Juvenile hemochromatosis is an early-onset form of iron storage disease characterized by hypogonadotrophic hypogonadism and cardiomyopathy. Recently, the putative causative gene (LOC148738) encoding a protein designated hemojuvelin was cloned. The previously proposed designation of this gene as HFE2 is contrary to established convention, because it is not a member of the HFE family. We suggest that it be designated HJV. We sequenced this gene in members of 2 previously reported kinships that manifest typical juvenile hemochromatosis. In one kinship, 2 previously undescribed mutations of HJV were identified, c.238T>C (C80R) and c.302T>C (L101P). In the second kinship, 2 previously identified mutations, G320V and I222N, were found. These studies confirm that mutations in HJV cause juvenile hemochromatosis. (Blood. 2004;103:4669-4671)

The first description of what is now designated as juvenile hemochromatosis was published in 1932 by Bezançon et al.1  Their patient, age 20 years, was described as having pigmentary cirrhosis with an enlarged liver, infantilism, and multiple endocrine insufficiencies. He died of cardiac failure.

Those findings correspond closely to the syndrome as described more recently.2  Hypogonadotrophic hypogonadism and cardiac failure, not only an early age of onset of iron overload, distinguish this disorder clinically from the much more common type of hemochromatosis that results from mutations of the HFE gene. Most cases of juvenile hemochromatosis were found to be genetically linked to chromosome 1q.3-6  However, a few patients with the same syndrome did not have this linkage and were shown to have mutations of the HAMP gene encoding hepcidin.7 

Because no gene known to regulate iron homeostasis was known to exist on chromosome 1q, this putative juvenile hemochromatosis gene became a prime target for positional cloning. Very recently, the putative gene responsible for the Ch1q-linked form of the disorder was cloned. It encodes a transcription unit of previously unknown function (LOC148738) that has been designated hemojuvelin.8  The suggested designation of the gene encoding hemojuvelin, namely HFE2, is inappropriate because it is contrary to the accepted guidelines for gene nomenclature.9  The use of an Arabic numeral is recommended for designation of a gene family, but the gene encoding hemojuvelin is not a part of the HFE family. Thus, a more appropriate designation for this gene is HJV, which has been adopted by Online Mendelian Inheritance in Man (OMIM).

We previously described 7 cases of juvenile hemochromatosis in 2 kinships, including one that had originally been reported in 1962.4  We have now sequenced the HJV gene of these patients with early-onset iron overload. We confirm that, indeed, mutations of this gene are responsible for the syndrome of juvenile hemochromatosis in most patients. We report the existence of 2 mutations of the HJV gene that have not been previously described and define the haplotypes in which they occur.

Study subjects

We evaluated persons in each of 2 unrelated kinships from the southeast United States; all were white. In kinship A, we previously reported 4 siblings with a juvenile hemochromatosis clinical phenotype4  and demonstrated that they were homozygous for the same Ch1q haplotype. The third of the 4 siblings, an 18-year-old woman who had amenorrhea since age 12, was selected for the present genetic analyses. At diagnosis, she had transferrin saturation 92%, serum ferritin 2003 μg/L, severe hypogonadotrophic hypogonadism, hepatomegaly, and hyperpigmentation. We also evaluated her father's cousin, one of the original 1967 probands who presented at age 23 years with amenorrhea, severe hypogonadism, and transferrin saturation 96% and had phlebotomy-proven iron overload.4,10  This woman had one Ch1q haplotype apparently identical with that of her younger first cousin once removed and a second, different Ch1q haplotype, and we had presumed her to be a compound heterozygote for the Ch1q-linked gene. In kinship B, we evaluated the parents of a woman who died at age 23 years of cardiomyopathy and was discovered at autopsy to have severe, multiorgan iron overload and hepatic cirrhosis. At age 17 years, she experienced cessation of menses and later developed other signs of severe hypogonadism and hyperpigmentation.4  The clinical characteristics of these patients are summarized in Table 1. Approval was obtained from the Scripps Research Institutional Review Board and from the Brookwood Medical Center Institutional Review Board for these studies. Informed consent was provided according to the Declaration of Helsinki.

