up-regulated or down-regulated by VPA + Li in 4 freshly isolated cell types, stem (LSK), progenitor (LSK+), myeloid (Gr1+), and erythroid (Ter119+) cells. Heat maps were created with Genesis Version 1.7.6 software.50  (C) Graphic representation of gene networks affected by VPA + Li. For similarity measure, Pearson correlation was used with a threshold of > 0.85 (FDR P < .1).30  The network consists of nodes (genes) and edges (biologic relations between nodes). Size of nodes correspond to amount of connection of a particular node with other nodes. Nodes are color-coded according to their expression abundance in 4 distinct cells types, green nodes refer to genes that are preferentially expressed in stem cells (LSK), yellow nodes shows genes active in progenitors (LSK+), blue nodes are prevalent in mature myeloid cells (Gr1+), and purple nodes are expressed in mature erythroid cells (Ter119+). Lines represent correlations of particular genes with others, blue lines represents negative correlations, and red lines indicate positive correlations. Nodes with < 1 connection were removed. (D) TF networks significantly changed by VPA + Li treatment. This graph shows essentially the same data as those in panel C, but now only for transcriptional regulators. All network visual representation were performed with Gephi Version 0.8 beta software.31  (E) Acetylation status of histone H4 at promoter regions of HoxA7 and HoxB4 genes. β-actin was used as a housekeeping gene control for ChIP experiments.

To assess whether VPA + Li treatment inhibited differentiation by preserving a primitive cell transcriptome, the changes in expression of VPA + Li targets (Figure 5A and supplemental Table 1) were compared with normal hematopoietic differentiation. For this purpose, previously obtained transcriptome data of 4 developmentally distinct hematopoietic cell stages, stem cells (LinSca1+ckit+), progenitors (LinSca1ckit+), myeloid (Gr1+), and erythroid (Ter119+) cells, were used.29  Analysis found that target genes that were up-regulated by VPA + Li were more abundantly expressed in primary stem/ progenitor cells compared with differentiated myeloid and erythroid cells, whereas VPA + Li down-regulated targets showed the opposite pattern, being higher expressed in differentiated than in uncommitted cells. (Figure 5B)

Since VPA + Li treatment altered expression of 360 genes, an important question is whether expression changes of these targets are all independent or co-regulated. Cellular differentiation is most probably orchestrated by networks of co-regulated genes, rather than by changes in expression of individual genes. To address this question, the method described in detail by Voy et al 30  was used. First, gene correlation studies (using Pearson coefficient) were performed with the same transcriptome data of the 4 developmentally distinct hematopoietic cell stages as used for determining cell type expression abundance of VPA + Li affected targets. The strongest correlations, most probably reflecting biologic relevance, were defined by less than −0.8 or > 0.85 thresholds and visualized with Gephi Version 0.8 beta software.31  Such a gene relevance network, reflecting similarity measures of gene expressions in 4 cell populations, is presented in Figure 5C. VPA + Li targets were color-coded according to the expression abundance. Interestingly, it appeared that VPA + Li targets are co-regulated during normal hematopoietic differentiation, creating high connectivity networks. In addition, genes clustered together according to a specific cell type, creating a network consisting of 3 apparent clusters. One combined cluster contained genes most abundantly expressed in either stem (green) or progenitor (yellow) cells, and 2 separate clusters contained genes predominantly expressed in myeloid (blue) or erythroid (purple) cells (Figure 5C). Network analysis found also differential gene induction or repression by the treatment. As expected, genes within a cluster, usually expressed in the same cell type, showed positive correlations (red lines) with each other, suggesting that expression levels of these genes are changed in parallel by VPA + Li. However, strong negative correlations (blue lines) were apparent between genes belonging to separate clusters. Almost all genes within the stem/progenitor cluster displayed inverse correlation with genes within myeloid and erythroid clusters, indicating interesting gene relations between uncommitted and differentiated cells. Collectively, our analyses show that VPA + Li affected the differentiation program of the cell by perturbing the coordinated expression of multiple genes in co-regulated fashion, preserving stem/progenitor genes, and down-regulating differentiation-associated genes.

