Hemophilia A, a deficiency of functional coagulation factor VIII (FVIII), is treated via protein replacement therapy. Restoring 1% to 5% of normal blood FVIII activity prevents spontaneous bleeding, making the disease an attractive gene therapy target. Previously, we have demonstrated short-term activity of a liver-specific AAV2 vector expressing canine B-domain-deleted FVIII (cFVIII) in a hemophilia canine model. Here, we report the long-term efficacy and safety of AAV-cFVIII vectors of serotypes 2, 5, 6, and 8 in both hemophilia A mice and dogs. AAV6-cFVIII and AAV8-cFVIII restored physiologic levels of plasma FVIII activity in hemophilia A mice. The improved efficacy is attributed to more efficient gene transfer in liver compared with AAV2 and AAV5. However, supraphysiologic cFVIII levels correlated with the formation of cFVIII-neutralizing antibodies in these mice. Of importance, hemophilia A dogs that received AAV2-cFVIII, AAV6-cFVIII, and AAV8-cFVIII have persistently expressed therapeutic levels of FVIII, without antibody formation or other toxicities, for more than 3 years. However, liver transduction efficiencies are similar between AAV2, AAV6, and AAV8 serotypes in hemophilia A dogs, in contrast to mice. In summary, this is the first report demonstrating multiyear therapeutic efficacy and safety of multiple AAV-cFVIII vectors in hemophilia A dogs and provides the basis for human clinical studies. (Blood. 2006;108:107-115)

Introduction

Hemophilia A, a congenital deficiency or dysfunction of factor VIII (FVIII), is the most common severe inherited bleeding disorder in humans. Severe hemophilia A patients have less than 1% of normal FVIII activity, and suffer from spontaneous or traumatic joint and muscle hemorrhage, leading to a chronic painful and disabling arthropathy. Bleeding into body cavities or the brain can result in significant morbidity and mortality if not treated aggressively.1  Current treatment in the developed world, FVIII protein replacement, has established that restoring circulating FVIII levels above 1% of normal prevents most spontaneous bleeding, and levels above 5% are sufficient to improve the disease from a severe to a mild form. However, the limited worldwide supplies of both plasma-derived and recombinant FVIII, its short half-life in vivo (∼ 12 hours), and the high cost of treatment (> $150 000 per year) make gene therapy an attractive alternative to better manage and cure the disease.

Previously, we have shown that gene therapy with an AAV2 vector encoding a B-domain-deleted (BDD) canine FVIII (cFVIII) cDNA under the control of a liver-specific promoter resulted in an average of 2% to 3% of normal canine FVIII activity in 2 hemophilia A dogs,2  providing preliminary support for the feasibility of this approach in humans. In order to further improve the efficacy of liver-targeted AAV-cFVIII, we explored the possibility of using alternative serotypes of AAV. We also assessed the duration of therapeutic benefit following a single injection of AAV-cFVIII in hemophilia A dogs.

Since the isolation of AAV2, many different AAV serotypes have been isolated from human and nonhuman primate tissues.3  In comparison with the prototypic AAV2, AAV vectors pseudotyped with other serotypes show superior transduction efficiency in various tissues: AAV1 in muscle,4  pancreatic islets,5  heart,6  vascular endothelium,7  brain and central nervous system (CNS),8,9  and liver10 ; AAV3 in Cochlear inner hair cells11 ; AAV4 in brain12 ; AAV5 in brain and CNS,8,13  lung,14-16  eye,17,18  arthritic joints,19  and liver20 ; AAV6 in muscle,21,22  heart,23  and airway epithelium24 ; AAV7 in muscle4 ; and AAV8 in muscle,4,25  pancreas,26  heart,25  and liver.27-31  The tissue tropism of different AAV serotypes may permit targeting of AAV vectors to human disease. However, as most of these tissue-specific tropisms have been reported in the rodent, it is important to evaluate cross-species fidelity of differential targeting among serotypes in larger animal models

In this report, we have compared the efficacy, gene transfer efficiency, and biodistribution of AAV-cFVIII vectors of serotypes 2, 5, 6, and 8 delivered by portal-vein injection in hemophilia A mice. Furthermore, since prior studies have demonstrated that the hemophilia dog model, compared with the mouse model, more accurately predicts the therapeutic outcomes in humans and other primates,32,33  we have determined the long-term efficacy and safety of AAV2-cFVIII, AAV6-cFVIII, and AAV8-cFVIII vectors in hemophilia A dogs, to assess whether dogs recapitulate the findings for different vector serotypes observed in mice. The potential application of alternative serotype AAV-FVIII vectors in humans not only may enhance the therapeutic efficacy, but also may diminish some neutralization by pre-existing anti-AAV2 antibodies that are prevalent in the human population.

Materials and methods

Vectors

The AAV B-domain-deleted canine FVIII vector construct was described previously.2  Briefly, the vector genome contains a minimal transthyretin promoter (202 nt), a synthetic intron (106 nt), the BDD-cFVIII cDNA (4367 nt), and a synthetic polyA sequence (46 nt), flanked by AAV2 inverted terminal repeats (ITRs, 145 nt). The vector genome with AAV2 ITRs was packaged into capsids from AAV2, and pseudotyped into AAV5, AAV6,34  and AAV827  by triple transfection in 293 cells.35  Vectors were purified by CsCl-gradient centrifugation, as described.36  Vector genomes were titered by quantitative real-time polymerase chain reaction (PCR) using primers and probes specific to canine FVIII light-chain sequences, and a linearized plasmid DNA standard.

Animal procedures

Hemophilia A mice37  were obtained from H. Kazazian. AAV-cFVIII vectors were diluted in PBS to a final volume of 200 μL and injected into the portal vein of mice. Citrated mouse plasmas were isolated from 200 μL blood collected via the retro-orbital plexus at multiple time points. Upon termination of the study, mice were humanely killed and perfused with PBS, and portions of liver, spleen, kidney, lung, heart, and gonadal tissue were harvested and snap-frozen in liquid nitrogen for molecular analyses; additional liver samples were embedded in OCT for fluorescence in situ hybridization. Hemophilia A dogs were bred at Queens University and injected with AAV-cFVIII vectors following the procedure previously described.2  Briefly, prior to surgery, dogs were treated intravenously with 25 mg diphenhydramine hydrochloride and 100 mg hydrocortisone. The dogs were then infused with canine cryoprecipitate to raise their plasma FVIII levels to more than 50% of normal levels. A midline incision was made in the abdomen of the animal, and the AAV-cFVIII vector was administered via the portal vein using a 23-gauge butterfly catheter at a rate of 0.24 to 0.6 mL/kg per minute. Postoperatively, the dogs were treated with cryoprecipitate at 7 and 24 hours. For the liver biopsies, a similar presurgical schedule was followed. After a thoracic-to-abdomen incision was made to expose the liver, six 6-mm liver sections were removed from multiple sites and then further divided into two 3-mm sections. One section from each site was preserved in OCT and snap-frozen on dry ice, and the second was snap-frozen in liquid nitrogen. All animal procedures were reviewed by the institutional Animal Care Committees and were in accordance with the “Guide for the Care and Use of Laboratory Animals”38  and the Canadian Council for Animal Care.

Coatest assay

Canine FVIII activity in mouse and canine plasma was measured by the Coatest VIII:C/4 assay from Chromogenix (DiPharma, West Chester, OH), following the manufacturer's instructions, using BDD human FVIII (ReFacto; Genetics Institute, Cambridge, MA) serially diluted from 50 to 1.56 mU/mL in hemophilia A murine or canine plasma to generate a standard curve.

Bethesda assay

Neutralizing antibodies to canine FVIII in mouse and canine plasma were measured by the Bethesda assay, as described previously.39  The standard curve for residual canine FVIII activity was generated with serially diluted normal canine plasma in hemophilia A murine or canine plasma.

Southern blotting analysis

Liver genomic DNAs harvested from mice were digested with BamHI and BglII, and hybridized with 32 P-labeled probes representing sequences of a 974-bp BamHI-BamHI and a 760-bp BglII-BglII fragment in the canine FVIII light- and heavy-chain coding region, respectively. The standards were pooled liver genomic DNAs of naive hemophilia A mice spiked with 0.62 to 20 copy/diploid genome of plasmid pAAV-cFVIII DNA digested with BamHI and BglII. Hybridization for canine liver genomic DNAs digested with BamHI was described previously.2  The standards were pooled liver genomic DNAs of naive hemophilia A dogs spiked with 0.16 to 5 copy/diploid genome of plasmid pAAV-cFVIII DNA digested with BamHI.

