Abstract

Most non-Hodgkin B-cell lymphomas (NHLs) are characterized by the clonal expansion of a single cell expressing a unique rearranged immunoglobulin gene. This idiotype (Id) is a tumor-specific antigen that can be immunologically targeted. The therapeutic efficacy of Id-based vaccines correlates best with detection of cellular immune responses, although these have not been as well characterized as the humoral responses. This study exploited a molecular approach to modify the Id of 38C13 lymphoma for processing via class I and II antigen-processing pathways and evaluated protein expression in dendritic cells (DCs) to simultaneously stimulate tumor reactive CD8+ and CD4+ lymphocytes. Recombinant vaccinia viruses (rVVs) were constructed, coding for Id fused with the targeting signal of the lysosomal-associated membrane protein1 (Id-LAMP1) to promote antigen presentation in the context of major histocompatibility complex (MHC) class II. Mature DCs infected with rVV/Id-LAMP1 elicited both CD4+ and CD8+ Id-specific T cells and protected animals from tumor challenge. Id-specific CD8+ cells were required to mediate the effector phase of a therapeutic response, and CD4+ cells were beneficial in the induction phase of the response. These results demonstrate that fusing Id to LAMP1 enhances CD8+ and CD4+ Id-specific responses for NHLs and may be useful therapeutically.

Introduction

B-cell lymphomas are characterized by the clonal expansion of tumor cells expressing an idiotypic immunoglobulin (Id). The Id is determined by rearrangements of the variable heavy (VH) and light (VL) chains of the immunoglobulin V regions that are unique for each clonal B-cell population and represent tumor-specific antigens. The Id contains epitopes recognized by antibodies1-3  and epitopes presented to T cells.2,4-10  These unique features have led to the development of several strategies for active and passive Id-specific immunotherapy.11,12  Initial clinical trials demonstrated that passive transfer of monoclonal Id-specific antibodies can be effective in the treatment of non-Hodgkin B-cell lymphoma (NHL),1  although tumor escape often limits the efficacy of this approach.13-16  Active immunization with tumor-derived Id protein was first shown to be effective in mouse models of lymphoma,2,3,17  and clinical trials of vaccination with patient-specific Id protein have been shown to elicit immunologic anti-Id and clinical responses.8  Initial trials, with the Id protein coupled to keyhole limpet hemocyanin (KLH), induced mainly humoral responses to the antigen, with robust cytotoxic cellular responses only in a minority of patients. T cells have been shown in animal models and clinical trials to mediate potent antitumor effects. The importance of CD8+ T cells in antitumor responses has been often emphasized,18,19  and infusion of tumor-reactive CD8+ T cells expanded to large numbers in vitro has been effective in eliminating tumors in animal models and patients with cancer.20-29  CD4+ T cells can not only provide critical support for the generation and maintenance of CD8+ responses but also mediate antitumor activity.30,31  Thus, efforts have been made to boost CD4+ and CD8+ responses to the Id. Strategies have included fusion of the antigen with xenogeneic constant regions, or fusion of a single-chain variable fragment (scFv) with molecules to enhance immunogenicity, such as fragment C of tetanus toxoid,32  cytokines such as granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 4 (IL-4), IL-2, IL-1β.33-36  Clinical trials produced encouraging immunologic cellular responses that correlated with improvement in relapse-free and overall survival. Following administration of Id-KLH conjugates with GM-CSF, Id-specific cellular responses were induced in 15 of 23 patients, and immune responses were associated with molecular remission in most patients.37  Administration of dendritic cells (DCs) pulsed with Id induced cellular Id-specific immune responses in 65% of patients.9,27  Despite the observed clinical benefit, the efficacy of these vaccines may have been limited in part by the inefficient induction of Id-specific CD8+ T-cell responses, presumably as a result of providing the antigen exogenously as a protein. Accordingly, ongoing clinical trials evaluating DNA vaccination with scFV coupled with fragment C are producing improved CD8+ responses.12  To elucidate the importance and relative contributions of Id-specific CD4+ and CD8+ T cells in the control of B-cell malignancies, we have performed studies in the 38C13 murine model for human NHL.17  To achieve antigen processing in the context of major histocompatibility complex (MHC) class I, the Id was inserted into a recombinant vaccinia virus (rVV) for infection of DCs.38,39  As we have previously demonstrated, vaccinia infection blocks DC maturation,40  making it essential that DCs be matured prior to infection for induction of CD8+ responses. However, following maturation, DCs exhibit severely reduced ability to capture and process antigens for presentation in the context of MHC class II for the generation of CD4+ T cells. Therefore, we and others have used strategies that directly target intracellular antigens to the MHC class II compartments while still permitting class I presentation.40-44  In particular, the cytoplasmic tail of the lysosomal-associated membrane protein 1 (LAMP1) has been shown to be sufficient for lysosomal targeting.45  By using rVV containing the Id from the 38C13 murine B-cell lymphoma fused to LAMP1-targeting signals, we demonstrated that DCs can elicit Id-specific CD4+ and CD8+ T cells capable of protecting animals from tumor challenge and curing tumor-bearing mice.

Materials and methods

Mice

Six-week-old female C3H/HeN mice (Charles River, Calco, Italy) were housed in a specific pathogen-free animal facility and treated in accordance with the European Union guidelines and with the approval of the Institutional Ethical Committee.

Cell lines

38C13 is a carcinogen-induced murine B-cell lymphoma tumor that expresses IgM/k on its surface and is MHC I+, MHC II-.46,47  All experiments were performed with cells from a cell bank of frozen 38C13 cells. 38C13 cells were maintained in RPMI 1640, 10% heat-inactivated fetal calf serum (FCS), 2 mM l-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, and 50 μM 2-Mercaptoethanol (complete medium) at 37°C, 5% CO2 in a humidified incubator. CH27 is a carcinogen-induced B-cell lymphoma tumor that also expresses IgM/k on its surface, but this idiotype is different from the one expressed by 38C13. CH27 cells were maintained under the same culture conditions as 38C13.

Generation of DCs

DCs were prepared from bone marrow of C3H mice. Briefly, single-cell suspensions of bone marrow were seeded into 6-well plates at 2 × 106/mL in Iscoves Modified Dulbecco Medium (Cambrex, Verviers, Belgium) supplemented with penicillin-streptomycin and 10% FCS, GM-CSF (25 ng/mL), and IL-4 (5 ng/mL; BD, San Diego, CA) for 5 days. Eight hours before harvesting the nonadherent and loosely adherent cells, lipopolysaccharide (LPS; 1 μg/mL) was added to the culture medium as a maturation signal for DCs.

Antibodies

The purity of DCs was evaluated by cell surface staining with phycoerythrin (PE)–conjugated antibodies (Abs) to CD11c and PE-conjugated isotype controls (BD Biosciences, Erembodegem, Belgium). Activation of DCs was evaluated by staining the cells with PE-conjugated Abs to CD80, CD86, and I-AK (BD Biosciences) and isotype controls. The samples were analyzed on a FACSCalibur (BD Biosciences) using CellQuest software. Data shown are representative of 3 or more independent experiments.