To try to identify primary candidates probably involved in cell fate decisions, the VPA + Li target list was filtered for transcription factors (TFs) and other DNA and RNA interacting genes. Table 1 provides a full list of transcriptional regulators that were affected by the treatment. A reduced network retained the 3-cluster structure with strong negative correlations between stem/progenitor and differentiated-cell associated TFs (Figure 5D). Among VPA + Li up-regulated targets were several known stem/progenitor TFs, such as Gata2, Gfi-1, and HoxA7.33-35  Other TFs, with still unknown functions in HSCs, could also be assigned to the stem cell cluster, including Rbbp7 and Phf5. Moreover, TFs involved in epigenetic events, such as Hmgn3 and Prmt5, were up-regulated by the VPA + Li treatment.36  In contrast, most of the down-regulated targets were correlated with cellular differentiation, including known TFs for myeloid (Erg1/2, Junb),37,38  erythroid/megakaryocyte (Dab2),39  and lymphoid (Irf5, Nfkbia)40,41  differentiation. TFs up-regulated by the treatment, showing a negative correlation with differentiation-associated TFs, seem to be especially interesting as targets for differentiation-preventing agents.

Table 1

Expression changes of transcriptional regulators (TRs) affected by VPA and/or Li treatment

TRVPAVPA + Li
Hmgn3  +3.32 
Gfi1  +2.26 
HoxA7 +2.58 +2.22 
Prmt5  +2.08 
Six1  +1.81 
Rbbp7  +1.74 
Satb1  +1.69 
Wdr77  +1.66 
Gata2  +1.64 
Phf5a  +1.60 
Psmc3ip  +1.55 
Egr2 −3.17 −3.74 
Egr1  −3.64 
Dab2  −3.52 
Il1b −2.61 −3.02 
Bhlhb2  −2.74 
Irf5 −2.73 −2.73 
Nfkbia  −2.62 
Tcf7l2  −2.61 
Atf3  −2.48 
Bcl6  −2.37 
Osm  −2.34 
Klf4  −2.28 
Junb  −2.14 
Inhba  −1.98 
S100a1  −1.91 
Irf4  −1.90 
Klf6  −1.90 
Zfhx3  −1.82 
Tlr4  −1.82 
Irak2  −1.74 
Prmt2  −1.72 
Hlx  −1.71 
Pparg  −1.69 
App  −1.62 
Mmp14 −2.54  
Tnni2 −1.94  
Tob1 −1.55  
TRVPAVPA + Li
Hmgn3  +3.32 
Gfi1  +2.26 
HoxA7 +2.58 +2.22 
Prmt5  +2.08 
Six1  +1.81 
Rbbp7  +1.74 
Satb1  +1.69 
Wdr77  +1.66 
Gata2  +1.64 
Phf5a  +1.60 
Psmc3ip  +1.55 
Egr2 −3.17 −3.74 
Egr1  −3.64 
Dab2  −3.52 
Il1b −2.61 −3.02 
Bhlhb2  −2.74 
Irf5 −2.73 −2.73 
Nfkbia  −2.62 
Tcf7l2  −2.61 
Atf3  −2.48 
Bcl6  −2.37 
Osm  −2.34 
Klf4  −2.28 
Junb  −2.14 
Inhba  −1.98 
S100a1  −1.91 
Irf4  −1.90 
Klf6  −1.90 
Zfhx3  −1.82 
Tlr4  −1.82 
Irak2  −1.74 
Prmt2  −1.72 
Hlx  −1.71 
Pparg  −1.69 
App  −1.62 
Mmp14 −2.54  
Tnni2 −1.94  
Tob1 −1.55  