Table 1.

Characteristics at diagnosis of patients with juvenile hemochromatosis



Kinship, case number

A, II-5
A, II-6
A, III-1
A, III-2
A, III-3
A, III-6
B, II-3
HJV genotype   C80R/L101P   C80R/L101P   L101P/L101P   L101P/L101P   L101P/L101P   L101P/L101P   I222N/G320V  
Age at diagnosis, y/sex   23/F   21/F   23/F   21/M   18/F   8/F   23/F  
Age at first objective symptoms, y   18   17   13   15   12   —   17  
Serum iron, μM   49.4   58.2   47.1   42.1   46   49.6   39.0  
Transferrin saturation, %   96   98   90   97   92   90   85  
Serum ferritin, μg/L   ND   ND   2647   4425   2003   1047   ND  
Hypogonadotrophic hypogonadism   Yes   Yes   Yes   Yes   Yes   No   Yes  
Cardiomyopathy   No   No   No   Yes   No   No   Yes  
Hepatomegaly   Yes   Yes   Yes   Yes   Yes   Yes   Yes  
Hepatic cirrhosis on biopsy
 
No
 
No
 
ND
 
Yes
 
ND
 
ND
 
Yes
 


Kinship, case number

A, II-5
A, II-6
A, III-1
A, III-2
A, III-3
A, III-6
B, II-3
HJV genotype   C80R/L101P   C80R/L101P   L101P/L101P   L101P/L101P   L101P/L101P   L101P/L101P   I222N/G320V  
Age at diagnosis, y/sex   23/F   21/F   23/F   21/M   18/F   8/F   23/F  
Age at first objective symptoms, y   18   17   13   15   12   —   17  
Serum iron, μM   49.4   58.2   47.1   42.1   46   49.6   39.0  
Transferrin saturation, %   96   98   90   97   92   90   85  
Serum ferritin, μg/L   ND   ND   2647   4425   2003   1047   ND  
Hypogonadotrophic hypogonadism   Yes   Yes   Yes   Yes   Yes   No   Yes  
Cardiomyopathy   No   No   No   Yes   No   No   Yes  
Hepatomegaly   Yes   Yes   Yes   Yes   Yes   Yes   Yes  
Hepatic cirrhosis on biopsy
 
No
 
No
 
ND
 
Yes
 
ND
 
ND
 
Yes
 

The characteristics are based on an earlier publication.4 —indicates not known; and ND, not done.

Methods

The primers used to amplify the HJV gene are shown in Table 2. Amplification was performed in a 50-μL reaction mix containing 50 to 200 ng genomic DNA, 150 ng of each primer, 33.5 mM Tris (tris(hydroxymethyl)aminomethane) HCl pH 8.8, 8.3 mM (NH3)2SO4, 3.35 mM MgCl2, 85 μg/mL bovine serum albumin, and 1 U Taq polymerase. After initial denaturation at 95°C for 4 minutes, amplification was performed for 30 cycles at 95°C for 1 minute, 60°C for 30 seconds, and 72°C for 30 to 50 seconds.

Table 2.

Primers used for amplification of the HJV coding region


HJV

Primer sequence

Fragment size, bp
HJ Ex 1 F   GTACTCTGGCCAGCCATATACT   286  
HJ Ex 1 R   CGAGAGACATCCAAGTAGGTGT   
HJ Ex 2 F   ATCTCCCCAAATTCCAGTCTG   359  
HJ Ex 2 R   ACATAGCAGCCTACCCTCTAG   
HJ Ex 3 F   GCAAACTACACTCCGATAGAG   669  
HJ Ex 3 R   GAATCTCATGAGGTGGATCGG   
HJ Ex 4A F   TAGTCCTGCATCTCTACTTGG   394  
HJ Ex 4A R   TGCAGGTCCTGTTCAGCTG   
HJ Ex 4B F   ATGGAGGTGACCGACCTGG   374  
HJ Ex 4B R   AGCTGCCACGGTAAAGTTGG   
HJ Ex 4C F   GCTCTCCTTCTCCATCAAGG   430  
HJ Ex 4C R   AAACTAGTAATGGGACTGATGG   
HJ Ex 4D F   TGTGGGCTCTTTGTTCTGTG   407  
HJ Ex 4D R   GTCTTCTGCTTTCAGCTCTTG   
HJ Ex 4E F   ATAAGTTTAGAGGTCATGAAGG   404  
HJ Ex 4E R
 