Plasmids and vaccinia viruses

The Sig-HA1-VL-LAMP1 and Sig-VH-HA1-LAMP1 genes were constructed by 20 cycles of strand overlap extension polymerase chain reaction (PCR) with the high-fidelity PWO DNA polymerase (Roche, Mannheim, Germany), using as template the Sig-E7-LAMP1 gene (provided by D. Pardoll, Johns Hopkins University, Baltimore, MD)45  and the VL and VH sequences from the 38C13 cDNA. The genes contain the 5′ sorting signal of the mouse LAMP1 (Sig) (to mediate translocation of the nascent antigen to the lumen of the endoplasmic reticulum) encoded in frame with HA1-VL or VH-HA1 (where HA1 is a tag-peptide derived from hemagglutinin of influenza virus) and the 3′ transmembrane and cytoplasmic tail of the mouse LAMP1 (for lysosomal targeting of the antigens). Fusion genes were constructed as shown in Table 1. HA1 was placed at 5′ of VL and 3′ of VH to facilitate cloning. The rVV-Sig-HA1-VL-LAMP1, rVV-Sig-VH-HA1-LAMP1, rVV-HA1-VL, and rVV-VH-HA1 were generated by cloning the genes in the pSC11T7 plasmid downstream of the vaccinia p7.5 early/late promoter by sticky/blunt or sticky/sticky ligation in the specific enzyme restriction sites. The plasmids were transfected with Lipofectamine (Gibco, Grand Island, NY) into BSC-40 cells infected with wild-type vaccinia (rVV-wt), and rVV was amplified in thymidine kinase–negative cells and plaque purified. An rVV coding for green fluorescence protein (GFP) under control of the vaccinia p7.5 promoter was provided by L. Corey (Fred Hutchinson Cancer Research Center, Seattle, WA). As a negative control of in vivo experiments, we used an rVV containing the S65L chimeric gene, encoding for the immunodominant pp65 protein (65) of cytomegalovirus, fused to the leader sequence (S), and lysosomal-targeting signal (L) of LAMP1.40  Viral stocks were prepared in BSC-40 cells, titrated simultaneously, and diluted in Dulbecco modified Eagle medium (DMEM) containing 2.5% FCS to a final titer of 109 plaque-forming units/mL. Chimeric constructs were also cloned in pGEM4Z/GFP/A64 (kindly provided by E. Gilboa and S. Nair, Duke University Medical Center, Durham, NC), under the T7 promoter, using as restriction enzymes BamHI and EcoRI, present in the 3′ and 5′ of the fusion genes and in the polylinker of the plasmid. These plasmids were used for in vitro transcription of mRNA with the T7 mMessage mMachine kit (Ambion, Houston, TX) and polyadenylated with Poly(A) enzyme (USB, Cleveland, OH) according to manufacturers' instructions.

Table 1.

Construction of fusion genes coding for a modified 38C13 idiotype


 

 

Annealing
 
 
Constructs and primers*
 
Region encoded by the set of primers
 
Temp, °C
 
Time, s
 
Sig-HA1-VL-LAMP1    
   TTGTCGACGGATCC/ATGGCGGCCCCCG  SalI-BamHI/Sig1-4  50   30  
   GTAATCTGGAACATCGTATGGGTA/TAGATCCTCAAAGAGTGC   Sig23-28-HA11-8   
   CTTAACAACATGTTGATCCC   LAMP1365-371  58   30  
   TTCCGCGGGAATCCCTAGATGGTCTGATAGCCGGC   LAMP1398-403/EcoRI-SacII   
   CCATACGATGTTCCAGATTACGCT/GACATCCAGATGACACAG   HA12-9-VL1-6VL100-106-LAMP1365-371  52   30  
   GGGGATCAACATGTTGTTAAG/TTTTATTTCCAGCTTGGTCCC     
   TTGTCGACGGATCC/ATGGCGGCCCCCG  SalI-BamHI/Sig1-4  58   30  
   GGGGATCAACATGTTGTTAAG/TTTTATTTCCAGCTTGGTCCC   VL100-106-LAMP1365-371   
Sig-VH-HA1-LAMP1    
   TTGTCGACGGATCC/ATGGCGGCCCCCG  SalI-BamHI/Sig1-4  50   30  
   CCACCAGCTTCACCTC/TAGATCCTCAAAGAGTGC   Sig25-29-VH1-6   
   CTTAACAACATGTTGATCCC   LAMP1365-371  58   30  
   TTCCGCGGGAATCCCTAGATGGTCTGATAGCCGG   LAMP1398-403/EcoRI-SacII   
   ATGGAGGTGAAGCTGGTGG   VH1-5  50   30  
   AATGGGGATCAACATGTTGTTAAG/AGCGTAATCTGGAACATC   HA14-9-LAMP1365-372   
   ATGGAGGTGAAGCTGGTGGC   LAMP1365-371  60   60  
   TTCCGCGGGAATCCCTAGATGGTCTGATAGCCGG   HA14-9-LAMP1365-372   
   TTGTCGACGGATCC/ATGGCGGCCCCCG  SalI-BamHI/Sig1-4  58   60  
   TTCCGCGGAATCCCTAGATGGTCTGATAGCCGGC   LAMP1398-403/EcoRI-SacII   
HA1-VL    
   CCATACGATGTTCCAGATTACGCT/GACATCCAGATGACACA   HA12-9-VL1-6  52   30  
   TTCCGCGGGAATTCCTATTTTAT TTCCAGCTTGGTCCC   VL100-106/EcoRI-SacII   
   TTGTCGACGGATCCATGTACCCA TACGATGTTCCAGAT  SalI-BamHI/HA11-7  60   60  
   TTCCGCGGGAATTCCTATTTTAT TTCCAGCTTGGTCCC   HA12-9-VL100-106/EcoRI-SacII   
VH-HA1    
   TTGTCGACGGATCCATGGAGGTG AAGCTGGTGG  SalI-BamHI/VH1-6  58   30  
   ATCTGGAACATCGTATGGGTA/TGAGGAGACGGTGAGAGTG   HA11-7-VH120-126   
   TTGTCGACGGATCCATGGAGGTG AAGCTGGTGG  SalI-BamHI/VH1-6  58   30  
   TTCCGCGGGAATCCCTAAGCGTA ATCTGGAACATC
 
HA14-9/EcoRI-SacII
 

 

 

 

 

Annealing
 
 
Constructs and primers*
 
Region encoded by the set of primers
 
Temp, °C
 
Time, s
 
Sig-HA1-VL-LAMP1    
   TTGTCGACGGATCC/ATGGCGGCCCCCG  SalI-BamHI/Sig1-4  50   30  
   GTAATCTGGAACATCGTATGGGTA/TAGATCCTCAAAGAGTGC   Sig23-28-HA11-8   
   CTTAACAACATGTTGATCCC   LAMP1365-371  58   30  
   TTCCGCGGGAATCCCTAGATGGTCTGATAGCCGGC   LAMP1398-403/EcoRI-SacII   
   CCATACGATGTTCCAGATTACGCT/GACATCCAGATGACACAG   HA12-9-VL1-6VL100-106-LAMP1365-371  52   30  
   GGGGATCAACATGTTGTTAAG/TTTTATTTCCAGCTTGGTCCC     
   TTGTCGACGGATCC/ATGGCGGCCCCCG  SalI-BamHI/Sig1-4  58   30  
   GGGGATCAACATGTTGTTAAG/TTTTATTTCCAGCTTGGTCCC   VL100-106-LAMP1365-371   
Sig-VH-HA1-LAMP1    
   TTGTCGACGGATCC/ATGGCGGCCCCCG  SalI-BamHI/Sig1-4  50   30  
   CCACCAGCTTCACCTC/TAGATCCTCAAAGAGTGC   Sig25-29-VH1-6   
   CTTAACAACATGTTGATCCC   LAMP1365-371  58   30  
   TTCCGCGGGAATCCCTAGATGGTCTGATAGCCGG   LAMP1398-403/EcoRI-SacII   
   ATGGAGGTGAAGCTGGTGG   VH1-5  50   30  
   AATGGGGATCAACATGTTGTTAAG/AGCGTAATCTGGAACATC   HA14-9-LAMP1365-372   
   ATGGAGGTGAAGCTGGTGGC   LAMP1365-371  60   60  
   TTCCGCGGGAATCCCTAGATGGTCTGATAGCCGG   HA14-9-LAMP1365-372   
   TTGTCGACGGATCC/ATGGCGGCCCCCG  SalI-BamHI/Sig1-4  58   60  
   TTCCGCGGAATCCCTAGATGGTCTGATAGCCGGC   LAMP1398-403/EcoRI-SacII   
HA1-VL    
   CCATACGATGTTCCAGATTACGCT/GACATCCAGATGACACA   HA12-9-VL1-6  52   30  
   TTCCGCGGGAATTCCTATTTTAT TTCCAGCTTGGTCCC   VL100-106/EcoRI-SacII   
   TTGTCGACGGATCCATGTACCCA TACGATGTTCCAGAT  SalI-BamHI/HA11-7  60   60  
   TTCCGCGGGAATTCCTATTTTAT TTCCAGCTTGGTCCC   HA12-9-VL100-106/EcoRI-SacII   
VH-HA1    
   TTGTCGACGGATCCATGGAGGTG AAGCTGGTGG  SalI-BamHI/VH1-6  58   30  
   ATCTGGAACATCGTATGGGTA/TGAGGAGACGGTGAGAGTG   HA11-7-VH120-126   
   TTGTCGACGGATCCATGGAGGTG AAGCTGGTGG  SalI-BamHI/VH1-6  58   30  
   TTCCGCGGGAATCCCTAAGCGTA ATCTGGAACATC
 
HA14-9/EcoRI-SacII
 

 

 

VH and VL from 38C13 were fused with the leader sequence of LAMP1 (Sig), the marker HA1, and the lysosomal targeting signal of LAMP1 (LAMP1) by strand overlapping PCR. Constructs without LAMP1 signals were prepared and used as controls. Extension was done at 72°C for 60 seconds for each construct.