Because VPA is an epigenetic modifier, known to affect gene expression by preventing chromatin deacetylation, we tested whether the observed changes in gene expression were caused by altered histone acetylation levels. To this end, ChIP with the use of Abs against acetylated histone H4 were performed. As proof of principle, HoxA7, up-regulated by both VPA and VPA + Li, was selected for ChIP assay. Interestingly, several reports have suggested that another homeobox gene, HoxB4, is a target of VPA in human cells.16-18  In our study, expression of HoxB4 was not affected by the compound treatment. The ChIP experiments showed that VPA caused hyperacetylation of histone H4 at regulatory sites of the HoxA7 promotor, but not of the HoxB4 promotor. This correlates with the 2.3- and 8-fold higher HoxA7 expression measured by microarray and quantitative RT-PCR (not shown), respectively, and lack of change in HoxB4 expression. As expected, Li did not affect the epigenetic status of promotor regions of tested genes (Figure 5F). This indicates that VPA affected expression of HoxA7 by increasing histone acetylation on regulatory regions of the gene.

Taken together, genome-wide gene expression profiling of VPA- and Li-treated cells showed the synergistic effects of these 2 compounds at the molecular level. Gene relevance networks indicated that these effects required simultaneous changes in multiple genes to prevent differentiation, which was achieved by enhancing genes involved in cell primitiveness and repressing genes associated with cellular differentiation.

Discussion

To date, attempts to define culture conditions that would favor stem cell self-renewal over differentiation have resulted in limited success. We hypothesized that combinations of cytokines and small molecules might represent an integrative approach to prevent differentiation in culture. In this report, we tested the combination of a well-known HDI, VPA, with the simple cation, Li, on HSPC maintenance under strong differentiation pressure and showed that the combination of these 2 compounds displayed strong anti-differentiation effects on hematopoietic differentiation at the biologic and the molecular levels. Although Li as a single agent displayed limited effects on HSPC differentiation, VPA and the combination of VPA + Li were able to preserve in vitro functionality of LSK and induced self-renewal of committed progenitors (CMPs and GMPs). Strikingly, after a 7-day differentiation culture only the combination of these 2 agents provided radioprotection to lethally irradiated recipients, shortened the time required for platelet and red blood cell recovery, and enhanced in vivo repopulation potential. These observations are consistent with previous reports, suggesting that VPA or Li, can affect fate decision of HSPCs,16-18,20-22,25,26  but to our knowledge this is the first report to show that VPA + Li act synergistically to delay HSPC differentiation.

In accordance with the biologic data, the most compelling evidence that VPA + Li act synergistically to inhibit LSK differentiation was provided by genome-wide gene expression analysis. Strikingly, VPA + Li affected expression of 360 genes, whereas VPA alone affected only 60 genes, and Li did not affect any genes. Network analysis provided evidence that most genes affected by VPA + Li were co-regulated during normal hematopoietic differentiation. In addition, VPA + Li preserved expression of stem cell–related genes, which coincided with repression of genes involved in differentiation. This indicates that the anti-differentiation effects of VPA + Li are caused by coordinated changes in multiple co-regulated genes, rather than in individual genes. Our findings were further illustrated by the fact that TFs (probably being the primary targets in the network) favoring self-renewal (eg, Gata2, Gfi-1, HoxA7)33-35  were increased, and differentiation-associated TFs were decreased on VPA + Li treatment. It has been suggested that competition and balance between TFs, such as Gata2, PU.1, Gfi-1, Erg1/2, may regulate switches between self-renewal and differentiation and triggers the determination of cell fate.3,37,42-44  The inhibition of the differentiation program was shown for multipotent uncommitted and also for committed cells, which are at various stages of differentiation. Strikingly, on addition of VPA and VPA + Li, individual CMP and GMP progenitor cells re-acquired replating capacity in methylcellulose assays, suggesting possible cellular de-differentiation. However, whether the same mechanism is responsible for the effects of Li + VPA on committed progenitor differentiation versus LSK differentiation remains to be determined.

