Patients after allogeneic stem-cell transplantation (alloSCT) have an increased risk for invasive aspergillosis (IA). Here, recipients of an allograft with IA (n = 81) or without IA (n = 58) were screened for 84 single nucleotide polymorphisms in 18 immune relevant genes. We found 3 markers in chemokine (C-X-C motif) ligand 10 (CXCL10, 4q21, 11 101 C > T, P = .007; 1642 C < G, P = .003; −1101 A < G, P = .001) significantly associated with an increased risk of developing IA. Furthermore, immature dendritic cells (iDCs) exposed to Aspergillus fumigatus germlings showed markedly higher CXCL10 expression, if carrying the wild type genotype, compared with the “CGAG” high risk haplotype. In addition, serum from patients with proven/probable IA showed increased serum levels of CXCL10, compared with immunocompromised patients without IA. Thus, polymorphisms in CXCL10 determine chemokine secretion by iDCs upon exposure to A fumigatus and most likely thereby genetically determine the risk of IA after alloSCT.

Introduction

Infections with Aspergillus fumigatus are frequent and life threatening in patients after allogeneic stem-cell transplantation (alloSCT).1  Several single nucleotide polymorphisms (SNPs) were described influencing the course and outcome of invasive aspergillosis (IA). Kesh and colleagues revealed an association of IA with polymorphisms in Toll-like receptor genes TLR1 and TLR6, whereas no association could be found for the TLR4 gene.2  In addition, it has been shown that polymorphisms in mannan-binding lectin (MBL) contribute to the occurrence of allergic bronchopulmonary aspergillosis (ABPA) by influencing the MBL plasma level and protein activity.3  Besides MBL, further SNPs in C-type lectins were investigated leading to the identification of an association between ABPA and variants of the surfactant protein A2 gene (SFPTPA2).4  In contrast, alleles with a protective role in the pathogenesis of IA were discovered in the promoter region of IL10.5 

Methods

This study was approved by the local ethics committees involved in the study (University of Innsbruck, Innsbruck, Austria; University of Graz, Graz, Austria; Karolinska University Hospital, Stockholm, Sweden; and Medical Hospital II, Tübingen, Germany).

Patient and sampling data

After approval of the local ethics committees, each consecutive patient who underwent alloSCT and who showed complete donor chimerism at the time of blood collection (as determined by short tandem repeat markers6 ) was asked for study participation. After informed consent was obtained in accordance with the Declaration of Helsinki, blood samples from 139 consecutive patients were collected between day +20 and day +50 after alloSCT. Patients suffered from acute myeloid leukemia (n = 57), chronic myeloid leukemia (n = 26), acute lymphatic leukemia (n = 20), multiple myeloma (n = 11), and other hematologic disorders (n = 25). Sampling was performed at the University of Innsbruck, Innsbruck, Austria (n = 16), University of Graz, Graz, Austria (n = 26), Karolinska University Hospital, Stockholm, Sweden (n = 13), and Medical Hospital II, Tübingen, Germany (n = 84). All patients were of European origin (median age 37y, range [7-61y], 82/139 males). Patients after alloSCT either developed proven or probable IA (as defined by the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Co-operative Group (EORTC-IFICG)/ National Institute of Allergy and Infectious Diseases/Mycoses Study Group (NIAID/MSG),7  n = 81) whereas controls (alloSCT patients without IA, n = 58) did not fulfil these criteria.

According to a case-control study design, samples were analyzed for association between an increased risk for IA and defined genetic markers (n = 84) in 18 genes (Table S1, available on the Blood website; see the Supplemental Materials link at the top of the online article). Genes were chosen for being differentially regulated in genome-wide expression profiling studies in cocultures of A fumigatus with immature dendritic cells (iDCs) or for being generally relevant for regulation of immune defense mechanisms. Retrospective genotyping was carried out as previously described on DNA from each patient who had given consent.8 