Temp indicates temperature; sig, 5′ sorting signal of the mouse LAMP1; HA1, tag-peptide derived from hemagglutinin of influenza virus; VH, variable region of the heavy chain of the Id expressed by the 38C13 lymphoma; VL, variable region of the light chain of the Id expressed by the 38C13 lymphoma; LAMP1, 3′ transmembrane and cytoplasmic tail of the mouse LAMP1.

*

Sense and antisense primers are shown. Restriction enzyme sites are underlined

Immunofluorescence staining

To verify the intracellular localization of transgene expression, DCs were infected for 8 hours with the different rVVs, exposed to UV light for 4 minutes, washed 3 times in phosphate-buffered saline (PBS) with Ca++ and Mg++, and fixed on poly-l-Lysine–coated cover slips. DCs were permeabilized by exposure to saponine 0.1%, bovine serum albumin (BSA) 0.3% for 30 minutes at 20°C and stained with fluorescein isothiocyanate (FITC)–-conjugated anti-HA1 (BabCO, Richmond, CA) and PE-conjugated anti–I-Ak antibodies. Colocalization was determined by confocal microscopy (Leica Alembic, Milan, Italy). To measure IL-12 production, DCs were treated with Brefeldin A (10 μg/mL; 5 hours at 37°C), labeled with biotin-conjugated anti-CD11c mAb followed by cyanine 5 (Cy5)–PE-streptavidin, fixed in 4% paraformaldehyde, permeabilized with 0.1% saponin–1% FCS-PBS, incubated with PE-conjugated mAbs specific for IL-12 for 20 minutes at room temperature, and analyzed by FACScan.

Vaccination protocol

Mice were immunized with 0.3 × 106 syngeneic DCs infected with recombinant vaccinia viruses coding for Id, Id-LAMP1,or S65L as negative control.40  Cells were injected subcutaneously in 200 μL 0.9% NaCl.

In vitro cytotoxicity against tumor cell lines

Fourteen days after vaccination, animals were killed, and spleens and lymph nodes were harvested. Splenocytes were resuspended in complete medium at 2.5 × 106/mL in T25 flasks with 1 × 106 30 cGy irradiated 38C13 or CH27 cells. After 4 days, medium was supplemented with 25 IU/mL IL-2. Twelve hours later, cells were isolated on a Lympholyte-M gradient (Cedarlane, Hornby, ON, Canada) and positively selected based on CD8 expression (Miltenyi Biotech, Bergisch Gladbach, Germany) according to manufactures' instructions. At day 5, CD8+ selected cells were tested for cytolytic activity in a standard 4-hour 51Cr release assay at increasing effector-target (E/T) ratios in triplicates. Specific lysis was expressed according to the following formula: 100 × (average experimental cpm - average spontaneous cpm)/(average maximum cpm - average spontaneous cpm).

Thymidine incorporation assay

Splenocytes were stimulated with 30 cGy irradiated 38C13 or CH27 tumor cells as described “In vitro cytotoxicity against tumor cell lines,” and at a day 4 IL-2 (25 UI/mL) was added. After a total of 8 days of culture, cells were isolated on a Lympholyte-M gradient, and CD4+ cells were purified by negative selection with anti-CD8–conjugated beads (Miltenyi Biotech). To test for proliferation to the idiotype, DCs generated from naive C3H mice were transfected with mRNA coding for Sig-HA1-VL-LAMP1 and Sig-VH-HA1-LAMP1 or S65L as a control, as previously described.48  Briefly, 1 × 106 DCs were transfected with 5 μg RNA previously mixed with transmessager (Qiagen, Milan, Italy), at an RNA/lipid ratio of 1:4. Transfection was performed at 37°C for 12 hours. Transfected DCs were then matured with LPS (1 mg/mL) for 8 hours and used as stimulators. The CD4+ responders were plated with stimulators at increasing responder-stimulator (R/S) ratio in triplicates. After 72 hours, 1 μCi (0.037 MBq) [3H]thymidine deoxyribose ([3H]-TdR) was added to each well, and counts per minute (cpm) were counted at 96 hours. The proliferative response was expressed as cpm sample - cpm control. Proliferation experiments were repeated after exposure of DCs to chloroquine 50 μM immediately prior to infection with rVV Id-LAMP1 and rVV-S65L.

Tumor inoculum in mice

38C13 cells were grown in tissue culture for 72 hours, and cells in logarithmic growth phase were washed 3 times in PBS and appropriately diluted for injection of mice subcutaneously with 1000 viable tumor cells in 0.1 mL PBS. For adoptive therapy experiments, cyclophosphamide (50 mg/kg) was administered intraperitoneally 7 days after the tumor inoculum to reduce the tumor burden. Mice were followed for survival and tumor growth.

Adoptive transfer of immune lymphocytes

Seven C3H mice per group were immunized once with DCs infected with the different rVVs. After 2 weeks, mice were killed, and spleens and draining lymph nodes were collected and pooled within each group, depleted of B cells, and positively selected for CD4+ and CD8+ T cells. Immune selected cells (6 × 106) were resuspended in 200 μL 0.9% NaCl and injected intravenously in 6 groups of 5 C3H mice that received 1000 viable 38C13 tumor cells subcutaneously and cyclophosphamide intravenously 9 and 7 days earlier. As controls, 2 cohorts of mice received only tumor cells or tumor cells and cyclophosphamide. Mice were again followed for survival and tumor growth.

In vivo depletion of CD4+ and CD8+ T cells

Monoclonal antibodies (mAbs) GK1.5 (rat IgG2b anti–murine CD4) and 53.6.72 (rat IgG2a anti–murine CD8) (Abinova, Taiwan) were used for in vivo depletion of CD4+ and CD8+ T-cell subsets, respectively. Groups of 6 mice were each injected intraperitoneally with either 300 μL anti–CD4 (GK1.5) or anti–CD8 (53.6.72) mAbs or with both anti-CD4 and anti-CD8 mAbs at day -3, -1, +2, and +5, with day 0 designated as the day of vaccination with DCs infected with the different rVVs. Six nondepleted mice were analyzed as controls. At day 14 mice were challenged with 1000 viable 38C13 tumor cells subcutaneously and followed for survival. On the days of vaccination (day 0) and tumor challenge (day 14), blood samples were collected and analyzed by flow cytometry for CD4+ and CD8+ T-cell subsets.

Statistical analysis

Data obtained from DC maturation experiments were analyzed by a 2-tailed Student t test (Excel; Microsoft, Redman, WA). Survival proportions were analyzed by a Fisher Exact test (Prism; GraphPad, San Diego, CA). The results were considered to be significant when P was less than .05.

Results

Activated murine DCs can be infected by vaccinia virus and maintain a mature phenotype after rVV infection

Infection of human immature DCs with rVV blocks the ability of DCs to mature in response to maturation signals.40,49  Since DC maturation is required for stimulation of T-cell responses, and since many viral activities that interfere with antigen presentation are species specific, we tested whether this blockade also occurred in murine DCs. Bone marrow–derived immature DCs obtained from C3H mice were infected for 8 hours with a rVV encoding GFP (rVV-GFP) at varying multiplicities of infection (MOI). An MOI of 50:1 reproducibly resulted in the highest infection efficiency (10%-40%) and was used for subsequent experiments. Eight hours after infection, DCs were exposed to LPS and analyzed after an additional 24 hours. As previously observed with human DCs, rVV infection of murine immature DCs failed to induce up-regulation of MHC class II, costimulatory molecules, or IL-12 secretion (Figure 1A). The infected DCs could not subsequently be matured by exposure to LPS as demonstrated again by failure to up-regulate I-Ak, CD86, and weak induction of IL-12 (Figure 1B). Therefore, we examined whether murine DCs already matured by exposure to LPS remained, similarly to human DCs, susceptible to vaccinia virus infection. Immature DCs were exposed to LPS for 8 hours and then infected with rVV-GFP at an MOI of 50:1 for 8 hours. Mature DCs were susceptible to rVV infection and maintained an activated phenotype after infection (Figure 1C-D). Expressions of I-Ak (Figure 1E) and CD86 (Figure 1F) were significantly higher (P < .05) in rVV–infected mature DCs (exposed to LPS for 8 hours before infection) than in rVV-infected immature DCs subsequently exposed to LPS for 8 hours. Expressions of I-Ak and of CD86 were similar in uninfected mature DCs and in mature DCs subsequently infected with rVV. Additionally, mature DCs were more resistant to the cytopathic effects of rVV than immature DCs (data not shown). Since DCs have been reported to be more effective when infused 8 hours rather than 48 hours after exposure to an activation signal,50  in vivo experiments were performed with DCs after 8-hour exposure to LPS followed by rVV infection.