The balance between histone acetylation and deacetylation is thought to play an important role in maintaining chromatin structure consistent with the stem cell state. Epigenetic regulation is believed to be important for cell fate decision, and epigenetic transcriptional repression was suggested to be required for silencing of stem cell genes and subsequent cell differentiation.14,15,44  VPA has been shown to inhibit HDACs and therefore could interfere with the epigenetic status of the cell.8  We confirmed increased histone acetylation at the HoxA7 promotor region, correlating with the increased expression of HoxA7. In addition, other confirmed VPA + Li targets (Gata2) have been suggested to bind to HDAC or to be involved in epigenetic modifications (Hmgn3, Prmt5).36,45  Moreover, the chromatin conformation maintained by VPA might allow a spectrum of Li targets to be better accessible. Thus, common targets of VPA and Li (eg, Wnt pathway)46  in combination with more accessible chromatin conformation may result in the observed synergistic effect of these 2 compounds. Therefore, modulation of epigenetic regulation of gene expression, as shown here with VPA, can lead to coordinated preservation or up-regulation of genes involved in stem cell maintenance and simultaneous down-regulation of differentiation-associated genes. The resemblance with expression patterns during natural differentiation suggests a physiologic mechanism driving expression of multiple genes determining cell fate. Self-renewal and differentiation seem to be strongly co-dependent, thus ex vivo stem cell culturing systems should target both processes to maintain uncommitted cells.

Methods to inhibit stem cell differentiation may be of benefit in ex vivo cell therapy protocols, which favor in vitro HSPC self-renewal rather than commitment and differentiation. So far, culturing systems with “classic” hematopoietic GFs resulted in stem cell loss because of profound differentiation.1,2  Recently, factors other than classic hematopoietic GFs (eg, RA, VPA, FGFs, SR1, pleiotropin)9,10,18,47,48  showed a promising potential in ex vivo expansion protocols. Our study underlines that combinatorial screening of Li and VPA and other new compounds may uncover possible additive and/or synergistic effects to modulate HSPC self-renewal and differentiation and thereby may lead to novel approaches in culturing systems of ex vivo stem cells.

The online version of this article contains a data supplement.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 USC section 1734.

Acknowledgments

The authors thank Pieter van der Vlies and Bahram Sanjabi for technical assistance; Henk Moes, Geert Mesander, and Roelof Jan van der Lei for assistance on cell sorting; Adrian Bracken for advice in setting up the ChIP assay in our laboratory; and Brad Dykstra for scientific advice.

This work was supported by the European Community's Seventh Framework Program (FP7/2007-2013; grant 222989; StemExpand), the Landsteiner Foundation for Blood Research (LSBR-0702), Dutch Platform for Tissue Engineering (DPTE; STW-GGT6727), and the Netherlands Organization of Scientific Research (VICI grant ZonMW 918.76.601, G.d.H.) and (VENI grant, G.H.).

Authorship

Contribution: M.A.W., G.d.H., and R.v.O. designed research; M.A.W., V.v.d.B., S.O., A.A., and M.R. performed research; M.A.W, L.B., V.v.d.B., and G.H. analyzed and interpreted data; and M.A.W. wrote the manuscript with contribution from L.B., G.d.H., and R.v.O.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Ronald van Os, Department of Cell Biology, Section Stem Cell Biology, University Medical Center Groningen, University of Groningen, Groningen 9700 AD, The Netherlands; e-mail: r.p.van.os@umcg.nl.

References

References
1
Sauvageau
 
G
Iscove
 
NI
Humphries
 
RK
In vitro and in vivo expansion of hematopoietic stem cells.
Oncogene
2004
, vol. 
23
 
43
(pg. 
7223
-
7232
)
2
Sorrentino
 
BP
Clinical strategies for expansion of haematopoietic stem cells.
Nat Rev Immunol
2004
, vol. 
4
 
11
(pg. 
878
-
888
)
3
Zon
 
LI
Intrinsic and extrinsic control of haematopoietic stem-cell self-renewal.
Nature
2008
, vol. 
453
 
7193
(pg. 
306
-
312
)
4
Antonchuk
 
J
Sauvageau
 
G
Humphries
 
RK
HOXB4-induced expansion of adult hematopoietic stem cells ex vivo.
Cell
2002
, vol. 
109
 
1
(pg. 
39
-
45
)
5
Rizo
 
A
Dontje
 
B
Vellenga
 
E
de Haan
 
G
Schuringa
 
JJ
Long-term maintenance of human hematopoietic stem/progenitor cells by expression of BMI1.
Blood
2008
, vol. 
111
 