The following clinical risk factors were tested for an association to IA: (1) selection of CD34+ cells before alloSCT, (2) corticosteroid therapy with a dosage of more than 2 mg/kg body weight, (3) severe acute graft-versus-host disease (aGVHD), grade II – IV, (4) cytomegalovirus disease (HCMV), and (5) respiratory virus (RV) infection. HCMV disease was defined by Ljungman et al,9  RV infection was defined as influenza A, influenza B, human parainfluenza 1-3, adenovirus, and respiratory syncytial virus detection by culture or reverse transcriptase–polymerase chain reaction (RT-PCR) assay.10 

In a preliminary, add-on study, 1 mL serum from further consecutive patients after alloSCT, (each patient who agreed to participate was included, n = 33, median age 52 years, range [23-64 years], 19/33 males) and from randomly selected laboratory workers (n = 14, median age 28 years, range [23-41 years], 6/14 males) was collected for quantification of CXCL10 levels by ELISA (R&D Systems, Wiesbaden, Germany). Patients suffered from proven or probable IA (6/33) or showed no clinical signs of infection (27/33).

Statistical analysis

Allele and genotype frequencies were compared between patients with IA and controls using Allele-Frequency-Difference-Test and Armitage Trend Test, respectively. P values less than .01 were considered to be significant. All markers were tested for Hardy-Weinberg equilibrium using the chi square test statistics with one degree of freedom, or an exact test in case of low expectation values (< 5). For 4 markers in CXCL10, haplotype analysis was performed with the program FAMHAP8,11  (version 16; Dr Tim Beder, University of Bonn, Institut für Medizinische Biometrie, Informatik und Epidemiologie, Bonn, Germany) and the overall significance for the haplotype block was calculated based on a permutation based procedure to correct for multiples testing. CXCL10 serum levels were analyzed with the Wilcoxon test.

Analysis of CXCL10 expression upon stimulation with A fumigatus

Isolation of monocytes (obtained from the laboratory workers mentioned above) and differentiation into iDCs was achieved as described before.12  Cocultivation of A fumigatus germlings (ATCC 9197) with iDCs was carried out for 5hours. CXCL10 expression was analyzed by real-time PCR assay13  using the following primers (F: acgtgttgagatcattgctacaa, R: gattttgctcccctctggt) and probes (P1: agtaaattcttgatggccttcgattct, P2: gattcagacatctcttctcacccttctttt, TIB MOLBIOL, Berlin, Germany). Results were normalized against the housekeeping gene 5-aminolevulinate synthase.14 

Results and discussion

DNA specimens of 139 patients after alloSCT were screened for defined polymorphisms. The single marker analyses revealed no association with an increased risk for IA for 80 of the 84 genetic markers (Table S1). However, 3 SNPs in CXCL10 (rs1554013, rs3921, and rs425767415 ) and one marker in IFN-γ (rs2069705) showed a significant association with the occurrence of IA (P < .01, Table 1).

Table 1

Genotyped polymorphisms in CXCL10 and statistical analysis

dbSNP number, alleleControlIAP
rs1554013 (+11 101 C/T)   .007* 
    C/C 24  
    C/T 29 20  
    T/T 11  
rs3921 (+1642 C/G)   .003* 
    C/C  
    C/G 27 15  
    G/G 10 21  
rs4859588 (+908 A/G)   .057 
    A/A 19  
    A/G 28 20  
    G/G 10  
rs4257674 (-1101 A/G)   .001* 
    A/A 12  
    A/G 22 19 
    G/G 10 28  
dbSNP number, alleleControlIAP
rs1554013 (+11 101 C/T)   .007* 
    C/C 24  
    C/T 29 20  
    T/T 11  
rs3921 (+1642 C/G)   .003* 
    C/C  
    C/G 27 15  
    G/G 10 21  
rs4859588 (+908 A/G)   .057 
    A/A 19  
    A/G 28 20  
    G/G 10  
rs4257674 (-1101 A/G)   .001* 
    A/A 12  
    A/G 22 19 
    G/G 10 28  

Association analysis between genetic polymorphisms in CXCL10 and the risk to develop IA for patients after alloSCT. Numbers of homozygous and heterozygous alleles used for statistical comparison are specified. Positions of the SNPs in the respective genes have been determined at http://snpper.chip.org/.

*

indicates significant Pvalues (P < .01) as obtained by Allele-Frequency Difference Test.