Figure 1.

rVV infection blocks DC maturation, while mature DCs infected by rVV maintain a mature phenotype. An rVV coding for GFP was used to infect DCs for 8 hours. rVV-infected immature DCs were mock treated (A) or exposed to LPS for 8 hours (B). Cells were then analyzed by fluorescence-activated cell sorting (FACS) for expression of GFP, I-Ak, and CD86 and for IL-12 production. Mock-infected cells exposed to LPS (C) were analyzed as controls. To overcome rVV interference with DC maturation, DCs were first matured for 8 hours with LPS, then infected with rVV-GFP (D) and analyzed to determine infection efficiency and level of activation. The average expression of I-Ak (E) and CD86 (F) in the different samples are shown (average of 3 experiments).

Figure 1.

rVV infection blocks DC maturation, while mature DCs infected by rVV maintain a mature phenotype. An rVV coding for GFP was used to infect DCs for 8 hours. rVV-infected immature DCs were mock treated (A) or exposed to LPS for 8 hours (B). Cells were then analyzed by fluorescence-activated cell sorting (FACS) for expression of GFP, I-Ak, and CD86 and for IL-12 production. Mock-infected cells exposed to LPS (C) were analyzed as controls. To overcome rVV interference with DC maturation, DCs were first matured for 8 hours with LPS, then infected with rVV-GFP (D) and analyzed to determine infection efficiency and level of activation. The average expression of I-Ak (E) and CD86 (F) in the different samples are shown (average of 3 experiments).

The idiotype can be targeted to the lysosomal/endosomal compartment in mature DCs

To target antigen processing into the class II presentation pathway, rVVs coding for the variable regions of the heavy and light chain of the 38C13-Id fused with LAMP1-targeting signals were constructed. Two chimeric constructs containing the VH or VL region of 38C13-Id fused with the leader sequence of LAMP1, with an HA1 tag to monitor protein expression and with the cytoplasmic tail of LAMP1 were constructed and named rVV-Sig-VH-HA1-LAMP1, rVV-Sig-HA1-VL-LAMP1. Two chimeric constructs containing the VH or VL regions fused with the marker HA1 (rVV-VHH-HA1, rVV-HA1-VL) but lacking the LAMP1 targeting sequences were also constructed and used as controls (Table 1). To accurately compare the different constructs, viral titers were measured simultaneously 3 times. The same levels of antigen expression were detected by Western blot on large cell lines (LCLs) infected with the different rVVs (data not shown). Intracellular trafficking of VH and VL was assessed in rVV-infected DCs by immunofluorescence. DCs infected with rVV-VH-HA1 and rVV-HA1-VL showed a homogeneous pattern of antigen expression dispersed throughout the cytosol (Figure 2), whereas DCs infected with rVV-VH-HA1-LAMP1 and with rVV-HA1-VL-LAMP1 showed a vesicular pattern of antigen expression. This vesicular pattern and overlapping staining with anti-IAk is consistent with localization to the endosomal/lysosomal pathway.51 

Figure 2.

LAMP1-targeting signals target antigen expression in the MHC class II–processing compartment. Intracellular localizations of VH-HA1 and Sig-VH-HA1-LAMP1 were assessed by immunofluorescence, using anti-HA1 and anti–I-Ak Abs. Images were captured with a Leica TCS SP2 microscope with a Pl Apo oil objective, 63×/1.4 numerical aperture (Leica, Milan, Italy). Cells were stained using HA1-FITC and I-AK-TRIC mAbs. Images were processed with Leica confocal software.

Figure 2.

LAMP1-targeting signals target antigen expression in the MHC class II–processing compartment. Intracellular localizations of VH-HA1 and Sig-VH-HA1-LAMP1 were assessed by immunofluorescence, using anti-HA1 and anti–I-Ak Abs. Images were captured with a Leica TCS SP2 microscope with a Pl Apo oil objective, 63×/1.4 numerical aperture (Leica, Milan, Italy). Cells were stained using HA1-FITC and I-AK-TRIC mAbs. Images were processed with Leica confocal software.

T-cell anti-Id immune responses can be elicited by a single vaccination with mature DCs expressing the antigen

Bone marrow–derived DCs obtained from C3H mice were activated with LPS, divided into 4 samples, and infected with the 4 rVVs: rVV-Sig-VH-HA1-LAMP1, rVV-Sig-HA1-VL-LAMP1, rVV-VH-HA1, and rVV-HA1-VL. Eight hours after infection samples were UV-irradiated to halt viral replication. Mature DCs infected with rVV-Sig-VH-HA1-LAMP1 and mature DCs infected with rVV-Sig-HA1-VL-LAMP1 were mixed at 1:1 ratio to obtain the Id-LAMP1 vaccine and inoculated subcutaneously into 4 mice at a total dose of 0.3 × 106 DCs/mouse. Mature DCs infected with rVV-VH-HA1 and mature DCs infected with rVV-HA1-VL, mixed at 1:1 ratio to obtain the Id vaccine, were inoculated at the same dose into 4 other mice. Finally, mature DCs infected with the irrelevant rVV-S65L were infused into 4 mice as controls. Fourteen days after vaccination, mice were killed, and spleens and lymph nodes were harvested and analyzed in vitro. No differences in the total number of lymphocytes or CD4+ or CD8+ T cells were observed in samples obtained in mice that received different vaccines. To identify and quantify Id-specific T-cell responses, splenocytes were first stimulated with irradiated 38C13 tumor cells or CH27, as negative control, for 5 days as described in “Materials and methods.” After one round of stimulation, CH27 had not induced cell growth, while 38C13 induced proliferation for both CD4+ and CD8+ effectors. Id-specific CD4+- and CD8+-mediated immune responses were analyzed separately. CD4+ T cells were isolated as described in “Materials and methods,” with more than 85% purity achieved. Since 38C13 is MHC II negative, we used DCs transfected with mRNA coding for Id-LAMP1 or S65L as a negative control to detect proliferation of Id-specific CD4+ cells in a 72-hour 3H-thymidine incorporation assay. This sequence of stimulator cells was used to permit detection of responses to Id epitopes without confounding responses to vaccinia. A strong Id-specific CD4+ T-cell proliferative response was elicited in cells from mice immunized in vivo with the Id-LAMP1 vaccine and stimulated in vitro with the Id-LAMP1 constructs, with very little proliferation detected in cells harvested from mice vaccinated with Id or S65L (Figure 3A). However, mice primed in vivo with S65L did demonstrate an appropriate proliferative response to pp65 (Figure 3B). To directly demonstrate that LAMP1 sequences mediate MHC class II processing of the idiotype, chloroquine was used to block lysosomal activity. Proliferation of CD4+ cells from immunized mice to DCs infected with rVV-Id-LAMP1 (Figure 3C) or rVV-S65L (Figure 3D) was abrogated by exposure to chloroquine, while antigen processing in the context of MHC class I was unaffected (not shown). To assess Id-specific CD8+ T-cell responses, 25 × 106 splenocytes were stimulated with 1 × 106 38C13 cells irradiated with 30 cGy. After 4 days, CD8 effectors were positively selected and recultured for an additional 24 hours in medium supplemented with 25 IU/mL human recombinant IL-2. At day 5, CD8+-selected cells were evaluated for cytotoxic activity by measuring lysis of the 38C13 cell line. All animals vaccinated with Id-based vaccines developed a tumor-specific lytic response (Figure 3D), whereas animals vaccinated with the irrelevant rVV failed to lyse 38C13. Id-specific lysis was significantly higher by cells from Id-LAMP1–vaccinated mice than from mice vaccinated with Id. The syngeneic isotype-matched CH27 cell line, which expresses a different idiotype, was not lysed, documenting specificity of the Id response (Figure 3E). Thus, Id-specific CD4+ and CD8+ T-cell responses were elicited by a vaccine expressing a modified Id in mature DCs. The magnitudes of CD8+ and more significantly of CD4+ T-cell responses were significantly enhanced if the antigen was targeted to the lysosomal/endosomal compartment.