5
(pg. 
2621
-
2630
)
6
Reya
 
T
Duncan
 
AW
Ailles
 
L
, et al. 
A role for Wnt signalling in self-renewal of haematopoietic stem cells.
Nature
2003
, vol. 
423
 
6938
(pg. 
409
-
414
)
7
Schugar
 
RC
Robbins
 
PD
Deasy
 
BM
Small molecules in stem cell self-renewal and differentiation.
Gene Therapy
2008
, vol. 
15
 
2
(pg. 
126
-
135
)
8
Lyssiotis
 
CA
Lairson
 
LL
Boitano
 
AE
Wurdak
 
H
Zhu
 
S
Schultz
 
PG
Chemical control of stem cell fate and developmental potential.
Angew Chem Int Ed
2011
, vol. 
50
 
1
(pg. 
200
-
242
)
9
Purton
 
LE
Bernstein
 
ID
Collins
 
SJ
All-trans retinoic acid enhances the long-term repopulating activity of cultured hematopoietic stem cells.
Blood
2000
, vol. 
95
 
2
(pg. 
470
-
477
)
10
Boitano
 
AE
Wang
 
J
Romeo
 
R
, et al. 
Aryl hydrocarbon receptor antagonists promote the expansion of human hematopoietic stem cells.
Science
2010
, vol. 
329
 
5997
(pg. 
1345
-
1348
)
11
Huangfu
 
D
Osafune
 
K
Maehr
 
R
, et al. 
Induction of pluripotent stem cells from primary human fibroblasts with only Oct4 and Sox2.
Nat Biotech
2008
, vol. 
26
 
11
(pg. 
1269
-
1275
)
12
Botrugno
 
OA
Santoro
 
F
Minucci
 
S
Histone deacetylase inhibitors as a new weapon in the arsenal of differentiation therapies of cancer.
Cancer Lett
2009
, vol. 
280
 
2
(pg. 
134
-
144
)
13
Focosi
 
D
Azzara
 
A
Kast
 
RE
Carulli
 
G
Petrini
 
M
Lithium and hematology: established and proposed uses.
J Leukoc Biol
2009
, vol. 
85
 
1
(pg. 
20
-
28
)
14
Zardo
 
G
Cimino
 
G
Nervi
 
C
Epigenetic plasticity of chromatin in embryonic and hematopoietic stem//progenitor cells: therapeutic potential of cell reprogramming.
Leukemia
2008
, vol. 
22
 
8
(pg. 
1503
-
1518
)
15
Meissner
 
A
Epigenetic modifications in pluripotent and differentiated cells.
Nat Biotech
2010
, vol. 
28
 
10
(pg. 
1079
-
1088
)
16
Bug
 
G
Gül
 
H
Schwarz
 
K
, et al. 
Valproic acid stimulates proliferation and self-renewal of hematopoietic stem cells.
Cancer Res
2005
, vol. 
65
 
7
(pg. 
2537
-
2541
)
17
De Felice
 
L
Tatarelli
 
C
Mascolo
 
MG
, et al. 
Histone deacetylase inhibitor valproic acid enhances the cytokine-induced expansion of human hematopoietic stem cells.
Cancer Res
2005
, vol. 
65
 
4
(pg. 
1505
-
1513
)
18
Seet
 
L
Teng
 
E
Lai
 
Y
, et al. 
Valproic acid enhances the engraftability of human umbilical cord blood hematopoietic stem cells expanded under serum-free conditions.
Eur J Haematol
2009
, vol. 
82
 
2
(pg. 
124
-
132
)
19
Milhem
 
M
Mahmud
 
N
Lavelle
 
D
, et al. 
Modification of hematopoietic stem cell fate by 5aza 2′deoxycytidine and trichostatin A.
Blood
2004
, vol. 
103
 
11
(pg. 
4102
-
4110
)
20
Yamamura
 
K
Ohishi
 
K
Katayama
 
N
, et al. 
Pleiotropic role of histone deacetylases in the regulation of human adult erythropoiesis.
Br J Haematol
2006
, vol. 
135
 