Haplotype analysis for the 3 markers in CXCL10 [rs1554013 (C/T), rs3921 (C/G), rs4859588 (A/G)] and the IFN-γ marker rs4257674 (A/G, located in a potential negative regulatory site) confirmed the single marker analysis and identified “CGAG” as the high risk haplotype (significance of the haplotype block: P = .008).

There is currently no consensus on how to adjust the level of significance in exploratory epidemiologic studies. The Bonferroni correction for multiple testing is often considered too conservative. In this study, P values less than .01 were considered to be significant for single marker analysis, but it cannot be excluded that even P values less than .05 can be regarded as indicators for an association with the occurrence of IA.16,17  We believe that multiple occurrence of several markers with low (P < .01) P values in one gene region and a significant P value of the haplotype analysis corrected for multiple testing give strong evidence of a true association.

CXCL10 is an inflammatory mediator, induced by IFN-γ, which stimulates the directional migration of Th1 cells as well as increasing T-cell adhesion to endothelium.17  Antigen-specific proliferation of T cells occurred in healthy individuals and in patients surviving IA, indicating that T-lymphocytes play a pivotal role in fungal clearance.19  Furthermore, Th1/Th2 deregulation and a switch to Th2 immune response may contribute to an unfavorable outcome of IA.19 

Serum levels of CXCL10 were compared in patients after alloSCT and in healthy individuals. In sera from patients who survived proven or probable IA (mean 998 pg/mL, range [753-1445 pg/mL], P = .002) as well as in specimens from patients without signs of infection (mean 554 pg/mL, range [151-1030 pg/mL], P = .004), CXCL10 levels were significantly higher compared with healthy controls (mean 102 pg/mL, range [28-372 pg/mL]).

To study the role of A fumigatus for CXCL10 induction, A fumigatus germlings were cocultured with iDCs generated from blood of healthy volunteers. Stimulation with A fumigatus augmented CXCL10 expression, dependent on the respective genoptype. In iDCs carrying the wild type alleles, CXCL10 expression increased notably [53.4×-335.5×], whereas in iDCs with the identified risk haplotype, expression ranged between 1.5× and 35.8× only. In the mean, markedly higher mRNA levels (9.3×) could be detected in iDCs carrying the wild type haplotype. These observations confirm the relevance of the risk haplotype “CGAG” for CXCL10 production and support the role of CXCL10 for effective immune defense against A fumigatus.

Table 2 shows the odds ratios of the clinical risk factors analyzed. Although most of them are not statistically significant, they point in the expected direction of being associated with A fumigatus infection. We suppose that lower P values might have been found in larger patient cohorts, as demonstrated by Upton et al in 405 cases.20  We found an especially strong association for the occurrence of RV infections (P = .004) with A fumigatus infection. This observation confirms data from Marr et al, who assumed that increased risk may be related to effects on pulmonary phagocyte function.21 

Table 2

Correlation between defined clinical parameters and patients with or without proven/probable IA after alloSCT

Clinical parametersPatients with proven/probable IA, %Controls, %POdds ratio
Corticosteroid therapy   .971 0.98 [0.29-3.19] 
    Less than 2 mg/kg 58.0 57.4   
    More than 2 mg/kg 42.0 42.6   
Acute GVHD   .161 2.11 [0.63-7.11] 
    Grade 0 to 1 52.6 70.4   
    Grade 2 to 4 47.4 29.6   
Chronic GVHD   .367 2.31 [0.31-15.32] 
    None 84.2 92.6   
    Limited/extensive 15.8 7.4   
CD34 selection   .144 0.24 [0.02-2.40] 
    Yes 93.5 76.9   
    No 6.5 23.1   
RSV infection   .004* 6.05* [1.65-23.68] 
    Yes 52.6 15.1   
    No 47.4 84.9   
CMV infection   .112 2.25 [0.72-7.14] 
    Yes 45.8 27.1   
    No 54.2 72.9   
Clinical parametersPatients with proven/probable IA, %Controls, %POdds ratio
Corticosteroid therapy   .971 0.98 [0.29-3.19] 
    Less than 2 mg/kg 58.0 57.4   
    More than 2 mg/kg 42.0 42.6   
Acute GVHD   .161 2.11 [0.63-7.11] 
    Grade 0 to 1 52.6 70.4   
    Grade 2 to 4 47.4 29.6   
Chronic GVHD   .367 2.31 [0.31-15.32] 
    None 84.2 92.6   
    Limited/extensive 15.8 7.4   
CD34 selection   .144 0.24 [0.02-2.40] 
    Yes 93.5 76.9   
    No 6.5 23.1   
RSV infection   .004* 6.05* [1.65-23.68] 
    Yes 52.6 15.1   
    No 47.4 84.9   
CMV infection   .112 2.25 [0.72-7.14] 
    Yes 45.8 27.1   
    No 54.2 72.9   
*