Figure 3.

Induction of a Id-specific CD4+ and CD8+ responses by Id-LAMP1 vaccine. Mice were vaccinated once with 0.3 × 106 mature DCs infected with rVV-Id (▴), rVV-Id-LAMP1 (▪), and rVV-S65L (○) as negative control. Fourteen days after vaccination, mice were killed, and splenocytes were stimulated with irradiated 38C13 tumor cells. After 8 days of culture, CD4+ effectors were selected and tested in a 72-hour proliferation assay using as stimulators DCs transfected with mRNAs coding for Id-LAMP1 (A) and S65L (B) or DCs treated (solid line) or untreated (dashed line) with chloroquine and infected with rVV-Id-LAMP1 (C) or rVV-S65L (D). At 5 days of culture, a cytotoxicity assay was performed using as effectors CD8+-selected T cells and as targets the 38C13 (E) or the irrelevant CH27 (F) cell lines.

Figure 3.

Induction of a Id-specific CD4+ and CD8+ responses by Id-LAMP1 vaccine. Mice were vaccinated once with 0.3 × 106 mature DCs infected with rVV-Id (▴), rVV-Id-LAMP1 (▪), and rVV-S65L (○) as negative control. Fourteen days after vaccination, mice were killed, and splenocytes were stimulated with irradiated 38C13 tumor cells. After 8 days of culture, CD4+ effectors were selected and tested in a 72-hour proliferation assay using as stimulators DCs transfected with mRNAs coding for Id-LAMP1 (A) and S65L (B) or DCs treated (solid line) or untreated (dashed line) with chloroquine and infected with rVV-Id-LAMP1 (C) or rVV-S65L (D). At 5 days of culture, a cytotoxicity assay was performed using as effectors CD8+-selected T cells and as targets the 38C13 (E) or the irrelevant CH27 (F) cell lines.

Immune responses elicited by mature DCs infected with rVV-Id and rVV-Id-LAMP1 protect from tumor growth

To determine whether the immune responses elicited by this vaccine were able to protect animals from tumor development, groups of 12 mice were vaccinated with mature DCs infected with rVV-Id, rVV-Id-LAMP1, and rVV-S65L, as previously described. Fourteen days after vaccination, mice were challenged with 1000 viable 38C13 cells subcutaneously and followed for survival and tumor growth. Animals with tumors larger than 10 mm were killed, in accordance with our institutional guidelines. All animals vaccinated with the control S65L vaccine developed progressive tumors, requiring killing within 25 days of tumor challenge (Figure 4). In mice vaccinated with the Id-based vaccine 35% survived tumor free for 60 days. By contrast, all mice vaccinated with the Id-LAMP1–based vaccine demonstrated delayed tumor growth and prolonged survival, with 73% being tumor free at 60 days. Protection in animals vaccinated with DCs infected with rVV-Id-LAMP1 was significantly higher than in animals vaccinated with DCs infected with rVV-Id (P < .05) and in animals vaccinated with DCs infected with rVV-S65L (P < .001).

Figure 4.

Protection from tumor challenge of mice vaccinated with mature DCs infected with rVV-Id or rVV-Id-LAMP1. Mice were vaccinated once with 0.3 × 106 DCs infected with rVV-Id (▴), rVV-Id-LAMP1 (▪), and rVV-S65L (○) as negative control. After 14 days, mice were challenged with 1000 viable 38C13 tumor cells subcutaneously and followed for survival.

Figure 4.

Protection from tumor challenge of mice vaccinated with mature DCs infected with rVV-Id or rVV-Id-LAMP1. Mice were vaccinated once with 0.3 × 106 DCs infected with rVV-Id (▴), rVV-Id-LAMP1 (▪), and rVV-S65L (○) as negative control. After 14 days, mice were challenged with 1000 viable 38C13 tumor cells subcutaneously and followed for survival.

Adoptively transferred Id-specific CD8+ T cells cure mice with an established tumor

To directly evaluate the therapeutic role of the Id-specific T cells elicited by our vaccines and to identify which T-cell subset is required in the effector phase of the immune response to an established 38C13 tumor, we performed adoptive transfer experiments with Id-specific T cells in tumor-bearing mice. Mice were first challenged with 1000 viable 38C13 tumor cells subcutaneously. After 7 days, mice received cyclophosphamide (50 mg/kg) to reduce tumor burden and delay tumor growth.17  Forty-eight hours later, T cells from mice previously vaccinated with Id-LAMP1 or S65L vaccines were isolated as described in “Materials and methods,” and 6 × 106 CD4+ or 6 × 106 CD8+, or 6 × 106 CD4+ + 6 × 106 CD8+ T cells/mouse were adoptively transferred into tumor-bearing mice (Figure 5). Eighty percent of animals that received CD4+ and CD8+ T lymphocytes and 60% of animals that received only CD8+ T cells obtained from mice vaccinated with Id-LAMP1–based vaccines were completely cured and remained tumor free for up to 60 days, while none of the mice adoptively transferred with only CD4+ T cells survived tumor free (P < .05). T cells obtained from animals vaccinated with control S65L-based vaccines demonstrated no antitumor activity. These results demonstrate that Id-specific CD8+ T cells, in the absence of B cells, play a crucial role in the control of this lymphoma. Although CD4+ T cells exhibited no significant therapeutic activity alone, cotransfer of CD4+ T cells with CD8+ T cells enhanced the activity of the CD8+ T cells, suggesting either a helper effect or some direct antitumor activity against this MHC class II- tumor.

Figure 5.

Adoptively transferred Id-specific CD8+ T cells cure mice with an established tumor. Mice were vaccinated once with 0.3 × 106 DCs infected with rVV-Id-LAMP1 and rVV-S65L as negative control. Fourteen days after vaccination, mice were killed, and spleens and lymph nodes were harvested, pooled within each group, and depleted of B cells, and CD4 and CD8 cells were positively selected. Mice were injected with 1000 38C13 viable tumor cells subcutaneously (day 0), and 7 days later they received cyclophosphamide as described in “Materials and methods.” Immune T cells were transferred intravenously at day 9 after tumor challenge, and mice were followed for survival and tumor growth. * indicates 38C13; ×, CTX (cyclophosphamides); ▴, rVV-Id-LAMP1 CD4; ⬡, rVV-Id-LAMP CD8; ▪, rVV-Id-LAMP1 CD4 + CD8; ▪, rVV-S65L CD4; ○, rVV-S65L CD8; and ▪, rVV-S65L CD4 + CD8.

Figure 5.

Adoptively transferred Id-specific CD8+ T cells cure mice with an established tumor. Mice were vaccinated once with 0.3 × 106 DCs infected with rVV-Id-LAMP1 and rVV-S65L as negative control. Fourteen days after vaccination, mice were killed, and spleens and lymph nodes were harvested, pooled within each group, and depleted of B cells, and CD4 and CD8 cells were positively selected. Mice were injected with 1000 38C13 viable tumor cells subcutaneously (day 0), and 7 days later they received cyclophosphamide as described in “Materials and methods.” Immune T cells were transferred intravenously at day 9 after tumor challenge, and mice were followed for survival and tumor growth. * indicates 38C13; ×, CTX (cyclophosphamides); ▴, rVV-Id-LAMP1 CD4; ⬡, rVV-Id-LAMP CD8; ▪, rVV-Id-LAMP1 CD4 + CD8; ▪, rVV-S65L CD4; ○, rVV-S65L CD8; and ▪, rVV-S65L CD4 + CD8.