2
(pg. 
242
-
253
)
21
Bartels
 
M
Geest
 
CR
Bierings
 
M
Buitenhuis
 
M
Coffer
 
PJ
Histone deacetylase inhibition modulates cell fate decisions during myeloid differentiation.
Haematology
2010
, vol. 
95
 
7
(pg. 
1052
-
1060
)
22
Chateauvieux
 
S
Eifes
 
S
Morceau
 
F
, et al. 
Valproic acid perturbs hematopoietic homeostasis by inhibition of erythroid differentiation and activation of the myelo-monocytic pathway.
Biochem Pharmacol
2011
, vol. 
81
 
4
(pg. 
498
-
509
)
23
Özdemir
 
MA
Sofuoglu
 
S
Tanrikulu
 
G
Aldanmaz
 
F
Esel
 
E
Dündar
 
S
Lithium-induced hematologic changes in patients with bipolar affective disorder.
Biol Psychiatry
1994
, vol. 
35
 
3
(pg. 
210
-
213
)
24
Ballin
 
A
Lehman
 
D
Sirota
 
P
Litvinjuk
 
U
Meytes
 
D
Increased number of peripheral blood CD34+ cells in lithium-treated patients.
Br J Haematol
1998
, vol. 
100
 
1
(pg. 
219
-
221
)
25
Gallicchio
 
V
MG
 
Modulation of murine pluripotential stem cell proliferation in vivo by lithium carbonate.
Blood
1980
, vol. 
56
 
6
(pg. 
1150
-
1152
)
26
Quesenberry
 
P
Coppola
 
M
Gualtieri
 
R
, et al. 
Lithium stimulation of murine hematopoiesis in liquid culture: an effect mediated by marrow stromal cells.
Blood
1984
, vol. 
63
 
1
(pg. 
121
-
127
)
27
Phiel
 
CJ
Klein
 
PS
Molecular targets of lithium action.
Annu Rev Pharmacol Toxicol
2001
, vol. 
41
 (pg. 
789
-
813
)
28
van Os
 
RP
Dethmers-Ausema
 
B
de Haan
 
G
In vitro assays for cobblestone area-forming cells, LTC-IC, and CFU-C.
Methods Mol Biol
2008
, vol. 
430
 
3
(pg. 
143
-
157
)
29
Gerrits
 
A
Li
 
Y
Tesson
 
BM
, et al. 
Expression quantitative trait loci are highly sensitive to cellular differentiation state.
PLoS Genet
2009
, vol. 
5
 
10
pg. 
e1000692
 
30
Voy
 
BH
Scharff
 
JA
Perkins
 
AD
, et al. 
Extracting gene networks for low-dose radiation using graph theoretical algorithms.
PLoS Comput Biol
2006
, vol. 
2
 
7
pg. 
e89
 
31
Bastian
 
M.
Heymann
 
S.
Jacomy
 
M
Gephi: an open source software for exploring and manipulating networks.
Presented at the International AAAI Conference on Weblogs and Social Media
May 2009
San Jose, CA
32
Frank
 
SR
Schroeder
 
M
Fernandez
 
P
Taubert
 
S
Amati
 
B
Binding of c-Myc to chromatin mediates mitogen-induced acetylation of histone H4 and gene activation.
Genes Dev
2001
, vol. 
15
 
16
(pg. 
2069
-
2082
)
33
Tsai
 
FY
Keller
 
G
Kuo
 
FC
, et al. 
An early haematopoietic defect in mice lacking the transcription factor GATA-2.
Nature
1994
, vol. 
371
 
6494
(pg. 
221
-
226
)
34
Zeng
 
H
Yucel
 
R
Kosan
 
C
Klein-Hitpass
 
L
Moroy
 
T
Transcription factor Gfi1 regulates self-renewal and engraftment of hematopoietic stem cells.
EMBO J
2004
, vol. 
23
 
20
(pg. 
4116
-
4125
)
35
Ayton
 
P
Cleary
 
M
Transformation of myeloid progenitors by MLL oncoproteins is dependent on Hoxa7 and Hoxa9.
Genes Dev
2003
, vol. 
17
 
