Investigators in the United Kingdom have shown that hereditary amyloidosis can be misdiagnosed as Ig light-chain (AL) amyloidosis because family history is an ineffective screen, and tissue staining used to type amyloid is unreliable. Misdiagnosis of AL can lead to inappropriate use of chemotherapy and failure to diagnose a hereditary disease. Over a 3-year period we sought to determine how often both possible sources of amyloidosis occurred in the same patient. We employed an algorithm based on established data and patterns of amyloidosis in order to focus the screening effort. Of 178 consecutive patients referred for amyloidosis, 54 were screened by polymerase chain reaction techniques with primers designed to detect transthyretin, apolipoprotein AI, apolipoprotein AII, fibrinogen Aα, and lysozyme variants. Three patients (6% of those screened and 2% of symptomatic patients) had both a monoclonal gammopathy and a hereditary variant. These results justify further study of screening for hereditary variants in patients with apparent AL, and highlight the need for practical techniques for identifying fibrils extracted from tissue.

Introduction

In the report of the first autologous stem cell transplantation (SCT) trial for systemic Ig light-chain (AL) amyloidosis, the authors wrote that patients with hereditary amyloidosis “are never candidates for dose-intensive melphalan.”1p3669 In hereditary amyloid, the mutant protein is often hepatic in origin, and the standard treatment is liver transplantation, not high-dose chemotherapy.2-4  In AL, the precursor protein is an immunoglobulin light chain produced by clonal plasma cells, and standard treatment is cytoreductive chemotherapy.5-7 

The issue of misdiagnosis of AL has been raised by several investigators.8,9  The national amyloidosis center in the United Kingdom reported that, of 350 patients thought to have AL, 10% had hereditary variants instead, including patients who had understandably failed SCT. The investigators noted that hereditary variants have variable penetrance, making family history an ineffective screen, and that the immunohistochemical (IHC) staining techniques used to type tissue amyloid as derived from Ig light chains were unreliable, although IHC staining for non-Ig amyloid-forming proteins such as transthyretin (TTR) or fibrinogen Aα may be useful.9  The lack of reliable staining for all types of amyloid limits the utility of IHC approaches.10 

Most hereditary variants are due to point mutations causing amino acid replacements. In the series of 350 patients from the United Kingdom, the identification of hereditary variants was based on polymerase chain reaction (PCR) amplification and sequencing of potentially mutated genes.9  Obviously the issue of diagnostic confidence would be moot if the amyloid protein in each case could be extracted easily from tissue and evaluated for identity.11  Currently, such techniques are not practical because, given the variability of deposits, obtaining enough tissue for protein extraction or for immunogold electronmicroscopy is problematic.11,12  In this study, we asked how often patients with symptomatic amyloidosis might have both a monoclonal gammopathy and a hereditary variant, employing a screening algorithm based on patterns of presentation of hereditary and AL amyloidosis. Our results support the need for routine DNA-based screening and for new methods for typing amyloid.

Study design

Patients and screening

Between June 1, 2002, and August 1, 2005, patients referred for assessment of systemic amyloidosis were evaluated for monoclonal gammopathy and organ involvement with amyloid as previously described.13-15  Approval was obtained from the institutional review board of the Memorial Sloan-Kettering Cancer Center for these studies and patients gave written informed consent. We screened all patients in the following categories for hereditary variants whether or not they had a monoclonal gammopathy: (1) African Americans were screened for the presence of a mutant transthyretin (the Val122Ile variant of TTR occurs in 4% of African Americans16 ); (2) patients with dominant peripheral nervous system involvement were screened for the variants shown in Table 1 (peripheral neuropathy is a common presentation of AL amyloidosis and several hereditary variants13 ); (3) patients with isolated renal amyloidosis and no amyloid in the bone marrow were screened for the fibrinogen Aα variant that occurred in 5% of patients from the United Kingdom, all with renal but not marrow amyloid9 ; and (4) patients sent for hereditary screening or with a biopsy reporting amyloidosis were screened for all variants shown in Table 1 and tested for a monoclonal gammopathy; some were rebiopsied.

Table 1.