Beneficial role of CD4+ T cells in the priming phase of the Id-specific immune response

To evaluate the role of CD4+ and CD8+ T cells in the priming phase of the Id-specific immune response, mice were depleted with anti-CD4 and/or anti-CD8 antibodies at days -3, -1, +2, and +5, as described in “Material and methods.” Mice were vaccinated at day 0 with mature DCs infected with rVV-Id-LAMP1, the irrelevant rVV-S65L, or with rVV-Id. Since we previously showed that rVV-Id fails to induce Id-specific CD4+ cells, analysis of antitumor response in this group of mice was used to discriminate the potential role of Id-specific CD4+ T cells (induced only by LAMP1-based vaccines) and CD4+ cells specific for vaccinia-derived epitopes (induced both by Id-LAMP1 and Id vaccines) that might be providing help in the induction of an effective immune response to 38C13. Fourteen days after vaccination, mice were challenged with 1000 viable 38C13 tumor cells subcutaneously and followed for survival. Before vaccination (day 0) and before tumor challenge (day 14) blood samples were collected, and the efficacy of T-cell depletion (> 99% in both cases) was confirmed by flow cytometry. Mice depleted of both CD4+ and CD8+ T cells or depleted of only CD8+ cells developed progressive tumor within 12 to 13 days (Figure 6A), confirming that CD8+ T cells are crucial for protection from tumor growth. In the group of Id-LAMP1–vaccinated mice, 73% of nondepleted mice survived tumor free for 60 days as compared with only 33% tumor-free survivors in CD4+-depleted mice, suggesting that CD4+ T cells likely play an important role in the priming phase of the immune response. This finding was further supported by analysis of mice vaccinated with rVV-Id (Figure 6B), in which no significant difference in tumor-free survival was observed between the group of nondepleted mice and mice depleted of CD4+ cells (tumor-free survival of 28% and 17%, respectively, at 60 days). Moreover, depletion of CD4+ T cells mitigated the protective advantage of the Id-LAMP1 vaccine compared with the Id vaccine (tumor-free survival of 33% versus 20%). Thus Id-specific CD4+ T cells appear to play a beneficial role in the induction phase of an effective immune response to this lymphoma.

Figure 6.

Critical role of CD4+ T cells in the priming phase of the Id-specific immune response. Mice were depleted with 300 μL anti-CD4 (▪), anti-CD8 (▾), or anti-CD4 + anti-CD8 mAbs (⬡) at days -3, -1, +2, and +5 relative to vaccination (day 0) with 0.3 × 106 DCs infected with rVV-Id-LAMP1 (A), rVV-Id (B), or rVV-S65L (*). indicates nondepleted mice. At day 14, mice were challenged with 1000 38C13 viable tumor cells subcutaneously and followed for survival.

Figure 6.

Critical role of CD4+ T cells in the priming phase of the Id-specific immune response. Mice were depleted with 300 μL anti-CD4 (▪), anti-CD8 (▾), or anti-CD4 + anti-CD8 mAbs (⬡) at days -3, -1, +2, and +5 relative to vaccination (day 0) with 0.3 × 106 DCs infected with rVV-Id-LAMP1 (A), rVV-Id (B), or rVV-S65L (*). indicates nondepleted mice. At day 14, mice were challenged with 1000 38C13 viable tumor cells subcutaneously and followed for survival.

Discussion

Results demonstrate that protective CD4+ and CD8+ T-cell responses to a lymphoma idiotype can be induced by immunization with DCs expressing a modified antigen. In the past decade, the treatment of NHL has dramatically changed with the use of monoclonal antibodies, particularly, anti-CD20.52  Although clearly highly effective, passive mAb therapy usually induces transient responses, suggesting the need to incorporate additional therapeutic strategies.53  One potentially attractive approach has been to induce T-cell responses to the lymphoma, since the cellular arm of the immune system remains largely intact during the B-cell depletion associated with anti-CD20 therapy. Since each B-cell lymphoma expresses an accessible individually unique tumor antigen encoded by the idiotype, current vaccine trials for NHL have attempted to enhance T-cell anti-Id–specific immune responses. This goal has been complicated by the difficulty in isolating candidate MHC class I–binding epitopes in the complementarity-determining regions (CDRs) or in mutated framework region (FWR) from the different idiotypes. However, published data strongly suggest that T-cell responses can be elicited to human lymphoma idiotypes.27,54-57  A variety of approaches are currently being explored, including vaccination with recombinant Id proteins, Id-encoding adenoviruses, Id-pulsed DCs, and DNA vaccination.7-9,37,54  Most of these strategies have been tested in the 38C13 model, a challenging and potentially predictive model for immunotherapy of NHL.2,46,47,55  Although Id-specific CD8+ and/or CD4+ T-cell responses have been elicited in different lymphoma models.58,59  Direct evidence of Id-specific T cells has been difficult to reveal in the 38C13 model.55,60  In this study, we show that, with appropriate antigen presentation, Id-specific CD4+ and CD8+ T cells can be induced in the 38C13 model. Several strategies were used to enhance immunogenicity, including expression of the Id protein directly in mature dendritic cells by way of recombinant vaccinia viruses, and the use of the sorting signal of LAMP1 to directly target the introduced idiotype protein into the endosomal-lysosomal compartment to facilitate MHC class II antigen processing.

The ability of an attached LAMP1 cytoplasmic tail to promote intracellular class II processing of an endogenously expressed protein has been described by several groups examining several different antigens. Lin et al45  initially demonstrated the role of the lysosomal-targeting sequence with the E7 antigen of the human papilloma virus in enhancing class II presentation, and Rowell et al61  reported similar results with the HIV-1 envelope protein. We also previously published studies demonstrating that it is possible to induce simultaneous stimulation of CMV-specific CD4+ and CD8+ T-cell responses by fusing LAMP1 with the immunodominant pp65 protein from CMV.40  Alternative targeting sequences, such as the invariant chain-targeting signal, have also been shown to promote MHC class II antigen processing of endogenously expressed proteins. However, Bonehill et al62  recently showed that the LAMP1 sequence is more effective than the invariant chain-targeting signal for stimulating a CD4 T-cell response to the tumor antigen melanoma-associated antigen 3 (MAGE3). All together these data document the efficiency of the LAMP1 sequence in enhancing antigen presentation in the context of MHC class II molecules. Effective induction of T-cell responses requires that the antigen be presented by mature rather than immature DCs, which is likely not entirely achieved with many in vivo antigen delivery systems unless the antigen is provided directly in mature DCs.38,39  In accordance with observations we previously made with human DCs,40  murine mature DCs infected in vitro with rVV were found to maintain a functional mature phenotype. Thus, rVV infection of mature DCs maximizes antigen processing and presentation by the most potent antigen-presenting cells. Mature DCs infected with rVV-Id-LAMP1 were found to efficiently present Id-derived epitopes in the context of both MHC II and MHC I, inducing both CD4+ and CD8+ Id-specific T responses after only one round of vaccination. The Id-LAMP1 fusion vaccine was both qualitatively and quantitatively better than the Id vaccine, not only eliciting stronger CD8+ responses but also uniquely inducing CD4+ responses to the Id protein. The enhanced MHC class II processing and induction of CD4 responses represented the desired goal of the introduction of targeting sequences, but the increased level of Id-specific CD8+ responses induced by Id-LAMP1 was less expected. Potentially, this result could reflect an indirect consequence of the increased CD4+ helper response and/or a direct consequence of increased protein instability and degradation for the class I pathway from improper folding due to the fusion.40  The separate contribution of the 38C13 VH and VL regions in the induction of the Id-specific immune response is still a matter of investigation. Initial experiments performed with mice vaccinated with DCs expressing only Sig-HA1-VL-LAMP1 or Sig-VH-HA1-LAMP1 suggest that VH epitopes are targets of CD8+ effectors, while VL epitopes are required for the generation of a CD4+ response (not shown). Accordingly, search for candidate H2-Kk–binding peptides, performed by the BioInformatics and Molecular Analysis Section (BIMAS, Bethesda, MD) software revealed a predicted epitope for the VH region. The isolation of relevant epitopes for cellular immune responses will be important steps for the future. Results of this study have provided the unique opportunity to evaluate and dissect the role of Id-specific CD4+ and CD8+ T cells in 38C13 tumor control. Indirect evidence of antitumor T-cell activity was provided by the correlation between the stronger cellular response and protection from tumor growth observed in animals vaccinated with the Id-LAMP1 compared with animals vaccinated with Id. To dissect the role of Id-specific CD4+ and CD8+ T cells, we performed 2 different sets of experiments. Adoptive transfer experiments demonstrated that CD8+ Id-specific T cells are the critical cells for the effector phase of the response, and depletion experiments demonstrated that Id-specific CD4+ T cells contribute during the induction phase of immune response. It is intriguing to note that CD4+ depletion did not prevent activation of Id-specific CD8+ cells in our model. This may be secondary to the use of mature DCs, licensed antigen-presenting cells able to bypass the need for CD4+ T cells for the generation a primary CD8+ response.63-65  Since most B-NHLs are MHC II+, Id-specific CD4+ T cells might be expected to play a potentially more important direct effector role in this clinical setting than observed in the 38C13 model. Tumor protection and cure were obtained in a high proportion of mice compared with results already reported in the 38C13 model,55,66  suggesting that a strong T-cell response may significantly improve the treatment of NHL.