Fluorescence in situ hybridization (FISH)

RNA FISH for canine FVIII transcripts in mouse liver was performed as previously described.2  Briefly, liver cryosections were hybridized with a cocktail of HRP-conjugated probes containing canine FVIII heavy- and light-chain antisense sequences. The positive signal was detected using a Tyramide signal amplification fluorescein kit (Perkin Elmer, Boston, MA). The transduction efficiency was determined by counting positive cells in 5 fields of view (400 nuclei) from 5 sections representing approximately 10 000 nuclei. The images were recorded using a Quips imaging system (Applied Imaging, Santa Clara, CA) on a Zeiss Axioskop fluorescence microscope (Carl Zeiss, Thornwood, NY) equipped with a Plan Neofluars 20 ×/0.5 NA objective lens. The images were not further processed.

Real-time quantitative PCR (QPCR)

QPCR was performed as previously described40  on genomic DNAs isolated from various tissues of mice. The copy number of canine FVIII DNA was quantified against a standard generated with linearized plasmid pAAV-cFVIII DNA serially diluted, in pooled genomic DNAs from naive hemophilia A mice, from 1 × 106  to 12.8 copies per reaction. The forward primer is 5′ TCCAACTCCCCTGCTAAATGA 3′; reverse primer, 5′ TCTGGCTGAAGAGTAGTAACGGTTATT 3′; and probe, 5′ 6FAM AAGCTTCTCCCAGAATCCACCAGTCTCAA TAMRA 3′.

Thrombelastography (TEG) analysis

TEG was performed on frozen citrated plasma samples using a Thrombelastograph Analyzer (Haemoscope, Niles, IL). The plasma was thawed in a 37°C water bath. Twenty microliters of 0.2 M CaCl2 was added to the TEG sample cup, and, as soon as the plasma sample was thawed, 340 μL plasma was added to the CaCl2 and mixed by 3 pipetting strokes. After addition of the plasma sample, the TEG analysis was started.

Statistical analyses

Two-tailed Student t tests, one-way ANOVA with Bonferroni multiple comparison posttest, and the Pearson test were performed using Prism 4 (GraphPad, San Diego, CA).

Results

Enhanced efficacy of AAV6 and AAV8 serotypes compared with AAV2 and AAV5 in hemophilia A mice

First, we compared the efficacy of AAV5-cFVIII versus AAV2-cFVIII vectors at doses of 3 × 1011  and 6 × 1011  vg/mouse delivered by portal-vein injection in C57BL/6 hemophilia A mice. The steady-state levels of FVIII in mouse plasma achieved by AAV5 delivery were 83 ± 14 and 302 ± 58 mU/mL at the low and high dose (n = 4/dose group), respectively, over 12 weeks (Figure 1A). In comparison, AAV2-cFVIII, at the same doses, achieved steady-state FVIII levels of 1235 ± 76 and 2337 ± 134 mU/mL in hemophilia A mice (n = 16/group and n = 8/group, respectively) over 22 weeks, 8- to 14-fold higher than AAV5 (Figure 1A). The normal canine FVIII activity is approximately 7000 mU/mL when measured against a human FVIII standard.41 

In the next comparison between AAV2-cFVIII and AAV6-cFVIII vectors, 3 groups of mice (n = 6-16/group) received AAV2-cFVIII at 1 × 1011 ,3 × 1011 , and 9 × 1011  vg/mouse, and achieved steady-state FVIII levels of 806 ± 51, 1201 ± 72, and 3243 ± 143 mU/mL, respectively, over 30 weeks (Figure 1B). In comparison, 1 × 1011  and 3 × 1011  vg/mouse of AAV6-cFVIII resulted in steady-state FVIII levels of 1665 ± 99 and 3717 ± 227 mU/mL, respectively, in hemophilia A mice (n = 15/group), which are 2- to 3-fold higher than that by AAV2-cFVIII (P < .001) (Figure 1B). A higher dose of AAV6-cFVIII at 9 × 1011  vg/mouse resulted in the development of canine FVIII-neutralizing antibodies that prevented detection of FVIII activity in plasma (next section). In addition, we may have underestimated the steady-state FVIII level achieved by 3 × 1011  vg/mouse of AAV6-cFVIII due to the exclusion of mice that developed canine FVIII antibodies after treatment (next section). On the other hand, decreasing the dose of AAV6-cFVIII to 3 × 1010  vg/mouse (n = 6) was sufficient to achieve therapeutic levels of FVIII at 416 ± 9 mU/mL, which is equivalent to 5.9% of normal canine FVIII activity (Figure 1B). Further reduction of dose to 1 × 1010  vg/mouse (n = 5), however, produced only subtherapeutic levels (< 1%) of FVIII at 65 ± 4 mU/mL (Figure 1B).

Figure 1.

Relative efficacy of different serotypes of AAV-cFVIII delivered by portal-vein injection to hemophilia A mice. Canine FVIII activity in mouse plasma was measured by Coatest and converted to percentage of normal canine FVIII activity (7000 mU/mL). Results presented are the mean and standard error of the mean (SEM). (A) Comparisons between mice dosed with 3 × 1011  and 6 × 1011  vg/mouse of AAV5-cFVIII (n = 4/dose) or AAV2-cFVIII (n = 16 at 3 × 1011  vg/mouse and n = 8 at 6 × 1011  vg/mouse, respectively). (B) Comparisons between mice that received AAV2 and AAV6 vectors. AAV2-cFVIII was injected at 1 × 1011  (n = 6), 3 × 1011  (n = 16, from panel A), and 9 × 1011  vg/mouse (n = 6); AAV6-cFVIII was injected at 1 × 1010 (n = 5), 3 × 1010 (n = 6), 1 × 1011  (n = 15), and 3 × 1011  vg/mouse (n = 15). (C) Comparisons between mice treated with 1 × 1011  and 3 × 1011  vg/mouse of AAV6-cFVIII (n = 15/dose, from panel B) and AAV8-cFVIII (n=6/dose). Results after week 2 from mice dosed with 3 × 1011  vg/mouse of AAV8-cFVIII are not shown due to prevalent canine FVIII-neutralizing antibody formation in this group.

Figure 1.

Relative efficacy of different serotypes of AAV-cFVIII delivered by portal-vein injection to hemophilia A mice. Canine FVIII activity in mouse plasma was measured by Coatest and converted to percentage of normal canine FVIII activity (7000 mU/mL). Results presented are the mean and standard error of the mean (SEM). (A) Comparisons between mice dosed with 3 × 1011  and 6 × 1011  vg/mouse of AAV5-cFVIII (n = 4/dose) or AAV2-cFVIII (n = 16 at 3 × 1011  vg/mouse and n = 8 at 6 × 1011  vg/mouse, respectively). (B) Comparisons between mice that received AAV2 and AAV6 vectors. AAV2-cFVIII was injected at 1 × 1011  (n = 6), 3 × 1011  (n = 16, from panel A), and 9 × 1011  vg/mouse (n = 6); AAV6-cFVIII was injected at 1 × 1010 (n = 5), 3 × 1010 (n = 6), 1 × 1011  (n = 15), and 3 × 1011  vg/mouse (n = 15). (C) Comparisons between mice treated with 1 × 1011  and 3 × 1011  vg/mouse of AAV6-cFVIII (n = 15/dose, from panel B) and AAV8-cFVIII (n=6/dose). Results after week 2 from mice dosed with 3 × 1011  vg/mouse of AAV8-cFVIII are not shown due to prevalent canine FVIII-neutralizing antibody formation in this group.

The efficacy of AAV8-cFVIII is roughly 2-fold greater than AAV6 at 1 × 1011  vg/mouse (P < .001; Figure 1C), since AAV8 achieved steady-state FVIII levels of 3138 ± 194 mU/mL (n = 6), in comparison with 1665 ± 99 mU/mL by AAV6 (n = 15). At 3 × 1011  vg/mouse, by week 2 the average FVIII level expressed from AAV8-cFVIII was 7818 ± 957 mU/mL (n = 6) versus 3675 ± 570 mU/mL from AAV6 (n = 15) (P = .008, Figure 1C). Long-term comparison with mice dosed with 3 × 1011  vg/mouse of AAV8-cFVIII was not feasible due to FVIII-neutralizing antibody formation (next section).