indicates significant P value (<.01) and odds ratio.

Only a few reports exist about an association of SNPs with susceptibility to IA, including markers in mannose-binding lectin and TLR genes.2,3,22  In contrast to Bochud et al, who showed that a distinct haplotype in TLR4 increased the risk of mould infections, our analyses did not show an association between polymorphisms in TLR4 (n = 5) and the probability of IA.23 

In conclusion, screening of patients after alloSCT for the presence of defined alleles in CXCL10 might have an impact on early identification of patients at risk for the development of IA, and thus on individualization of antifungal prophylaxis and treatment. A prospective study, evaluating treatment / prophylaxis strategies based on genetic polymorphisms in CXCL10, is under development.

The online version of this article contains a data supplement.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 USC section 1734.

Acknowledgments

We thank Dr Oliver Morton, Trinity College, Dublin, Ireland, for correction of the English language, and all volunteers for their generous blood donations.

This study was supported by research funding from the National Genomic Research Network, the European Union (EU) project The Development of Immunotherapeutic Strategies to Treat Haematologic and Neoplastic Diseases on the Basis of Optimised Allogeneic Stem Cell Transplantation (Allostem; LSHB-CT-2004-503319), the Infectious Diseases Working Party of the European Group for Blood and Marrow Transplantation (EBMT-IDWP), and the EuroNet Leukemia (Contract No. LSH-2002-2.2.0-3; Strengthen and develop scientific and technologic excellence in research and therapy of leukemia [CML, AML, ALL, CLL, MDS, CMPD] by integration of the leading national leukemia networks and their interdisciplinary partner groups in Europe; Project No. 503216).

Authorship

Contribution: M.M. performed research, analyzed data, and wrote; the manuscript; M.S. and T.F.W. performed data analysis; M.B. performed research and data analysis; C.M.J.E. and M.R.T. performed research; P.L. and H.J.D. collected data; H.H. and H.E. designed research; and J.L. designed research, analyzed data, and wrote the manuscript.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Dr Juergen Loeffler, Medizinische Klinik & Poliklinik II, Josef-Schneider-Str. 2, 97070 Würzburg, Germany; e-mail: loeffler_j@klinik.uni-wuerzburg.de.