Prepublished online as Blood First Edition Paper, January 13, 2005; DOI 10.1182/blood-2004-07-2890.

Supported in part by a postdoctoral fellowship from the Cancer Research Institute (C.B.), the Italian Health Ministry, the Italian Association for Cancer Research (AIRC), the National Institutes of Health National Cancer Institute (CA33084, CA18029), and the Leukemia and Lymphoma Society (7040).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

We thank David Maloney, Anna Mondino, and Catia Traversari for helpful discussion.

1
Miller RA, Maloney DG, Warnke R, Levy R. Treatment of B-cell lymphoma with monoclonal anti-idiotype antibody.
N Engl J Med
.
1982
;
306
:
517
-522.
2
Campbell MJ, Carroll W, Kon S, et al. Idiotype vaccination against murine B cell lymphoma. Humoral and cellular responses elicited by tumor-derived immunoglobulin M and its molecular subunits.
J Immunol
.
1987
;
139
:
2825
-2833.
3
George AJT, Folkard SG, Hamblin TJ, Stevenson FK. Idiotypic vaccination as a treatment for a B cell lymphoma.
J Immunol
.
1988
;
141
:
2168
-2174.
4
Chakrabarti D, Ghosh SK. Induction of syngeneic cytotoxic T lymphocytes against a B cell tumor, II: characterization of anti-idiotypic CTL lines and clones.
Cell Immunol
.
1992
;
144
:
443
-454.
5
Cao W, Myers-Powell BA, Braciale TJ. Recognition of an immunoglobulin VH epitope by influenza virus-specific Class I major histocompatibility complex-restricted cytolytic T lymphocytes.
J Exp Med
.
1994
;
179
:
195
-202.
6
Abe A, Emi N, Taji H, Kasai M, Kohno A, Saito H. Induction of humoral and cellular anti-idiotypic immunity by intradermal injection of naked DNA encoding a human variable region gene sequence of an immunoglobulin heavy chain in a B cell malignancy.
Gene Ther
.
1996
;
3
:
988
-993.
7
Osterroth F, Garbe A, Fisch P, Veelken H. Stimulation of cytotoxic T cells against idiotype immunoglobulin of malignant lymphoma with protein-pulsed or idiotype-transduced dendritic cells.
Blood
.
2000
;
95
:
1342
-1349.
8
Kwak LW, Campbell MJ, Czerwinski D, Hart S, Miller RA, Levy R. Induction of immune response in patients with B-cell lymphoma against the surface-immunoglobulin idiotype expressed by their tumors.
N Engl J Med
.
1992
;
327
:
1209
-1215.
9
Hsu FJ, Benike C, Fagnoni F, et al. Vaccination of patients with B-cell lymphoma using autologous antigen-pulsed dendritic cells.
Nat Med
.
1996
;
2
:
52
-58.
10
Lauritzen G, Weiss S, Dembic Z, Bogen B. Naive idiotype-specific CD4+ T cells and immunosurveillance of B-cell tumors.
Proc Natl Acad Sci U S A
.
1994
;
91
:
5700
-5704.
11
Ruffini PA, Neelapu SS, Kwak LW, Biragyn A. Idiotypic vaccination for B-cell malignancies as a model for therapeutic cancer vaccines: from prototype protein to second generation vaccines.
Haematologica
.
2002
;
87
:
989
-1001.
12
McCarthy H, Ottensmeier CH, Hamblin TJ, Stevenson FK. Anti-idiotype vaccines.
Br J Haematol
.
2003
;
123
:
770
-781.
13
Maloney DG, Brown S, Czerwinski DK, et al. Monoclonal anti-idiotype antibody therapy of B-cell lymphoma: the addition of a short course of chemotherapy does not interfere with the antitumor effect nor prevent the emergence of idiotype-negative variant cells.
Blood
.
1992
;
80
:
1502
-1510.
14
Brown SL, Miller RA, Horning SJ, et al. Treatment of B-cell lymphoma with anti-adiotype antibodies alone and in combination with alpha interferon.
Blood
.
1989
;
73
:
651
-661.
15
Clearly ML, Meeker TC, Levy S, et al. Clustering of extensive somatic mutations in the variable region of an immunoglobulin heavy chain gene from a human B cell lymphoma.
Cell
.
1986
;
44
:
97
-106.
16
Meeker T, Lowder J, Clearly ML, et al. Emergence of idiotype variants during treatment of B-cell lymphoma with anti-idiotype antibodies.
N Engl J Med
.
1985
;
312
:
1658
-1665.
17
Campbell MJ, Esserman L, Levy R. Immunotherapy of established murine B cell lymphoma.
J Immunol
.
1988
;
141
:
3227
-3233.
18
Rosenberg SA. A new era of cancer immunotherapy: converting theory to performance.
CA Cancer J Clin
.
1999
;
49
:
70
-73, 65.
19
Melief CJ, Kast WM. T-cell immunotherapy of tumors by adoptive transfer of cytotoxic T lymphocytes and by vaccination with minimal essential epitopes.
Immunol Rev
.
1995
;
145
:
167
-177.
20
Yee C, Thompson JA, Byrd D, et al. Adoptive T cell therapy using antigen-specific CD8+ T cell clones for the treatment of patients with metastatic melanoma: in vivo persistence, migration, and antitumor effect of transferred T cells.
Proc Natl Acad Sci U S A
.
2002
;
99
:
16168
-16173.
21
Dudley ME, Wunderlich JR, Robbins PF, et al. Cancer regression and autoimmunity in patients after clonal repopulation with antitumor lymphocytes.
Science
.
2002
;
298
:
850
-854.
22
Melief CJ. Tumor eradication by adoptive transfer of cytotoxic T lymphocytes.
Adv Cancer Res
.
1992
;
58
:
143
-175.
23
Riddell SR, Watanabe KS, Goodrich JM, Li CR, Agha ME, Greenberg PD. Restoration of viral immunity in immunodeficient humans by adoptive transfer of T cell clones.
Science
.
1992
;
257
:
238
-241.
24
Greenberg PD. Adoptive T cell therapy of tumors: mechanisms operative in the recognition and elimination of tumor cells.
Adv Immunol
.
1991
;
49
:
281
-355.
25
Shu S, Rosenberg SA. Adoptive immunotherapy of a newly induced sarcoma: immunologic characteristics of effector cells.
J Immunol
.
1985
;
135
:
2895
-2903.
26
Greenberg PD. Therapy of murine leukemia with cyclophosphamide and immune Lyt-2 cells: cytolytic T cells can mediate eradication of disseminated leukemia.
J Immunol
.
1986
;
136
:
1917
-1922.
27
Timmerman JM, Czerwinski DK, Davis TA, et al. Idiotype-pulsed dendritic cell vaccination for B-cell lymphoma: clinical and immune responses in 35 patients.
Blood
.
2002
;
99
:
1517
-1526.
28
Kronenberger K, Dieckmann A, Selmayr M, et al. Impact of the lymphoma idiotype on in vivo tumor protection in a vaccination model based on targeting antigens to antigen-presenting cells.
Blood
.
2002
;
99
:
1327
-1331.
29
Chen HW, Lee YP, Chung YF, et al. Inducing long-term survival with lasting anti-tumor immunity in treating B cell lymphoma by a combined dendritic cell-based and hydrodynamic plasmid-encoding IL-12 gene therapy.
Int Immunol
.
2003
;
15
:
427
-435.
30
Greenberg PD, Kern DE, Cheever MA. Therapy of disseminated murine leukemia with cyclophosphamide and immune Lyt-1+,2-T cells. Tumor eradication does not require participation of cytotoxic T cells.