Development of canine FVIII-neutralizing antibodies following overexpression of canine FVIII in hemophilia A mice

None of the mice treated with AAV2-cFVIII or AAV5-cFVIII vectors developed any antibodies to canine FVIII; however, mice that received AAV6-cFVIII and AAV8-cFVIII had a high incidence of antibody formation. FVIII-neutralizing antibodies were detected in 32% (7/22), 71% (5/7), and 100% (9/9) of mice dosed with AAV6-cFVIII at 3 × 1011 , 6 × 1011 , and 9 × 1011  vg/mouse, respectively; as well as 67% (4/6) of mice that received 3 × 1011  vg/mouse of AAV8-cFVIII. Antibodies were detected at 2 to 6 weeks after vector injection, except for one mouse that did not develop FVIII antibodies until week 12. The presence of FVIII-neutralizing antibodies prevented measurement of FVIII activity in plasma; however, in cases where FVIII activity was detectable prior to the onset of FVIII-neutralizing antibodies, it always exceeded the normal canine level of 7000 mU/mL (Figure 2A), consistent with the notion that overexpression of canine FVIII instead of vector dose induced canine FVIII antibodies. Nevertheless, the development of FVIII antibodies was not associated with loss of vector DNA, as shown by the lack of correlation between the neutralizing antibodies, as defined by Bethesda assay, and the copy numbers of canine FVIII DNA in liver as measured by Southern blotting analysis (Figure 2B). A Pearson test found no statistically significant correlation between Bethesda units and canine FVIII DNA copy numbers (r2  = 0.012, P = .748). Also, the average canine FVIII DNA copy numbers are comparable in mice irrespective of their antibody status (ie, AAV6: 5.31 ± 0.26 vs 5.45 ± 0.93, and AAV8: 9.38 ± 0.80 vs 7.44 ± 0.35 in mice dosed with 3 × 1011  vg/mouse, with and without canine FVIII-neutralizing antibodies [Figure 2B]). Therefore, the neutralizing antibody development was not associated with T-cell-mediated destruction of transduced hepatocytes, which would result in the elimination of cells containing canine FVIII DNA in the liver.

Differential liver transduction efficiencies by serotype variants of AAV-cFVIII vector in hemophilia A mice

To determine the gene transfer efficiency in liver by different serotypes of AAV-cFVIII vectors, mice were humanely killed upon termination of the study, and genomic DNAs were isolated from liver and analyzed by Southern blotting for canine FVIII DNA. A representative Southern blot is shown in Figure 3A, and the results are summarized in Table 1 and correlate remarkably with their differences in expressed FVIII activity. Specifically, AAV5 at doses of 3 × 1011  and 6 × 1011  vg/mouse, respectively, resulted in 8- to 15-fold less canine FVIII DNA copy numbers/diploid genome (0.08 ± 0.02 and 0.40 ± 0.20) compared with AAV2-transduced livers (1.24 ± 0.25 and 3.01 ± 0.41). In turn, AAV2 dosing led to 3- to 4-fold less FVIII DNA than that detected in AAV6-transduced livers (4.88 ± 0.58 and 9.79 ± 1.73, respectively). The gene transfer efficiency was further increased by about 2-fold in AAV8-transduced livers (1.95 ± 0.26 and 8.73 ± 0.81) relative to AAV6-transduced livers (0.74 ± 0.14 and 4.88 ± 0.58) at doses of 1 × 1011  and 3 × 1011  vg/mouse, respectively. Results from QPCR corroborate those from Southern blotting (Table 1).

Table 1.

Hepatic gene transfer efficiency by different serotypes of AAV-cFVIII vectors in hemophilia A mice





cFVIII DNA copy/diploid genome
AAV serotype
Vector dose, vg/mouse
No. of mice analyzed
Southern blot, mean ± SEM
QPCR, mean ± SEM
5   3 × 1011  4   0.08 ± 0.02   ND  
5   6 × 1011  4   0.40 ± 0.20   ND  
2   3 × 1011  10   1.24 ± 0.25   1.73 ± 1.37  
2   6 × 1011  8   3.01 ± 0.41   3.86 ± 1.36  
6   1 × 1011  3   0.74 ± 0.14   1.11 ± 0.37  
6   3 × 1011  10   4.88 ± 0.58   5.78 ± 2.29  
6   6 × 1011  4   9.79 ± 1.73   14.97 ± 6.57  
8   1 × 1011  6   1.95 ± 0.26   2.21 ± 0.68  
8
 
3 × 1011
 
6
 
8.73 ± 0.81
 
9.68 ± 3.59
 




cFVIII DNA copy/diploid genome
AAV serotype
Vector dose, vg/mouse
No. of mice analyzed
Southern blot, mean ± SEM
QPCR, mean ± SEM
5   3 × 1011  4   0.08 ± 0.02   ND  
5   6 × 1011  4   0.40 ± 0.20   ND  
2   3 × 1011  10   1.24 ± 0.25   1.73 ± 1.37  
2   6 × 1011  8   3.01 ± 0.41   3.86 ± 1.36  
6   1 × 1011  3   0.74 ± 0.14   1.11 ± 0.37  
6   3 × 1011  10   4.88 ± 0.58   5.78 ± 2.29  
6   6 × 1011  4   9.79 ± 1.73   14.97 ± 6.57  
8   1 × 1011  6   1.95 ± 0.26   2.21 ± 0.68  
8
 
3 × 1011
 
6
 
8.73 ± 0.81
 
9.68 ± 3.59
 

ND indicates not determined.

Figure 2.

Formation of canine FVIII-neutralizing antibodies in hemophilia A mice. (A) Correlation between the overexpression of canine FVIII and subsequent presence of FVIII-neutralizing antibodies in mice in which FVIII activities were detectable before the onset of FVIII-neutralizing antibodies. The FVIII activities at weeks 2 and 6 after vector injection were determined by Coatest. The FVIII-neutralizing antibodies at weeks 2 and 6 were determined by Bethesda assay. (B) Lack of correlation between the levels of FVIII-neutralizing antibodies and transgene DNA in liver in individual mice. The copy numbers of canine FVIII DNA per diploid genome in mouse liver were quantified by Southern blotting analysis.

Figure 2.

Formation of canine FVIII-neutralizing antibodies in hemophilia A mice. (A) Correlation between the overexpression of canine FVIII and subsequent presence of FVIII-neutralizing antibodies in mice in which FVIII activities were detectable before the onset of FVIII-neutralizing antibodies. The FVIII activities at weeks 2 and 6 after vector injection were determined by Coatest. The FVIII-neutralizing antibodies at weeks 2 and 6 were determined by Bethesda assay. (B) Lack of correlation between the levels of FVIII-neutralizing antibodies and transgene DNA in liver in individual mice. The copy numbers of canine FVIII DNA per diploid genome in mouse liver were quantified by Southern blotting analysis.

To further assess the percentage of liver transduced by AAV-cFVIII, liver sections from mice dosed with 3 × 1011  vg of either AAV6 or AAV2 vectors were analyzed by FISH for canine FVIII mRNA. As shown in Figure 3B, in contrast to the negative staining of either naive hemophilia A liver or AAV6-cFVIII-transduced liver hybridized with probes comprising sense sequences of canine FVIII, the antisense probe positively stained for canine FVIII mRNA in AAV6-cFVIII-treated mouse liver. On average, 26% ± 3% of liver cells were positive for canine FVIII mRNA in the mice (n = 4) treated with 3 × 1011  vg AAV6, which is slightly higher than the 18% ± 4% in mice (n = 5) treated with the same dose of AAV2 (data not shown). However, this difference was not statistically significant (P = .207).

In addition, the biodistribution of the vector DNA was found predominantly in liver with a mean of 5.778 ± 1.981 copy/diploid genome at 3 × 1011  vg/mouse of AAV6-cFVIII (Table 2), followed by 0.024 ± 0.005 copy/genome disseminated in spleen, 0.004 ± 0.002 in kidney, 0.002 ± 0.001 in both lung and heart, and 0.001 in gonad. The detection limit of QPCR is 0.0003 copy/diploid genome.

Table 2.

Biodistribution of AAV6-cFVIII vector DNA in hemophilia A mice


Tissue

Naive

M1*

M2*

M3*

M4*

Mean ± SD
Gonad   0.0000   0.0012   0.0007   0.0017   0.0017   0.001 ± 0.000  
Liver   0.0000   4.7044   11.3035   5.2088   1.8963   5.778 ± 1.981  
Lung   0.0000   0.0004   0.0018   0.0001   0.0060   0.002 ± 0.001  
Heart   0.0001   0.0013   0.0042   0.0004   0.0015   0.002 ± 0.001  
Kidney   0.0000   0.0075   0.0064   0.0008   0.0010   0.004 ± 0.002  
Spleen
 
0.0002
 
0.0227
 
0.0374
 
0.0217
 
0.0155
 
0.024 ± 0.005
 

Tissue

Naive

M1*

M2*

M3*

M4*

Mean ± SD
Gonad   0.0000   0.0012   0.0007   0.0017   0.0017   0.001 ± 0.000  
Liver   0.0000   4.7044   11.3035   5.2088   1.8963   5.778 ± 1.981  
Lung   0.0000   0.0004   0.0018   0.0001   0.0060   0.002 ± 0.001  
Heart   0.0001   0.0013   0.0042   0.0004   0.0015   0.002 ± 0.001  
Kidney   0.0000   0.0075   0.0064   0.0008   0.0010   0.004 ± 0.002  
Spleen
 
0.0002
 
0.0227
 
0.0374
 
0.0217
 
0.0155
 
0.024 ± 0.005
 

The copy numbers of canine FVIII DNA per diploid genome as determined by QPCR. The limit of detection is 0.0003 copy/diploid genome.