Genes, primers, PCR conditions, and amplicon sizes



Primers (5′ to 3′)

Annealing temperature, °C (no. cycles)

Amplicon size, bp
Gene (exon)
Forward
Reverse
Transthyretin* (2)   gtaattcttgtttcgctccaga   gataaaaccaagtcctgtggg   58(35)   271  
Transthyretin (3)   ggtgtattactttgccatgcc   ctcgaaggtctgtatactcac   58(35)   226  
Transthyretin (4)   tcatgtgtgtcatctgtcacg   gttaaagtggaatgaaaagtgc   58(35)   340  
Apolipoprotein Al (2)   caccctcagggagccaggctcgg   taggtgaggactcggccagtctgg   65(35)   255  
Apolipoprotein Al (3)   cagccctcaacccttctgtctcacc   cagatgcgtgcgcagcgcgtccaca   65(35)   392  
Apolipoprotein Al (3)   agctgcaagagaagctgagcccact   aacgtttattctgagcaccgggaag   65(35)   370  
Fibrinogen Aα  tgatgaagctgccttcttcga   ctcatctgccattttatagctc   58(35)   277  
Apolipoprotein All§ (3)   tgctgtggacccagctga   gaaccccttgccctgaga   60(35)   217  
Apolipoprotein All (4)   ctaatcccctcaccta   ggaagacaatggtctg   45(35)   161  
Lysozyme (2)
 
agtcacttagtgttgctgttt
 
accagattggtcaaatattag
 
54(35)
 
242
 


Primers (5′ to 3′)

Annealing temperature, °C (no. cycles)

Amplicon size, bp
Gene (exon)
Forward
Reverse
Transthyretin* (2)   gtaattcttgtttcgctccaga   gataaaaccaagtcctgtggg   58(35)   271  
Transthyretin (3)   ggtgtattactttgccatgcc   ctcgaaggtctgtatactcac   58(35)   226  
Transthyretin (4)   tcatgtgtgtcatctgtcacg   gttaaagtggaatgaaaagtgc   58(35)   340  
Apolipoprotein Al (2)   caccctcagggagccaggctcgg   taggtgaggactcggccagtctgg   65(35)   255  
Apolipoprotein Al (3)   cagccctcaacccttctgtctcacc   cagatgcgtgcgcagcgcgtccaca   65(35)   392  
Apolipoprotein Al (3)   agctgcaagagaagctgagcccact   aacgtttattctgagcaccgggaag   65(35)   370  
Fibrinogen Aα  tgatgaagctgccttcttcga   ctcatctgccattttatagctc   58(35)   277  
Apolipoprotein All§ (3)   tgctgtggacccagctga   gaaccccttgccctgaga   60(35)   217  
Apolipoprotein All (4)   ctaatcccctcaccta   ggaagacaatggtctg   45(35)   161  
Lysozyme (2)
 
agtcacttagtgttgctgttt
 
accagattggtcaaatattag
 
54(35)
 
242
 
*

The Online Mendelian Inheritance in Man identifier (OMIM ID) for transthyretin (TTR) is + 176300. There are more than 100 amyloidogenic TTR variants. Common ones include Val30Met, Thr60Ala, Ile84Thr, and Val122Ile (see Connors et al3 ).

The OMIM ID for apolipoprotein AI is *107680. Most variants are nonneuropathic and cause cardiac and cutaneous amyloidosis. Common ones include Gly26Arg, Leu60Arg, Trp50Arg, Leu90Pro, Arg173Pro, Leu174Ser, Ala175pro, and a deletion variant with a 2-bp insertion at position 60.

The OMIM ID for fibrinogen Aα is + 134820. There are at least 3 amyloidogenic variants: Arg554Leu, Glu526Val, and a frameshift mutation that causes termination at codon 548.

§

The OMIM ID for apolipoprotein AII is *107670. The amyloidogenic variants involve stop codon mutations at position 78 to glycine, serine, or arginine, with abnormal extension of the protein; these variants are usually nonneuropathic.

The OMIM ID for lysozyme is *153450. Amyloidogenic variants include Ile56Thr, Asp67His, Trp64Arg, and Phe57Ile, and are usually nonneuropathic.

PCR assays

Genomic DNA was extracted from mononuclear cells as previously described.17  Primer pairs were designed for transthyretin, apolipoprotein AI, apolipoprotein AII, fibrinogen Aα, and lysozyme (Table 1).3,18-21  PCR amplicons were sequenced at our core facility and results scanned with Chromas Version 1.45 (Griffith University, Queensland, Australia) and evaluated by BLAST (Genbank).