J Exp Med
.
1985
;
161
:
1122
-1134.
31
Kennedy RC, Shearer MH, Watts AM, Bright RK. CD4+ T lymphocytes play a critical role in anti-body production and tumor immunity against simian virus 40 large tumor antigen.
Cancer Res
.
2003
;
63
:
1040
-1045.
32
Spellerberg MB, Zhu D, Thompsett A, King CA, Hamblin TJ, Stevenson FK. DNA vaccines against lymphoma: promotion of anti-idiotypic antibody responses induced by single chain Fv genes by fusion to tetanus toxin fragment C.
J Immunol
.
1997
;
159
:
1885
-1892.
33
Syrengelas AD, Chen TT, Levy R. DNA immunization induces protective immunity against B-cell lymphoma.
Nat Med
.
1996
;
2
:
1038
-1041.
34
Hakim I, Levy S, Levy R. A nine-amino acid peptide from IL-1B augments antitumor immune responses induced by protein and DNA vaccines.
J Immunol
.
1996
;
157
:
5503
-5511.
35
Chen TT, Tao MH, Levy R. Idiotype-cytokine fusion proteins as cancer vaccines.
J Immunol
.
1994
;
153
:
4775
-4787.
36
Tao H, Levy R. Idiotype/granulocyte-macrophage colony-stimulating factor fusion protein as a vaccine for B-cell lymphoma.
Nature
.
1993
;
362
:
755
-758.
37
Bendandi M, Gocke CD, Kobrin CB, et al. Complete molecular remissions induced by patient-specific vaccination plus granulocyte-monocyte colony-stimulating factor against lymphoma.
Nat Med
.
1999
;
5
:
1171
-1177.
38
Fong L, Engleman EG. Dendritic cells in cancer immunotherapy.
Annu Rev Immunol
.
2000
;
18
:
245
-273.
39
Banchereau J, Steinman RM. Dendritic cells and the control of immunity.
Nature
.
1998
;
392
:
245
-252.
40
Bonini C, Lee SP, Riddell SR, Greenberg PD. Targeting antigen in mature dendritic cells for simultaneous stimulation of CD4+ and CD8+ T cells.
J Immunol
.
2001
;
166
:
5250
-5257.
41
Lewis V, Green SA, Marsh M, Vihko P, Helenius A, Mellman I. Glycoproteins of the lysosomal membrane.
J Cell Biol
.
1985
;
100
:
1839
-1847.
42
Chen WF, Murphy TL, Willingham MC, Pastan I, August JT. Identification of two lysosomal membrane glycoproteins.
J Cell Biol
.
1985
;
101
:
85
-95.
43
Chen JW, Cha Y, Yuksel KU, Gracy RW, August JT. Isolation and sequencing of a cDNA clone encoding lysosomal.
J Biol Chem
.
1988
;
263
:
8754
-8758.
44
Fukuda M, Viitala J, Matteson J, Carlsson R. Cloning of cDNAs encoding human lysosomal membrane glycoproteins h-lamp-1 and h-lamp-2.
J Biol Chem
.
1988
;
263
:
18920
-19928.
45
Lin KY, Guarnieri FG, Staveley-O'Carroll KF, et al. Treatment of established tumors with a novel vaccine that enhances major histocompatibility class II presentation of tumor antigen.
Cancer Res
.
1996
;
56
:
21
-26.
46
Bergman Y, Haimovich J. Characterization of a carcinogen-induced murine B lymphocyte cell line of C3H/eB origin.
Eur J Immunol
.
1977
;
7
:
413
-417.
47
Levy R, Warnke R, Dorfman RF, Haimovich J. The monoclonality of human B-cell lymphomas.
J Exp Med
.
1977
;
145
:
1014
-1028.
48
Boczkowski D, Nair SK, Snyder D, Gilboa E. Dendritic cells pulsed with RNA are potent antigen-presenting cells in vitro and in vivo.
J Exp Med
.
1996
;
184
:
465
-472.
49
Engelmayer J, Larsson M, Subklewe M, et al. Vaccinia virus inhibits the maturation of human dendritic cells: a novel mechanism of immune evasion.
J Immunol
.
1999
;
163
:
6762
-6768.
50
Camporeale A, Boni A, Iezzi G, et al. Critical impact of the kinetics of dendritic cells activation on the in vivo induction of tumor-specific T lymphocytes.
Cancer Res
.
2003
;
63
:
3688
-3694.
51
Inaba K, Turley S, Yamaide F, et al. Efficient presentation of phagocytosed cellular fragments on the major histocompatibility complex class II products of dendritic cells.
J Exp Med
.
1998
;
188
:
2163
-2173.
52
Maloney DG, Liles TM, Czerwinski DK, et al. Phase I clinical trial using escalating single-dose infusion of chimeric anti-CD20 monoclonal antibody (IDEC-C2B8) in patients with recurrent B-cell lymphoma.
Blood
.
1994
;
84
:
2457
-2466.
53
Cheson BD. Rituximab: clinical development and future directions.
Expert Opin Biol Ther
.
2002
;
2
:
97
-110.
54
Stevenson FK. Idiotypic DNA vaccines against B-cell lymphoma.
Immunol Rev
.
1995
;
145
:
211
-228.
55
Timmerman JM, Caspar CB, Lambert SL, Syrengelas AD, Levy R. Idiotype-encoding recombinant adenoviruses provide protective immunity against murine B-cell lymphomas.
Blood
.
2001
;
97
:
1370
-1377.
56
Timmerman JM, Singh G, Hermanson G, et al. Immunogenicity of a plasmid DNA vaccine encoding chimeric idiotype in patients with B-cell lymphoma.
Cancer Res
.
2002
;
62
:
5845
-5852.
57
Heslop H, Stevenson FK, Molldrem JJ. Immunotherapy of hematologic malignancy.
Rev Hematol
.
2003
;:
331
-349.
58
Flamand V, Sornasse T, Thielemans K, et al. Murine dendritic cells pulsed in vitro with tumor antigen induce tumor resistance in vivo.
Eur J Immunol
.
1994
;
24
:
605
-610.
59
Dembic Z, Schenck K, Bogen B. Dendritic cells purified from myeloma are primed with tumor-specific antigen (idiotype) and activate CD4+ T cells.
Proc Natl Acad Sci U S A
.
2000
;
97
:
2697
-2702.
60
Syrengelas AD, Levy R. DNA vaccination against the idiotype of a murine B cell lymphoma: mechanism of tumor protection.
J Immunol
.
1999
;
162
:
4790
-4795.
61
Rowell J, Ruff A, Guarnieri FG, et al. Lysosomal-associated-membrane-protein-1 mediated targeting of the HIV envelope protein to an endosomal/lysosomal compartment enhances its presentation to MHC class II-restricted T cells.
J Immunol
.
1995
;
155
:
1818
-1828.
62
Bonehill A, Heirman C, Tuyaerts S, et al. Messenger RNA-electroporated dendritic cells presenting MAGE-A3 simultaneously in HLA class I and Class II molecules.
J Immunol
.
2004
;
172
:
6649
-6657.
63
Janssen EM, Lemmens EE, Wolfe T, Christen U, von Herrath MG, Schoenberger SP. CD4+ T cells are required for a secondary expansion and memory in CD8+ T lymphocytes.
Nature
.
2003
;
421
:
852
-855.
64
Shedlock DJ, Shen H. Requirement for CD4 T cell help in generating functional CD8 T cell memory.
Science
.
2003
;
300
:
337
-339.
65
Sun JC, Bevan MJ. Defective CD8 T cell memory following acute infection without CD4 T cell help.
Science
.
2003
;
300
:
339
-342.
66
Kwak LW, Young HA, Pennington RW, Weeks SD. Vaccination with syngeneic, lymphoma-derived immunoglobulin idiotype combined with granulocyte/macrophage colony-stimulating factor primes mice for a protective T-cell response.
Proc Natl Acad Sci U S A
.
1996
;
93
:
10972
-10977.