*

Individual mice dosed with 3 × 1011 vg AAV6-cFVIII.

Figure 3.

Liver transduction efficiency by AAV6-cFVIII and AAV2-cFVIII in hemophilia A mice. (A) Southern blotting analysis. Genomic DNAs from AAV-treated mouse livers yield 2 positive bands from BamHI and BglII digestion, representing the canine FVIII light-chain (LC) and heavy-chain (HC), respectively. The standards are generated with digested plasmid DNAs spiked in liver genomic DNAs from naive hemophilia A mice. (B) RNA FISH for canine FVIII transcripts in liver sections of a mouse treated with 3 × 1011  vg of AAV6-cFVIII (i-iii). (i) Section hybridized with a cocktail of canine FVIII antisense probes; (ii) same section counterstained with DAPI for nuclei; (iii) section hybridized with canine FVIII sense probes; and (iv) a naive mouse liver hybridized with canine FVIII antisense probes. Pictures were taken at 20 × magnification.

Figure 3.

Liver transduction efficiency by AAV6-cFVIII and AAV2-cFVIII in hemophilia A mice. (A) Southern blotting analysis. Genomic DNAs from AAV-treated mouse livers yield 2 positive bands from BamHI and BglII digestion, representing the canine FVIII light-chain (LC) and heavy-chain (HC), respectively. The standards are generated with digested plasmid DNAs spiked in liver genomic DNAs from naive hemophilia A mice. (B) RNA FISH for canine FVIII transcripts in liver sections of a mouse treated with 3 × 1011  vg of AAV6-cFVIII (i-iii). (i) Section hybridized with a cocktail of canine FVIII antisense probes; (ii) same section counterstained with DAPI for nuclei; (iii) section hybridized with canine FVIII sense probes; and (iv) a naive mouse liver hybridized with canine FVIII antisense probes. Pictures were taken at 20 × magnification.

Long-term therapeutic benefit of AAV-cFVIII delivered to hemophilia A dogs

Next, we determined the long-term efficacy and safety of the AAV-cFVIII vector in hemophilia A dogs in the colony at Queen's University (Kingston, ON). In the Queen's University hemophilia A dogs, the FVIII transcript is aberrantly spliced, resulting in a polyadenylated transcript lacking exons distal to 22 and terminating with a novel sequence element. This mutation is similar to the intron 22 inversion found in approximately 45% of severe hemophilia A patients.42  Phenotypically, these hemophilia A dogs are cross-reacting material negative (CRM-), have a circulating FVIII activity less than 1%, and have a propensity for spontaneous musculoskeletal bleeding requiring on average 5 infusions of cryoprecipitate per year.43 

Eight hemophilia A dogs were treated with AAV-cFVIII vector via portal-vein injection (Table 3). Four dogs (Elisa, Angus, Vector, and Junior) received escalating doses of AAV2 from 6 × 1012  to 2.3 × 1013  vg/kg, 3 dogs (Alexis, Maurizio, and Morag) received either 1 × 1013  or 1.7 × 1013  vg/kg AAV6, and 1 dog (Floopers) was injected with 1 × 1013  vg/kg AAV8.

Table 3.

Hemophilia A dogs treated with AAV-cFVIII vectors via portal-vein injection


Animal name

AAV serotype

Sex

Age

Weight, kg

Dose, vg/kg

Duration of study, wk

Peak FVIII level, mU/mL,*(% of normal)

Steady-state FVIII level mU/mL,*% of normal (mean ± SEM)

WBCT after treatment, min,mean ± SEM

FVIII DNA copy/diploid genome in live biopsy,mean ± SEM
Elisa§  2   F   7 m   10   6 × 1012  171   269 (3.84)   174 ± 6 (2.49 ± 0.09)   5.22 ± 1.02   0.14 ± 0.13  
Angus   2   M   1 y   10.4   1.5 × 1013  62   64 (0.91)   38 ± 5 (0.54 ± 0.07)   6.37 ± 1.02   ND  
Vector   2   M   8 m   15.2   1.5 × 1013  96   256 (3.66)   149 ± 11 (2.13 ± 0.16)   5.85 ± 1.44   1.52 ± 0.28  
Junior§  2   M   1 y   12.8   2.7 × 1013  139   351 (5.02)   225 ± 9 (3.21 ± 0.13)   4.96 ± 0.85   0.802  
Alexis   6   F   1 y 8 m   9.4   1.0 × 1013  73   598 (8.54)   331 ± 27 (4.73 ± 0.39)   4.21 ± 0.77   0.69 ± 0.06  
Morag   6   F   6 m   10.5   1.7 × 1013  46   < 23 (< 0.33)   < 23 (< 0.33)   6.29 ± 1.57   0.05 ± 0.01  
Maurizio   6   M   1 y 2 m   11.9   1.0 × 1013  44   227 (3.24)   175 ± 9 (2.50 ± 0.13)   4.57 ± 0.53   0.85 ± 0.28  
Floopers
 
8
 
F
 
1 y
 
11.2
 
1.0 × 1013
 
61
 
312 (4.46)
 
177 ± 16 (2.53 ± 0.23)
 
4.69 ± 1.16
 
0.80 ± 0.10
 

Animal name

AAV serotype

Sex

Age

Weight, kg

Dose, vg/kg

Duration of study, wk

Peak FVIII level, mU/mL,*(% of normal)

Steady-state FVIII level mU/mL,*% of normal (mean ± SEM)

WBCT after treatment, min,mean ± SEM

FVIII DNA copy/diploid genome in live biopsy,mean ± SEM
Elisa§  2   F   7 m   10   6 × 1012  171   269 (3.84)   174 ± 6 (2.49 ± 0.09)   5.22 ± 1.02   0.14 ± 0.13  
Angus   2   M   1 y   10.4   1.5 × 1013  62   64 (0.91)   38 ± 5 (0.54 ± 0.07)   6.37 ± 1.02   ND  
Vector   2   M   8 m   15.2   1.5 × 1013  96   256 (3.66)   149 ± 11 (2.13 ± 0.16)   5.85 ± 1.44   1.52 ± 0.28  
Junior§  2   M   1 y   12.8   2.7 × 1013  139   351 (5.02)   225 ± 9 (3.21 ± 0.13)   4.96 ± 0.85   0.802  
Alexis   6   F   1 y 8 m   9.4   1.0 × 1013  73   598 (8.54)   331 ± 27 (4.73 ± 0.39)   4.21 ± 0.77   0.69 ± 0.06  
Morag   6   F   6 m   10.5   1.7 × 1013  46   < 23 (< 0.33)   < 23 (< 0.33)   6.29 ± 1.57   0.05 ± 0.01  
Maurizio   6   M   1 y 2 m   11.9   1.0 × 1013  44   227 (3.24)   175 ± 9 (2.50 ± 0.13)   4.57 ± 0.53   0.85 ± 0.28  
Floopers
 
8
 
F
 
1 y
 
11.2
 
1.0 × 1013
 
61
 
312 (4.46)
 
177 ± 16 (2.53 ± 0.23)
 
4.69 ± 1.16
 
0.80 ± 0.10
 

ND indicates not determined.

*

FVIII activities in canine plasma were determined by Coatest and converted to percentage of normal canine FVIII activity of 7000 mU/mL. Pretreatment hemophilia A dogs had FVIII activity less than 1%.

Average WBCT from all time points measured after treatment with duplicate measurements at each time point. Pretreatment WBCT was 14 to 17 minutes.

Copy numbers of canine B-domain-deleted FVIII DNA in canine liver were determined by Southern blotting analysis.