Immunohistochemical staining for TTR

Tissue sections stained for the identification of amyloidosis by Congo red dichroism were also stained for TTR in patients with both a monoclonal gammopathy and hereditary TTR variants and in patients suspected of hereditary disease or senile cardiac amyloidosis, a diagnosis that requires TTR-positive endomyocardial amyloid and wild-type TTR gene sequence.22 

Polyclonal rabbit anti–human TTR (DAKO, Carpenteria, CA) was used with citric acid pH 6.00 at a 1:2000 dilution. Slides were incubated with the primary antibody overnight at 4°C in a humidity chamber. Secondary antibody at 1:500 dilution in 1% bovine serum albumin (BSA) in phosphate-buffered saline (PBS) was applied for 1 hour at room temperature then washed in PBS. Peroxidase-conjugated tertiary antibody (DAKO) at 1:500 in 1% BSA/PBS was applied for 45 to 60 minutes at room temperature, then washed. Slides were transferred to a diaminobenzidine bath for 5 to 15 minutes, washed in tap water, then counterstained using Harris modified hematoxylin, decolorized with 1% acid alcohol in ammonia water, dehydrated 3 times in 95% ethanol, 100% ethanol, and xylene for 2 minutes each, and coverslipped with mounting media.

Amyloid deposits were TTR-positive if the TTR immunostain specifically demonstrated concordance with the Congo red stained section—that is, if the areas of amyloid by Congo red dichroisim were TTR-positive and the Congo red–negative areas were TTR-negative.

Results and discussion

One hundred and seventy-eight consecutive patients were evaluated for amyloidosis and the diagnosis was confirmed in 96%, most of whom were symptomatic (Table 2). In an attempt to determine how often both a monoclonal gammopathy and a hereditary variant occurred in the same patient, patients in 4 categories were screened and 1 patient with both proteins was identified in 3 of the 4 categories. They represented 6% of those screened and 2% of symptomatic patients. One was African-American, one had peripheral neuropathy, and the third was referred for evaluation of hereditary amyloidosis and was diagnosed with Durie-Salmon stage I multiple myeloma. All had bona fide monoclonal gammopathies, not faint bands on urine immunofixation, and all had a variant TTR (Table 2). TTR staining indicated that in 2 cases amyloid was likely due to variant TTR and in one it was not (Table 2).

Table 2.

Patients seen between June 1, 2002, and August 1, 2005, for assessment of systemic amyloidosis


Feature

Data
No. patients  178  
    No. men/no. women   110/68  
    Median age, y (range)   60 (34-83)  
Diagnoses, no.  170  
    AL   150  
    ATTR   7  
    Both MG and hereditary variant identified   3  
    AA   1  
    Senile cardiac   2  
    Plasmacytoma   2  
    Other   5  
Asymptomatic patients, no.  5  
    ATTR   2  
    Localized AL in plasmacytomas   2  
    Localized with cancer   1  
No. patients with symptoms of organ involvement  165  
    Dominant organ involvement, no. (%)   
        Cardiac   69 (42)  
        Renal   50 (30)  
        Other   46 (28)  
Subsets screened for hereditary variants, no.  
    Patients (% of total)   54 (30)  
        African-American (no. with MG/no. without MG)   20 (16/4)  
        Peripheral neuropathy (no. with MG/no. without MG)   16 (11/5)  
        Renal without marrow amyloid (no. with MG/no. without MG)   7 (7/0)  
        Other (no. with MG/no. without MG)
 
11 (1/10)
 

Feature

Data
No. patients  178  
    No. men/no. women   110/68  
    Median age, y (range)   60 (34-83)  
Diagnoses, no.  170  
    AL   150  
    ATTR   7  
    Both MG and hereditary variant identified   3  
    AA   1  
    Senile cardiac   2  
    Plasmacytoma   2  
    Other   5  
Asymptomatic patients, no.  5  
    ATTR   2  
    Localized AL in plasmacytomas   2  
    Localized with cancer   1  
No. patients with symptoms of organ involvement  165  
    Dominant organ involvement, no. (%)   
        Cardiac   69 (42)  
        Renal   50 (30)  
        Other   46 (28)  
Subsets screened for hereditary variants, no.  
    Patients (% of total)   54 (30)  
        African-American (no. with MG/no. without MG)   20 (16/4)  
        Peripheral neuropathy (no. with MG/no. without MG)   16 (11/5)  
        Renal without marrow amyloid (no. with MG/no. without MG)   7 (7/0)  
        Other (no. with MG/no. without MG)
 