References

References
1
Einsele
H
Hebart
H
Cellular immunity to viral and fungal antigens after stem cell transplantation.
Curr Opin Hematol
2002
9
485
489
2
Kesh
S
Mensah
NY
Peterlongo
P
et al
TLR1 and TLR6 polymorphisms are associated with susceptibility to invasive aspergillosis after allogeneic stem cell transplantation.
Ann N Y Acad Sci
2005
1062
95
103
3
Kaur
S
Gupta
VK
Shah
A
Thiel
S
Sarma
PU
Madan
T
Elevated levels of mannan-binding lectin (MBL) and eosinophilia in patients of bronchial asthma with allergic rhinitis and allergic bronchopulmonary aspergillosis associate with a novel intronic polymorphism in MBL.
Clin Exp Immunol
2006
143
414
419
4
Madan
T
Kaur
S
Saxena
S
et al
Role of collectins in innate immunity against aspergillosis.
Med Mycol
2005
43
155
163
5
Seo
KW
Kim
DH
Sohn
SK
et al
Protective role of interleukin-10 promoter gene polymorphism in the pathogenesis of invasive pulmonary aspergillosis after allogeneic stem cell transplantation.
Bone Marrow Transplant
2005
36
1089
1095
6
Thiede
C
Bornhäuser
M
Ehninger
G
Evaluation of STR informativity for chimerism testing–comparative analysis of 27 STR systems in 203 matched related donor recipient pairs.
Leukemia
2004
18
248
254
7
Ascioglu
S
Rex
JH
de Pauw
B
et al
Defining opportunistic invasive fungal infections in immunocompromised patients with cancer and hematopoietic stem cell transplants: an international consensus.
Clin Infect Dis
2002
34
7
14
8
Loeffler
J
Steffens
M
Arlt
EM
et al
Polymorphisms in the genes encoding chemokine receptor 5, interleukin-10, and monocyte chemoattractant protein 1 contribute to cytomegalovirus reactivation and disease after allogeneic stem cell transplantation.
J Clin Microbiol
2006
44
1847
1850
9
Ljungman
P
Griffiths
P
Paya
C
Definitions of cytomegalovirus infection and disease in transplant recipients.
Clin Infect Dis
2002
34
1094
1097
10
Roghmann
M
Ball
K
Erdman
D
Lovchik
J
Anderson
LJ
Edelman
R
Active surveillance for respiratory virus infections in adults who have undergone bone marrow and peripheral stem cell transplantation.
Bone Marrow Transplant
2003
32
105
1088
11
Becker
T
Knapp
M
A powerful strategy to account for multiple testing in the context of haplotype analysis.
Am J Hum Genet
2004
75
561
570
12
Grigoleit
U
Riegler
S
Einsele
H
et al
Human cytomegalovirus induces a direct inhibitory effect on antigen presentation by monocyte-derived immature dendritic cells.
Br J Haematol
2002
119
189
198
13
Loeffler
J
Swatoch
P
Akhawi-Araghi
D
Hebart
H
Einsele
H
Automated RNA extraction by MagNA Pure followed by rapid quantification of cytokine and chemokine gene expression with use of fluorescence resonance energy transfer.
Clin Chem
2003
49
955
958
14
Johnson
MR
Wang
K
Smith
JB
Heslin
MJ
Diasio
RB
Quantitation of dihydropyrimidine dehydrogenase expression by real-time reverse transcription polymerase chain reaction.
Anal Biochem
2000
278
175
184
15
National Center for Biotechnology Information, US National Library of Medicine
Accessed April 2007
16
Feise
RJ
Do multiple outcome measures require p-value adjustment?
BMC Med Res Methodol
2002
2
8
11
17
Rothman
KJ
No adjustments are needed for multiple comparisons.
Epidemiology
1990
1
43
46
18
Loetscher
M
Gerber
B
Loetscher
P
et al
Chemokine receptor specific for IP10 and mig: structure, function, and expression in activated T-lymphocytes.
J Exp Med
1996
184
963
969
19
Hebart
H
Bollinger
C
Fisch
P
et al
Analysis of T-cell responses to Aspergillus fumigatus antigens in healthy individuals and patients with hematologic malignancies.
Blood
2002
100
4521
4528
20
Upton
A
Kirby
KA
Carpenter
P
Boeckh
M
Marr
KA
Invasive aspergillosis following hematopoietic cell transplantation: outcomes and prognostic factors associated with mortality.
Clin Infect Dis
2007
44
531
540
21
Marr
KA
Carter
RA
Boeckh
M
Martin
P
Corey
L
Invasive aspergillosis in allogeneic stem cell transplant recipients: changes in epidemiology and risk factors.
Blood
2002
100
4358
4366
22
Vaid
M
Kaur
S
Sambatakou
H
Madan
T
Denning
DW
Sarma
PU
Distinct alleles of mannose-binding lectin (MBL) and surfactant proteins A (SP-A) in patients with chronic cavitary pulmonary aspergillosis and allergic bronchopulmonary aspergillosis.
Clin Chem Lab Med
2007
45
183
186
23
Bochud
PY
Chien
JW
Janer
M
Marr
KA
Aderem
A
Boeckh
M
Donor's toll-like receptor (TLR) 4 haplotypes increase the incidence of invasive mold infections (IMI) in hematopoietic stem cell transplant (HCT) recipients.
Paper presented at the Annual Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) of the American Society of Microbiology (ASM)
September 27-30, 2006
San Francisco, CA
Abstract B-1329