§

Some data up to week 56 for Elisa and week 36 for Junior have been reported previously.2 

Except for Angus and Morag, all other dogs have expressed sustained therapeutic levels (> 1%) of FVIII activity as measured by Coatest assay for 44 to 171 weeks (the last time points assessed) (Figure 4A; Table 3). The highest peak level achieved was 598 mU/mL (8.5% canine FVIII level), in Alexis dosed with 1 × 1013  vg/kg AAV6, followed by 351 mU/mL (5.0%, Junior, 2.7 × 1013  vg/kg AAV2) and 312 mU/mL (4.5%, Floopers, 1 × 1013  vg/kg AAV8). Elisa, Vector, and Maurizio received 6 × 1012  vg/kg AAV2, 1.5 × 1013  vg AAV2, and 1 × 1013  vg/kg AAV6, peaked at comparable levels of 269 mU/mL (3.8%), 256 mU/mL (3.7%), and 227mU/mL (3.2%), respectively. The steady-state FVIIII levels are roughly 60% of the peak levels except for Maurizio, who stabilized at about 80% of his maximal FVIII expression. Therefore, AAV-cFVIII-treated hemophilia A dogs have persistently expressed 2% to 5% of normal canine FVIII activity by Coatest, values that are consistent with results obtained by the 1-stage aPTT-based FVIII assay (data not shown). The therapeutic benefits were also shown by improved whole-blood clotting time (WBCT), from an average of 15.98 ± 0.79 minutes before treatment to the normal ranges of 2 to 6 minutes after treatment (Figure 4B; Table 3). Specifically, the average WBCTs from all time points measured after treatment for all 6 dogs are 5.22 ± 1.02 (Elisa), 5.85 ± 1.44 (Vector), 4.96 ± 0.85 (Junior), 4.21 ± 0.77 (Alexis), 4.57 ± 0.53 (Maurizio), and 4.69 ± 1.16 (Floopers).

To assess the gene transfer efficiency in liver, biopsies were obtained by open surgery either at the end of the study or at week 20 (Morag and Floopers), and the canine BDD-FVIII transgene DNAs were quantified by Southern blotting (Figure 5). From each dog, multiple biopsies were collected from different sites in the liver and were found to contain comparable amounts of canine BDD-FVIII DNA, with less than 2-fold variation. The exception was Elisa, in which canine BDD-FVIII DNA was undetectable in the left lateral lobe. On average, 1 × 1013  vg/kg AAV8 or AAV6 resulted in similar copy numbers of canine BDD-FVIII DNA per diploid genome of liver in Floopers (0.8 ± 0.1), Alexis (0.69 ± 0.06), and Maurizio (0.85 ± 0.28). Elisa, Vector, and Junior who were treated with AAV2 at 6 × 1012 , 1.5 × 1013 , and 2.7 × 1013  vg/kg contained 0.14 ± 0.13, 1.52 ± 0.28, and 0.8 copies of canine BDD-FVIII DNA per cell, respectively (Table 3).

Angus and Morag were treated with 1.5 × 1013  vg/kg AAV2 and 1 × 1013  vg/kg AAV6, respectively, and expressed only subtherapeutic levels of FVIII (Table 3). FVIII activity in Angus peaked at 64 mU/mL (0.91%) and remained at 38 ± 14 mU/mL, whereas in Morag the FVIII was below the detection limit of Coatest (23 mU/mL). The low copy number (0.05 ± 0.01) of canine BDD-FVIII DNA/cell detected in Morag's liver indicates that the low levels of FVIII expression resulted, at least in part, from poor gene transfer efficiency (Figure 5; Table 3). No neutralizing antibodies to canine FVIII have been detected in either Angus or Morag (data not shown). However, despite their undetectable levels of circulating FVIII activities, Angus and Morag have shown clinical improvement. First, in comparison with their prior history of 6 bleeding episodes the year before the treatment, they have not experienced any spontaneous bleeding since the AAV treatment. Second, the WBCTs of Angus and Morag were decreased from 15.87 and 16.28 minutes before treatment to 6.37 ± 1.02 and 6.29 ± 1.57 minutes after treatment, respectively (Figure 6A). Third, clot formation was improved, as assessed in the TEG assay, which permits a more sensitive global assessment of homeostasis in the plasma. Whereas the pre-AAV plasma samples from these 2 hemophilia A dogs did not form detectable fibrin after more than 70 minutes, the TEG tracings for Angus and Morag showed “R” values of 23.8 and 31.3 minutes, clotting angles of 6.4 and 1.9 degrees, and maximal amplitudes of 6.3 and 2.4 mm, respectively, after AAV treatment (Figure 6B).

Figure 4.

Long-term therapeutic efficacy of AAV-cFVIII in hemophilia A dogs. Elisa, Vector, and Junior received 6 × 1012 , 1.5 × 1013 , and 2.7 × 1013 vg/kg AAV2 vector, respectively; Alexis and Maurizio, 1.0 × 1013 vg/kg AAV6 vector; and Floopers, 1.0 × 1013 vg/kg AAV8 vector. (A) Plasma FVIII activities as measured by Coatest and converted to percentage of normal canine FVIII activity of 7000 mU/mL. (B) Whole-blood clotting time (WBCT) measured before and after vector infusion. The normal range of canine WBCT is 2 to 6 minutes.

Figure 4.

Long-term therapeutic efficacy of AAV-cFVIII in hemophilia A dogs. Elisa, Vector, and Junior received 6 × 1012 , 1.5 × 1013 , and 2.7 × 1013 vg/kg AAV2 vector, respectively; Alexis and Maurizio, 1.0 × 1013 vg/kg AAV6 vector; and Floopers, 1.0 × 1013 vg/kg AAV8 vector. (A) Plasma FVIII activities as measured by Coatest and converted to percentage of normal canine FVIII activity of 7000 mU/mL. (B) Whole-blood clotting time (WBCT) measured before and after vector infusion. The normal range of canine WBCT is 2 to 6 minutes.

AAV-cFVIII vectors of serotypes 2, 6, and 8 induced no toxicity in hemophilia A dogs. Complete panels of serum chemistry and hematologic parameters have shown mostly normal values throughout the study, except for a slight increase (< 2-fold above the baseline) of alkaline phosphatase within the first week after surgery, and a self-resolving mild increase in creatine kinase in some cases, likely relating to intraoperative muscle damage (data not shown). H&E staining of liver biopsies has also shown healthy hepatic architecture; no inflammation, necrosis, or fibrosis; and no tumors (data not shown).

Figure 5.

Comparable hepatic gene transfer efficiency by AAV2-cFVIII, AAV6-cFVIII, and AAV8-cFVIII in hemophilia A dogs. Southern blotting analysis for canine B-domain-deleted (BDD) FVIII transgene DNA in liver biopsies taken from multiple lobes in Morag and Floopers at 20 weeks, Vector at 102 weeks, Elisa at 177 weeks, Alexis at 77 weeks, and Maurizio at 49 weeks after vector injection. AAV-treated canine liver genomic DNAs yield 2 positive bands from BamHI digestion, representing the endogenous FVIII and transgene BDD-FVIII. The standards are generated with BamHI-digested plasmid DNAs spiked in liver genomic DNAs from naive hemophilia A dogs. RL indicates right lateral lobe; LL, left lateral lobe; RM, right medial lobe; LM, left medial lobe; Q, quadrate lobe; and C, caudate lobe.

Figure 5.

Comparable hepatic gene transfer efficiency by AAV2-cFVIII, AAV6-cFVIII, and AAV8-cFVIII in hemophilia A dogs. Southern blotting analysis for canine B-domain-deleted (BDD) FVIII transgene DNA in liver biopsies taken from multiple lobes in Morag and Floopers at 20 weeks, Vector at 102 weeks, Elisa at 177 weeks, Alexis at 77 weeks, and Maurizio at 49 weeks after vector injection. AAV-treated canine liver genomic DNAs yield 2 positive bands from BamHI digestion, representing the endogenous FVIII and transgene BDD-FVIII. The standards are generated with BamHI-digested plasmid DNAs spiked in liver genomic DNAs from naive hemophilia A dogs. RL indicates right lateral lobe; LL, left lateral lobe; RM, right medial lobe; LM, left medial lobe; Q, quadrate lobe; and C, caudate lobe.

Figure 6.

Global homeostasis improvements in Angus and Morag expressing subtherapeutic circulating FVIII activity. (A) WBCT of Angus and Morag before and after treatment with 1.5 × 1013 vg/kg AAV2-cFVIII and 1.75 × 1013 vg/kg AAV6-cFVIII, respectively. (B) Thrombelastography (TEG) measuring the clot formation time and the size of fibrin in citrated plasmas collected from Angus and Morag at 62 and 46 weeks after vector infusion, respectively. The negative control (HemA) tracing is from Angus before AAV therapy.

Figure 6.

Global homeostasis improvements in Angus and Morag expressing subtherapeutic circulating FVIII activity. (A) WBCT of Angus and Morag before and after treatment with 1.5 × 1013 vg/kg AAV2-cFVIII and 1.75 × 1013 vg/kg AAV6-cFVIII, respectively. (B) Thrombelastography (TEG) measuring the clot formation time and the size of fibrin in citrated plasmas collected from Angus and Morag at 62 and 46 weeks after vector infusion, respectively. The negative control (HemA) tracing is from Angus before AAV therapy.