11 (1/10)
 

There were 3 patients with both a monoclonal gammopathy and an hereditary variant: a 46-year-old man with soft-tissue, nodal, and cardiac amyloid (TTR-negative by immunohistochemical staining [IHC]) with hereditary variant V1222I TTR and free λ of 28 mg/dL with 28% λ-restricted plasma cells; a 59-year-old man with peripheral neuropathy (TTR-positive by IHC) with hereditary variant F64L TTR and free λ of 3 mg/dL with 10% λ-restricted plasma cells; and a 70-year-old woman with GI involvement (TTR-positive by IHC) with hereditary variant T60A TTR and free λ of 2700 mg/dL with 30% λ-restricted plasma cells. All 3 patients had abnormal κ:λ ratios.

AA indicates secondary amyloid due to serum amyloid A protein; AL, light-chain amyloid; ATTR, familial transthyretin amyloidosis; MG, monoclonal gammopathy; and TTR, transthyretin.

The amyloidoses are diseases caused by protein misfolding.23,24  The most common type encountered by hematologists is due to monoclonal immunoglobulin light chains (AL) and can be difficult to diagnose and treat in a timely fashion.13  The median survival even with the most aggressive therapy is less than 5 years.6  Diagnostic confidence is critical in order to plan therapy, and hereditary and senile cardiac variants are not treated with cytotoxic therapies or SCT.

Our results speak to the need for reliable tools to aid in the diagnosis and management of patients with amyloidosis. Combined with the recent report from the United Kingdom, the data indicate that the issue of diagnostic confidence is important because 1 patient can have both a monoclonal gammopathy and a hereditary variant, representing 2 possible sources of amyloid-forming proteins.9  It should also be recalled that the incidence of monoclonal gammopathy of undetermined significance (MGUS) increases with age and that hereditary variants in the United States usually present in older patients. Both MGUS and Val122Ile mutant TTR are also more common in African Americans.

Given the implications for patients and their families if AL is misdiagnosed and a hereditary mutation not identified, we agree with our colleagues in the United Kingdom that all new cases of amyloidosis should be screened for both AL and hereditary variants.23  The PCR technique we used is reliable and easily implemented in human genetics laboratories. In addition, innovative and improved techniques are needed for typing amyloid from tissue biopsies.10-12  Finally, the issue of diagnostic confidence becomes even more critical as new therapies are evaluated for both AL and hereditary disease.8,25 

Prepublished online as Blood First Edition Paper, January 26, 2006; DOI 10.1182/blood-2005-10-4148.

Supported by FDA grant R03-002 174, Celgene, the MSKCC Amyloidosis Research Fund, and the Werner and Elaine Dannheiser Fund for Research on the Biology of Aging of the Lymphoma Foundation, New York, NY.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

We thank the many amyloid patients who contributed to this work. We also thank Dr Stephen D. Nimer for continued help and encouragement, the MSKCC Hematology-Oncology fellows for caring for our patients, Joanne Santorsa, RN, for assistance in bone marrow studies, and Dr Kenneth Offit and colleagues in the Department of Human Genetics at MSKCC for their encouragement.