GCCCTCTTTCAGTGGAGTG
 

 

HJV

Primer sequence

Fragment size, bp
HJ Ex 1 F   GTACTCTGGCCAGCCATATACT   286  
HJ Ex 1 R   CGAGAGACATCCAAGTAGGTGT   
HJ Ex 2 F   ATCTCCCCAAATTCCAGTCTG   359  
HJ Ex 2 R   ACATAGCAGCCTACCCTCTAG   
HJ Ex 3 F   GCAAACTACACTCCGATAGAG   669  
HJ Ex 3 R   GAATCTCATGAGGTGGATCGG   
HJ Ex 4A F   TAGTCCTGCATCTCTACTTGG   394  
HJ Ex 4A R   TGCAGGTCCTGTTCAGCTG   
HJ Ex 4B F   ATGGAGGTGACCGACCTGG   374  
HJ Ex 4B R   AGCTGCCACGGTAAAGTTGG   
HJ Ex 4C F   GCTCTCCTTCTCCATCAAGG   430  
HJ Ex 4C R   AAACTAGTAATGGGACTGATGG   
HJ Ex 4D F   TGTGGGCTCTTTGTTCTGTG   407  
HJ Ex 4D R   GTCTTCTGCTTTCAGCTCTTG   
HJ Ex 4E F   ATAAGTTTAGAGGTCATGAAGG   404  
HJ Ex 4E R
 
GCCCTCTTTCAGTGGAGTG
 

 

The primers and conditions for the amplification of the HFE gene11  and the hepcidin gene12  were as described previously. The region around the HJV gene contained single nucleotide polymorphisms and microsatellites that were useful for haplotyping the subjects. The primers and annealing temperatures for haplotype analysis are described in the supplementary material available at the Blood website (see the Supplemental Tables link at the top of the online article). Amplification was performed using the polymerase chain reaction (PCR) conditions described earlier.

Amplified DNA products were purified by using Qiaquick PCR purification kits (Qiagen, Valencia, CA). Genotypes were determined by direct sequencing using the ABI 3100 DNA sequencer (Applied Biosystems, Foster City, CA).

The pedigrees and the result of mutation analysis of the 2 kinships are shown in Figures 1 and 2. Subject II-5 from kinship A was a compound heterozygote with c.238T>C (C80R) and c.302T>C (L101P) mutations in the hemojuvelin gene. Subject III-2 in kinship A was, as expected from the chromosome 1q haplotype that had been determined earlier, homozygous for a hemojuvelin mutation, L101P. The C80R and L101P mutations have not been reported previously. The haplotypes in which they were found are defined as a series of single nucleotide polymorphisms (SNPs) in the region surrounding the HJV gene and are summarized in the Supplemental Tables. A large number of genes in the region of the HJV gene were sequenced in subject II-5 and/or subject III-3. No mutations were found. The genes that were examined are listed in the Supplemental Tables.

Figure 1.

Abbreviated pedigree of Carolinas kinship A with juvenile hemochromatosis (JH). JH patients II-5 and II-6 were described in a previous report.9  Arrows designate JH index cases in respective sibships. Ages (in years) are those at time of manuscript preparation (or death); clinical and laboratory findings reflect observations at the time of diagnosis of JH patients or evaluation of corresponding family members. Tf sat indicates serum transferrin saturation; Ftn, serum ferritin concentration. Determined alleles of HFE and HJV are displayed without parentheses, deduced genotypes within parentheses. The arrows designate the subjects used for DNA analysis.

Figure 1.