Discussion

Comparison of transduction efficiencies by different serotypes of AAV-cFVIII in murine liver

In this study, we have compared the efficiency of gene transfer, protein synthesis, and secretion when FVIII was delivered by AAV5, AAV2, AAV6, and AAV8 via portal-vein injection in hemophilia A mice. At doses of 1 × 1011  to 6 × 1011  vg/mouse, the transduction efficiency increased in the following order: AAV5 < < AAV2 < AAV6 < AAV8. Whereas there was an 8- to 14-fold improvement from AAV5 to AAV2 as determined by plasma FVIII activities, the differential changes observed with AAV2, AAV6, and AAV8 are moderate at about 2- to 3-fold stepwise, yet statistically significant as determined by the 2-tailed, unpaired t test. However, we may have underestimated the efficacy mediated by AAV6 and AAV8 vectors at doses of 3 × 1011  vg/mouse or higher since mice that developed FVIII-neutralizing antibodies were excluded from the analysis. Therefore, it is important to note that the serotype differences were corroborated by both Southern blotting and QPCR analyses, which measured the copy numbers of canine FVIII DNAs in mouse livers. Both assays are independent of the development of canine FVIII-neutralizing antibodies.

Earlier studies of various serotypes of AAV vectors used for liver targeting are controversial with regard to the differences in the transduction efficiency among AAV1, 2, 5, 6, and 8.20,27,44,45  AAV1 is 97% homologous in its capsid amino acid sequences to AAV6 studied here, and both serotypes have generally been found to be concordant in tissue tropism. The interstudy comparisons are complicated because of the choices of different transgenes; the choices of different expression cassettes, including upstream regulatory sequences if the transgene is the same; and the potency of vectors produced in different labs with different production and assay methods. In addition, the disagreement on the magnitude of differences between AAV2 and other serotypes may partly result from differences in purification methods (ie, AAV2 vectors purified by heparin-based column chromatography contain excess empty viral particles, whereas most serotypes purified by CsCl-gradient centrifugation are free from empty particles). Empty particles inhibit transduction efficiency of full particles, leading to a lower overall response.46  However, on the other hand, since it has been reported that CsCl may damage AAV particles under certain conditions,47  and since we do not have column-purified AAV6 and AAV8 vectors to compare, we cannot rule out the possibility that CsCl is more detrimental to AAV6 and AAV8 than AAV2 particles, resulting in lower infectivity and thus lower efficacy than reported by other groups.30,48 

Nevertheless, results from this study are comparable with those by Grimm et al36  and Sarkar et al.28  In the first study,36  AAV-FIX vectors of serotypes 1 to 6 were all purified by CsCl-gradient centrifugation by the same group that produced the AAV-cFVIII vectors studied in the present report. The authors showed that portal-vein injection of AAV-FIX resulted in 12- and 2-fold increases from AAV5 to AAV2 and from AAV2 to AAV6, respectively, as determined by circulating human FIX levels and QPCR of FIX transgene DNA (Table 1 36 ). In the second study,28  at doses of either 1 × 1011  or 3 × 1010  gc/mouse, AAV8 B-domain-deleted FVIII vector resulted in a roughly 2-fold higher FVIII activity over AAV2 as measured at 6 months and 15 months following portalvein injection in hemophilia A mice.

Development of FVIII-neutralizing antibodies in hemophilia A mice

FVIII is more immunogenic than other coagulation factors such as FIX, since approximately 25% of hemophilia A and 3% of hemophilia B patients who have received protein replacement therapy develop inhibitors to FVIII or FIX, respectively, after repeated exposures. We also detected a high incidence of FVIII-neutralizing antibodies in hemophilia A mice treated with AAV-cFVIII, which is not fully attributable to the production of xenogeneic FVIII, because a previous study has shown this propensity to be independent of the species of origin of the transgene FVIII49 ; and overexpression of canine FIX did not result in inhibitor formation in C57Bl/6 mice (same strain as our hemophilia A mice). On the other hand, our results strongly suggest that the formation of FVIII-neutralizing antibodies is a consequence of the expression of supraphysiologic levels of FVIII. Consistent with this notion, a minimal adenoviral vector expressing supraphysiologic levels of human FVIII also induced FVIII inhibitors as early as 2 weeks after intravenous injection in hemophilia A mice.50  In addition, an E1/E2a/E3-deficient adenoviral vector encoding canine FVIII induced FVIII inhibitors in hemophilia A dogs, and the titers of the FVIII inhibitors were proportional to the prior expression levels of canine FVIII.51  Furthermore, it was shown that in hemophilia A mice, whereas repeated administration of human FVIII to achieve sustained normal human levels (50 U/kg, equivalent to 10 μg/kg) induced anti-FVIII antibodies in most animals, a single injection of a 5- to 50-fold higher dose of human FVIII elicited a strong anti-FVIII IgG response within 14 days.52  However, it is important to note that in the present study, the development of FVIII-neutralizing antibodies does not lead to T-cell-mediated elimination of transduced hepatocytes, as evidenced by the persistence of transgene DNA in the livers of AAV-cFVIII-treated hemophilia A mice, which is in contrast to the marked innate immune response and associated inflammation/necrosis observed with adenoviral vectors.

On the other hand, since AAV-transduced FVIII-producing hepatocytes remain in the face of FVIII inhibitors, it is also possible that sustained FVIII expression may eventually lead to immune tolerance to FVIII. Indeed, one of the AAV2-cFVIII-treated hemophilia A dogs (Junior) developed FVIII inhibitors only transiently, peaking at 9 BU at 4 weeks after vector infusion and resolving by 9 weeks.2  In addition, Chao and Walsh53  also observed that human FVIII antigen levels were partially restored, coinciding with the disappearance of the anti-hFVIII inhibitors, 10 months after vector injection in 3 C57BL/6 mice. However, in the present study, mice that developed FVIII inhibitors had no detectable FVIII activities up to 34 weeks after vector infusion. The different outcome between the 2 mouse studies could be attributed to (1) an insufficient duration of follow-up, (2) the difference between hemophilia A versus normal mice, or (3) the difference in the FVIII exposure, supraphysiologic versus low levels (as in normal mice and Junior).

Long-lived therapeutic activity in the absence of toxicity by AAV-cFVIII in hemophilia A dogs

The most significant finding of this study is the demonstration of the long-term efficacy and safety of multiple AAV-cFVIII serotypes in hemophilia A dogs, greatly extending our initial pilot study that had short-term results using AAV2. Long-term efficacy lasting approximately 4 years suggests the potential for a cure in humans. Preclinical and clinical studies on AAV-FIX have also shown multiyear stable FIX expression in a hemophilia B canine model and predicted the therapeutic dose likely to be effective in humans (H.J., L.B.C., S.P.-W., T.L., D.N., J.A.V., S.Z., C.D.S., Jurg Sommer, Sharmila Vijay, Darren Warren, Federico Mingozzi, Katherine A. High, G.F.P.; “Effects of transient immunosuppression on adeno-associated, virus-mediated, liver-directed gene transfer in rhesus macaques and implications for human gene therapy; submitted April 18, 2006).32,54-59 

Of 8 hemophilia A dogs treated with AAV2-cFVIII, AAV6-cFVIII, and AAV8-cFVIII vectors at doses from 6 × 1012  to 2.7 × 1013  vg/kg, 6 dogs had sustained circulating FVIII activities at 2% to 5% for 1 to 4 years, with no evidence of a diminution in FVIII production. In addition to improved Coatest and aPTT values, WBCT decreased from 14 to 17 minutes before treatment to normal at 4 to 6 minutes after treatment, and the spontaneous bleeding episodes were decreased from an average of 5 times per year before treatment to 0 after treatment. The remaining 2 dogs, Angus and Morag, who received 1.5 × 1013  and 1.7 × 1013  vg/kg AAV2 and AAV6, respectively, failed to express FVIII activity more than 1% of normal. Angus and Morag have no pre-existing neutralizing titers against AAV2 and AAV6, respectively (data not shown). In addition, the low levels of FVIII activity in these dogs are not due to the development of FVIII-neutralizing antibodies, but correlate with poor gene transfer within the liver. However, despite subtherapeutic FVIII activity levels (< 1%), evidence of improved homeostasis was detected. In addition to improved WBCT (6 minutes), both dogs no longer bled spontaneously. Furthermore, both dogs also clearly showed improved global homeostasis after AAV therapy in the TEG assay. The TEG assay has a greater sensitivity than traditional clotting assays and allows the analysis of clot (fibrin) formation in real time, demonstrating that the rate of fibrin formation correlates to FVIII levels from 0.001% to 100%.60,61  In these studies, all 8 dogs have maintained clinical chemistry and hematologic parameters within normal limits. No abnormal histopathologic findings were found in liver biopsies.