1
Comenzo RL, Vosburgh E, Falk RH, et al. Dose-intensive melphalan with blood stem-cell support for the treatment of AL amyloidosis: survival and responses in 25 patients.
Blood.
1998
;
91
:
3662
-3670.
2
Merlini G, Bellotti V. Molecular mechanisms of amyloidosis.
N Engl J Med.
2003
;
349
:
583
-596.
3
Connors LH, Lim A, Prokaeva T, Roskens VA, Costello CE. Tabulation of human transthyretin (TTR) variants, 2003.
Amyloid.
2003
;
10
:
160
-184.
4
Ericzon BG, Larsson M, Herlenius G, et al. Report from the Familial Amyloidotic Polyneuropathy World Transplant Registry (FAPWTR) and the Domino Liver Transplant Registry (DLTR).
Amyloid.
2003
;
10
(S1):
67
-76.
5
Comenzo RL, Gertz MA. Autologous stem cell transplantation for primary systemic amyloidosis.
Blood.
2002
;
99
:
4276
-4282.
6
Skinner M, Sanchorawala V, Seldin DC, et al. High-dose melphalan and autologous stem-cell transplantation in patients with AL amyloidosis: an 8-year study.
Ann Intern Med.
2004
;
140
:
85
-93.
7
Gertz MA, Lacy MQ, Dispenzieri A, et al. Stem cell transplantation for the management of primary systemic amyloidosis.
Am J Med.
2002
;
113
:
549
-555.
8
Anesi E, Palladini G, Perfetti V, et al. Therapeutic advances demand accurate typing of amyloid deposits.
Am J Med.
2001
;
111
:
243
-244.
9
Lachmann HJ, Booth DR, Booth SE, et al. Misdiagnosis of hereditary amyloidosis as AL (primary) amyloidosis.
N Engl J Med.
2002
;
346
:
1786
-1791.
10
Murphy CL, Eulitz M, Hrncic R, et al. Chemical typing of amyloid protein contained in formalin-fixed paraffin-embedded biopsy specimens.
Am J Clin Pathol.
2001
;
116
:
135
-142.
11
Yazaki M, Liepnieks JJ, Callaghan J, et al. Chemical characterization of a lambda I amyloid protein isolated from formalin-fixed and parafin-embedded tissue sections.
Amyloid.
2004
;
11
:
50
-55.
12
Arbustini E, Morbini P, Verga L, et al. Light and electron microscopy immunohistochemical characterization of amyloid deposits.
Amyloid.
1997
;
4
:
157
-170.
13
Falk RH, Comenzo RL, Skinner M. The systemic amyloidoses.
New Engl J Med.
1997
;
337
:
898
-909.
14
Cohen A, Zhou P, Xiao Q, et al. Systemic AL amyloidosis due to non-Hodgkin's lymphoma: an unusual clinicopathologic association.
Br J Haematol.
2004
;
124
:
309
-314.
15
Comenzo RL, Zhang Y, Martinez C, Osman K, Herrera GA. The tropism of organ involvement in primary systemic amyloidosis: contributions of Ig VL germ line gene use and clonal plasma cell burden.
Blood.
2001
;
98
:
714
-720.
16
Jacobson DR, Pastore RD, Yaghoubian R, et al. Variant-sequence transthyretin (isoleucine 122) in late-onset cardiac amyloidosis in black Americans.
N Engl J Med.
1997
;
336
:
466
-473.
17
Zhou P, Zhang Y, Martinez C, et al. Melphalan-mobilized blood stem cell components contain minimal clonotypic myeloma cell contamination.
Blood.
2003
;
102
:
477
-479.
18
Benson MD, Liepnieks J, Uemichi T, Wheeler G, Correa R. Hereditary renal amyloidosis associated with a mutant fibrinogen a-chain.
Nat Gen.
1993
;
3
:
252
-255.
19
Booth DR, Tan SY, Booth SE, et al. Hereditary hepatic and systemic amyloidosis caused by a new deletion/insertion mutation in the apolipoprotein AI gene.
J Clin Invest.
1996
;
97
:
2714
-2721.
20
Pepys MB, Hawkins PN, Booth DR, et al. Human lysozyme gene mutations cause hereditary systemic amyloidosis.
Nature.
1993
;
362
:
553
-557.
21
Benson MD, Liepnieks JJ, Yazaki M, et al. A new human hereditary amyloidosis: the result of a stop-codon mutation in the apolipoprotein AII gene.
Genomics.
2001
;
72
:
272
-277.
22
Persey MR, Booth DR, Booth SE, et al. Fibril in senile systemic amyloidosis is derived from normal transthyretin.
Proc Natl Acad Sci U S A.
1990
;
87
:
2843
-2845.
23
Pepys MB. Amyloidosis.
Annu Rev Med.
2006
;
57
:
1
-19.
24
Wetzel R. Domain stability in immunoglobulin light chain deposition disorders.
Adv Protein Chem.
1997
;
50
:
183
-242.
25
Hrncic R, Wall J, Wolfenbarger DA, et al. Antibody-mediated resolution of light chain-associated amyloid deposits.
Am J Pathol.
2000
;
157
:
1239
-1246.