18
(pg. 
2298
-
2307
)
36
Roloff
 
TC
Nuber
 
UA
Chromatin, epigenetics and stem cells.
Eur J Cell Biol
2005
, vol. 
84
 
2-3
(pg. 
123
-
135
)
37
Laslo
 
P
Spooner
 
CJ
Warmflash
 
A
, et al. 
Multilineage transcriptional priming and determination of alternate hematopoietic cell fates.
Cell
2006
, vol. 
126
 
4
(pg. 
755
-
766
)
38
Passegué
 
E
Wagner
 
EF
Weissman
 
IL
JunB deficiency leads to a myeloproliferative disorder arising from hematopoietic stem cells.
Cell
2004
, vol. 
119
 
3
(pg. 
431
-
443
)
39
Tseng
 
C
Huang
 
C
Tseng
 
C
Lin
 
M
Hsieh
 
J
Tseng
 
C
Induction of disabled-2 gene during megakaryocyte differentiation of K562 cells.
Biochem Biophys Res Commun
2001
, vol. 
285
 
1
(pg. 
129
-
135
)
40
Lien
 
C
Fang
 
C
Huso
 
D
Livak
 
F
Lu
 
R
Pitha
 
PM
Critical role of IRF-5 in regulation of B-cell differentiation.
Proc Natl Acad Sci U S A
2010
, vol. 
107
 
10
(pg. 
4664
-
4668
)
41
Goudeau
 
B
Huetz
 
F
Samson
 
S
, et al. 
IκBα/IκBϵ deficiency reveals that a critical NF-κB dosage is required for lymphocyte survival.
Proc Natl Acad Sci U S A
2003
, vol. 
100
 
26
(pg. 
15800
-
15805
)
42
Walsh
 
JC
DeKoter
 
RP
Lee
 
H
, et al. 
Cooperative and antagonistic interplay between PU. 1 and GATA-2 in the specification of myeloid cell fates.
Immunity
2002
, vol. 
17
 
5
(pg. 
665
-
676
)
43
Wilson
 
NK
Foster
 
SD
Wang
 
X
, et al. 
Combinatorial transcriptional control in blood stem/progenitor cells: genome-wide analysis of ten major transcriptional regulators.
Cell Stem Cell
2010
, vol. 
7
 
4
(pg. 
532
-
544
)
44
Pimanda
 
JE
Göttgens
 
B
Gene regulatory networks governing haematopoietic stem cell development and identity.
Int J Dev Biol
2010
, vol. 
54
 
6-7
(pg. 
1201
-
1211
)
45
Ozawa
 
Y
Towatari
 
M
Tsuzuki
 
S
, et al. 
Histone deacetylase 3 associates with and represses the transcription factor GATA-2.
Blood
2001
, vol. 
98
 
7
(pg. 
2116
-
2123
)
46
Gurvich
 
N
Klein
 
PS
Lithium and valproic acid: parallels and contrasts in diverse signaling contexts.
Pharmacol Ther
2002
, vol. 
96
 
1
(pg. 
45
-
66
)
47
de Haan
 
G
Weersing
 
E
Dontje
 
B
, et al. 
In vitro generation of long-term repopulating hematopoietic stem cells by fibroblast growth factor-1.
Dev Cell
2003
, vol. 
4
 
2
(pg. 
241
-
251
)
48
Himburg
 
HA
Muramoto
 
GG
Daher
 
P
, et al. 
Pleiotrophin regulates the expansion and regeneration of hematopoietic stem cells.
Nat Med
2010
, vol. 
16
 
4
(pg. 
475
-
482
)
49
Oliveros
 
JC
VENNY. An interactive tool for comparing lists with Venn diagrams.
2007
Accessed August 22, 2011 
50
Sturn
 
A
Quackenbush
 
J
Trajanoski
 
Z
Genesis: cluster analysis of microarray data.
Bioinformatics
2002
, vol. 
18
 
1
(pg. 
207
-
208
)