As observed with AAV-FIX studies, the levels of FVIII expression achieved in mice did not scale up to dogs. Whereas 1 × 1013  vg/kg (3 × 1011  vg/mouse) of AAV2-cFVIII, AAV6-cFVIII, and AAV8-cFVIII achieved roughly 20%, 50%, and 110% of normal canine FVIII activity, respectively, in hemophilia A mice, the same dose of all 3 vectors resulted in only 2% to 5% of normal FVIII levels in hemophilia A dogs. Thus, the underestimate of efficacious doses seen in the transition from mice to dogs and nonhuman primates further supports the canine model as a predictor of effective doses in humans. Firm conclusions regarding differences in efficacy between AAV serotypes are not possible due to the small sample sizes; however, taken together, differences among AAV2, AAV6, and AAV8 do not appear to be substantial. This is notably different in comparison with AAV1, which consistently performs better than AAV2 in muscle in both mouse and dog models.62  It is possible that AAV1 has a tropism for skeletal myocytes irrespective of species, whereas the liver specificity of AAV6 and AAV8 does not cross species from murine to canine. Species-dependent tropism has been previously reported, for example, although AAV1 vector transduced murine pancreatic islets better than AAV2, the order was reversed in transduction of human islets.63  However, it is also possible that unlike easily accessible skeletal muscles, only a limited number of hepatocytes are accessible to AAV vectors due to inefficient delivery via either portal vein or hepatic artery; this may also explain the lack of vector dose response seen in hemophilia A dogs.

Future research should focus on improving the strength of the transgene promoter, which is minimal due to the large size of the B-domain-deleted FVIII gene, and on improving the efficiency of hepatic delivery, to achieve enhanced therapeutic benefit while minimizing the risk of potential toxicity or a cytotoxic T-cell immune response to vector capsid. Alternative serotypes such as AAV6 and AAV8 may partially circumvent the inhibition of transduction by low-level anti-AAV2 antibodies prevalent in humans.64 

Prepublished online as Blood First Edition Paper, March 7, 2006; DOI 10.1182/blood-2005-12-5115.

Supported, in part, by Bayer Health Care, and an operating grant from the Canadian Institutes of Health Research (MOP-10912). D.L. is the recipient of a Canada Research Chair in Molecular Homeostasis.

An Inside Blood analysis of this article appears at the front of this issue.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

We thank Gibrail Haniff for his excellent techniques in mouse surgery.

G.F.P. is currently at Bayer HealthCare LLC, Berkeley, CA 94710; e-mail: glenn.pierce.b@bayer.com. L.B.C. is currently at Benitec, Mountain View, CA 94043; e-mail: lcouto@benitec.com.

1
Mannucci PM, Tuddenham EG. The hemophilias: from royal genes to gene therapy.
N Engl J Med
.
2001
;
344
:
1773
-1779.
2
Scallan CD, Lillicrap D, Jiang H, et al. Sustained phenotypic correction of canine hemophilia A using an adeno-associated viral vector.
Blood
.
2003
;
102
:
2031
-2037.
3
Gao G, Vandenberghe LH, Wilson JM. New recombinant serotypes of AAV vectors.
Curr Gene Ther
.
2005
;
5
:
285
-297.
4
Louboutin JP, Wang L, Wilson JM. Gene transfer into skeletal muscle using novel AAV serotypes.
J Gene Med
.
2005
;
7
:
442
-451.
5
Loiler SA, Conlon TJ, Song S, et al. Targeting recombinant adeno-associated virus vectors to enhance gene transfer to pancreatic islets and liver.
Gene Ther
.
2003
;
10
:
1551
-1558.
6
Du L, Kido M, Lee DV, et al. Differential myocardial gene delivery by recombinant serotype-specific adeno-associated viral vectors.
Mol Ther
.
2004
;
10
:
604
-608.
7
Chen S, Kapturczak M, Loiler SA, et al. Efficient transduction of vascular endothelial cells with recombinant adeno-associated virus serotype 1 and 5 vectors.
Hum Gene Ther
.
2005
;
16
:
235
-247.
8
Burger C, Gorbatyuk OS, Velardo MJ, et al. Recombinant AAV viral vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central nervous system.
Mol Ther
.
2004
;
10
:
302
-317.
9
Passini MA, Watson DJ, Vite CH, Landsburg DJ, Feigenbaum AL, Wolfe JH. Intraventricular brain injection of adeno-associated virus type 1 (AAV1) in neonatal mice results in complementary patterns of neuronal transduction to AAV2 and total long-term correction of storage lesions in the brains of beta-glucuronidase-deficient mice.
J Virol
.
2003
;
77
:
7034
-7040.
10
Ghosh A, Allamarvdasht M, Pan CJ, et al. Long-term correction of murine glycogen storage disease type Ia by recombinant adeno-associated virus-1-mediated gene transfer.
Gene Ther
.
2006
;
13
:
321
-329.
11
Liu Y, Okada T, Sheykholeslami K, et al. Specific and efficient transduction of Cochlear inner hair cells with recombinant adeno-associated virus type 3 vector.
Mol Ther
.
2005
;
12
:
725
-733.
12
Liu G, Martins I, Wemmie JA, Chiorini JA, Davidson BL. Functional correction of CNS phenotypes in a lysosomal storage disease model using adeno-associated virus type 4 vectors.
J Neurosci
.
2005
;
25
:
9321
-9327.
13
Cressant A, Desmaris N, Verot L, et al. Improved behavior and neuropathology in the mouse model of Sanfilippo type IIIB disease after adeno-associated virus-mediated gene transfer in the striatum.
J Neurosci
.
2004
;
24
:
10229
-10239.
14
Auricchio A, O'Connor E, Weiner D, et al. Noninvasive gene transfer to the lung for systemic delivery of therapeutic proteins.
J Clin Invest
.
2002
;
110
:
499
-504.
15
De B, Heguy A, Leopold PL, et al. Intrapleural administration of a serotype 5 adeno-associated virus coding for alpha1-antitrypsin mediates persistent, high lung and serum levels of alpha1-antitrypsin.
Mol Ther
.
2004
;
10
:
1003
-1010.
16
Sandalon Z, Bruckheimer EM, Lustig KH, Rogers LC, Peluso RW, Burstein H. Secretion of a TN-FR:Fc fusion protein following pulmonary administration of pseudotyped adeno-associated virus vectors.
J Virol
.
2004
;
78
:
12355
-12365.
17
Lotery AJ, Yang GS, Mullins RF, et al. Adeno-associated virus type 5: transduction efficiency and cell-type specificity in the primate retina.
Hum Gene Ther
.
2003
;
14
:
1663
-1671.
18
Reich SJ, Auricchio A, Hildinger M, et al. Efficient trans-splicing in the retina expands the utility of adeno-associated virus as a vector for gene therapy.
Hum Gene Ther
.
2003
;
14
:
37
-44.
19
Apparailly F, Khoury M, Vervoordeldonk MJ, et al. Adeno-associated virus pseudotype 5 vector improves gene transfer in arthritic joints.
Hum Gene Ther
.
2005
;
16
:
426
-434.
20
Mingozzi F, Schuttrumpf J, Arruda VR, et al. Improved hepatic gene transfer by using an adeno-associated virus serotype 5 vector.
J Virol
.
2002
;
76
:
10497
-10502.
21
Blankinship MJ, Gregorevic P, Allen JM, et al. Efficient transduction of skeletal muscle using vectors based on adeno-associated virus serotype 6.
Mol Ther
.
2004
;
10
:
671
-678.
22
Sun B, Zhang H, Franco LM, et al. Correction of glycogen storage disease type II by an adeno-associated virus vector containing a muscle-specific promoter.
Mol Ther
.
2005
;
11
:
889
-898.
23
Kawamoto S, Shi Q, Nitta Y, Miyazaki J, Allen MD. Widespread and early myocardial gene expression by adeno-associated virus vector type 6 with a beta-actin hybrid promoter.
Mol Ther
.
2005
;
11
:
980
-985.
24
Halbert CL, Allen JM, Miller AD. Adeno-associated virus type 6 (AAV6) vectors mediate efficient transduction of airway epithelial cells in mouse lungs compared to that of AAV2 vectors.
J Virol
.
2001
;
75
:
6615
-6624.
25
Wang Z, Zhu T, Qiao C, et al. Adeno-associated virus serotype 8 efficiently delivers genes to muscle and heart.
Nat Biotechnol
.
2005
;
23
:
321
-328.
26
Wang AY, Peng PD, Ehrhardt A, Storm TA, Kay MA. Comparison of adenoviral and adeno-associated viral vectors for pancreatic gene delivery in vivo.
Hum Gene Ther
.
2004
;
15
:
405
-413.
27
Gao GP, Alvira MR, Wang L, Calcedo R, Johnston J, Wilson JM. Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy.
Proc Natl Acad Sci U S A
.
2002
;
99
:
11854
-11859.
28
Sarkar R, Tetreault R, Gao G, et al. Total correction of hemophilia A mice with canine FVIII using an AAV 8 serotype.
Blood
.
2004
;
103
:
1253
-1260.
29
Wang L, Calcedo R, Nichols TC, et al. Sustained correction of disease in naive and AAV2-pretreated hemophilia B dogs: AAV2/8 mediated, liver-directed gene therapy.
Blood
.
2005
;
105
:
3079
-3086.
30
Conlon TJ, Cossette T, Erger K, et al. Efficient hepatic delivery and expression from a recombinant adeno-associated virus 8 pseudotyped alpha1-antitrypsin vector.
Mol Ther
.
2005
;
12
:
867
-875.
31
Sun B, Zhang H, Franco LM, et al. Efficacy of an adeno-associated virus 8-pseudotyped vector in glycogen storage disease type II.
Mol Ther
.
2005
;
11
:
57
-65.
32
Herzog RW, Yang EY, Couto LB, et al. Long-term correction of canine hemophilia B by gene transfer of blood coagulation factor IX mediated by adeno-associated viral vector.
Nat Med
.
1999
;
5
:
56
-63.
33
Rawle FE, Lillicrap D. Preclinical animal models for hemophilia gene therapy: predictive value and limitations.
Semin Thromb Hemost
.
2004
;
30
:
205
-213.
34
Rutledge EA, Halbert CL, Russell DW. Infectious clones and vectors derived from adeno-associated virus (AAV) serotypes other than AAV type 2.
J Virol
.
1998
;
72
:
309
-319.
35
Matsushita T, Elliger S, Elliger C, et al. Adeno-associated virus vectors can be efficiently produced without helper virus.
Gene Ther
.
1998
;
5
:
938
-945.
36
Grimm D, Zhou S, Nakai H, et al. Preclinical in vivo evaluation of pseudotyped adeno-associated virus vectors for liver gene therapy.
Blood
.
2003
;
102
:
2412
-2419.
37
Bi L, Lawler AM, Antonarakis SE, High KA, Gearhart JD, Kazazian HH Jr. Targeted disruption of the mouse factor VIII gene produces a model of haemophilia A.
Nat Genet
.
1995
;
10
:
119
-121.
38
National Research Council.
Guide for the Care and Use of Laboratory Animals
. Washington, DC: National Academy Press;
1985
. NIH publication no. 85-23.
39
Kasper CK, Aledort L, Aronson D, et al. Proceedings: a more uniform measurement of factor VIII inhibitors.
Thromb Diath Haemorrh
.
1975
;
34
:
612
.
40
Sommer JM, Smith PH, Parthasarathy S, et al. Quantification of adeno-associated virus particles and empty capsids by optical density measurement.
Mol Ther
.
2003
;
7
:
122
-128.
41
Feingold HM, Pivacek LE, Melaragno AJ, Valeri CR. Coagulation assays and platelet aggregation patterns in human, baboon, and canine blood.
Am J Vet Res
.
1986
;
47
:
2197
-2199.
42
Hough C, Kamisue S, Cameron C, et al. Aberrant splicing and premature termination of transcription of the FVIII gene as a cause of severe canine hemophilia A: similarities with the intron 22 inversion mutation in human hemophilia.
Thromb Haemost
.
2002
;
87
:
659
-665.
43
Giles AR, Tinlin S, Greenwood R. A canine model of hemophilic (factor VIII:C deficiency) bleeding.
Blood
.
1982
;
60
:
727
-730.
44
Xiao W, Chirmule N, Berta SC, McCullough B, Gao G, Wilson JM. Gene therapy vectors based on adeno-associated virus type 1.
J Virol
.
1999
;
73
:
3994
-4003.
45
Rabinowitz JE, Rolling F, Li C, et al. Cross-packaging of a single adeno-associated virus (AAV) type 2 vector genome into multiple AAV serotypes enables transduction with broad specificity.
J Virol
.
2002
;
76
:
791
-801.
46
Qu G, Bahr-Davidson J, Prado J, et al. Separation of adeno-associated virus type 2 empty particles from genome containing vectors using anion-exchange column chromatography.
Mol Ther
. In press.
47
Zolotukhin S, Byrne BJ, Mason E, et al. Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield.
Gene Ther
.
1999
;
6
:
973
-985.
48
Davidoff AM, Gray JT, Ng CY, et al. Comparison of the ability of adeno-associated viral vectors pseudotyped with serotype 2, 5, and 8 capsid proteins to mediate efficient transduction of the liver in murine and nonhuman primate models.
Mol Ther
.
2005
;
11
:
875
-888.
49
Ye P, Thompson AR, Sarkar R, et al. Naked DNA transfer of factor VIII induced transgene-specific, species-independent immune response in hemophilia A mice.
Mol Ther
.
2004
;
10
:
117
-126.
50
Balague C, Zhou J, Dai Y, et al. Sustained highlevel expression of full-length human factor VIII and restoration of clotting activity in hemophilic mice using a minimal adenovirus vector.
Blood
.
2000
;
95
:
820
-828.
51
Gallo-Penn AM, Shirley PS, Andrews JL, et al. Systemic delivery of an adenoviral vector encoding canine factor VIII results in short-term phenotypic correction, inhibitor development, and biphasic liver toxicity in hemophilia A dogs.
Blood
.
2001
;
97
:
107
-113.
52
Qian J, Borovok M, Bi L, Kazazian HH Jr, Hoyer LW. Inhibitor antibody development and T cell response to human factor VIII in murine hemophilia A.
Thromb Haemost
.
1999
;
81
:
240
-244.
53
Chao H, Walsh CE. Induction of tolerance to human factor VIII in mice.
Blood
.
2001
;
97
:
3311
-3312.
54
High KA. Clinical gene transfer studies for hemophilia B.
Semin Thromb Hemost
.
2004
;
30
:
257
-267.
55
Kay MA, Manno CS, Ragni MV, et al. Evidence for gene transfer and expression of factor IX in haemophilia B patients treated with an AAV vector.
Nat Genet
.
2000
;
24
:
257
-261.
56
Manno CS, Chew AJ, Hutchison S, et al. AAV-mediated factor IX gene transfer to skeletal muscle in patients with severe hemophilia B.
Blood
.
2003
;
101
:
2963
-2972.
57
Mount JD, Herzog RW, Tillson DM, et al. Sustained phenotypic correction of hemophilia B dogs with a factor IX null mutation by liver-directed gene therapy.
Blood
.
2002
;
99
:
2670
-2676.
58
Snyder RO, Miao C, Meuse L, et al. Correction of hemophilia B in canine and murine models using recombinant adeno-associated viral vectors.
Nat Med
.
1999
;
5
:
64
-70.
59
Manno CS, Pierce GF, Glader B, et al. AAV-mediated, liver-directed gene transfer for severe hemophilia B: successful transduction and limitations imposed by the host immune response.
Nat Med
.
2006
;
12
:
342
-347.
60
Landskroner KA, Olson NC, Jesmok GJ. Enhanced factor VIII activity measurements using ROTEG and factor VIII-/-mice whole blood.
J Thromb Haemost
.
2004
;
2
:
2274
-2275.
61
Landskroner KA, Olson NC, Jesmok GJ. Thromboelastography measurements of whole blood from factor VIII-deficient mice supplemented with rFVIII.
Haemophilia
.
2005
;
11
:
346
-352.
62
Arruda VR, Schuettrumpf J, Herzog RW, et al. Safety and efficacy of factor IX gene transfer to skeletal muscle in murine and canine hemophilia B models by adeno-associated viral vector serotype 1.
Blood
.
2004
;
103
:
85
-92.
63
Zhang N, Clement N, Chen D, et al. Transduction of pancreatic islets with pseudotyped adeno-associated virus: effect of viral capsid and genome conversion.
Transplantation
.
2005
;
80
:
683
-690.
64
Scallan CD, Jiang H, Liu T, et al. Human immunoglobulin inhibits liver transduction by AAV vectors at low neutralizing titers in SCID mice.
Blood
.
2006
;
107
:
1810
-1817.