Abbreviated pedigree of Carolinas kinship A with juvenile hemochromatosis (JH). JH patients II-5 and II-6 were described in a previous report.9  Arrows designate JH index cases in respective sibships. Ages (in years) are those at time of manuscript preparation (or death); clinical and laboratory findings reflect observations at the time of diagnosis of JH patients or evaluation of corresponding family members. Tf sat indicates serum transferrin saturation; Ftn, serum ferritin concentration. Determined alleles of HFE and HJV are displayed without parentheses, deduced genotypes within parentheses. The arrows designate the subjects used for DNA analysis.

Close modal
Figure 2.

Pedigree of Alabama kinship B with JH. Arrow designates JH index case. Ages (in years) are those at time of manuscript preparation (or death); clinical and laboratory findings reflect observations at the time of diagnosis of JH patients or evaluation of corresponding family members. Tf sat indicates serum transferrin saturation; Ftn, serum ferritin concentration. Determined alleles of HFE and HJV are displayed without parentheses, deduced genotypes within parentheses. The arrows designate the subjects used for DNA analysis.

Figure 2.

Pedigree of Alabama kinship B with JH. Arrow designates JH index case. Ages (in years) are those at time of manuscript preparation (or death); clinical and laboratory findings reflect observations at the time of diagnosis of JH patients or evaluation of corresponding family members. Tf sat indicates serum transferrin saturation; Ftn, serum ferritin concentration. Determined alleles of HFE and HJV are displayed without parentheses, deduced genotypes within parentheses. The arrows designate the subjects used for DNA analysis.

Close modal

Subjects I-1 and I-2 from kinship B were the parents of a woman who died at age 23 of putative juvenile hemochromatosis.4  Subject I-1 was a simple heterozygote carrying the c.959G>T (G320V) mutation in the HJV gene. Subject I-2 was a simple heterozygote carrying the c.665T>A (I222N) mutation in the HJV gene. Both the G320V and the I222N mutations have been described previously.8  The deceased subject II-1 from kinship B is, therefore, presumed to be a compound heterozygote carrying both mutations in the HJV gene.

The results of these investigations confirm the assignment of the gene causing chromosome 1q-linked juvenile hemochromatosis. In 2 families manifesting the typical clinical picture of this disorder, mutations were found in the HJV gene. The heterogeneity of the HJV mutations and Ch1q haplotypes demonstrated in the present kinships and in those previously reported4,5,8  are typical of rare heritable disorders. Most patients with juvenile hemochromatosis are diagnosed younger than age 30 years and have hypogonadism, hepatic fibrosis, or cirrhosis, or cardiomyopathy.8,13-15  However, some patients, their siblings, or other affected members with juvenile hemochromatosis have fewer complications of iron overload at diagnosis. This observation suggests that, although age of onset may influence the phenotype, juvenile hemochromatosis appears to have unique features, especially endocrinopathies (hypogonadotrophic hypogonadism) and cardiomyopathy. These complications may be the result of age-dependent organ susceptibility to iron, unusually high levels of non-transferrin-bound iron, tissue-specific iron deposition, transport or avidity, or other peculiarities of the mutations themselves. It is clear from kinship A, in which 4 siblings are affected, that the penetrance of HJV mutations is very high, in contrast with hemochromatosis associated with HFE mutations.

Although the appearance of the disease phenotype in 2 successive generations might have suggested dominant inheritance with low penetrance, genetic analysis makes it clear that the inheritance is autosomal recessive, and that the pattern observed represents pseudodominance. Such pseudodominant inheritance is common when the disease gene frequencies are high. For example, it was once believed that Gaucher disease was a dominant disorder,16  but it is now clear that the apparent dominance was due to the mating of heterozygotes with a homozygotes in a population in which about 7% were heterozygous. Pseudodominance must be much less common in the case of rare mutations such as those of hemojuvelin.

Prepublished online as Blood First Edition Paper, February 24, 2004; DOI 10.1182/blood-2004-01-0072.

Supported by National Institutes of Health grants DK53505-04 and RR00833, the Stein Endowment Fund, and the Southern Iron Disorders Center.

The online version of the article contains a data supplement.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

The technical assistance of Mrs Terri Gelbart and Mrs Carol Halloran is gratefully acknowledged.

1
Bezançon F, De Gennes L, Delarue J, Oumensky V. Cirrhose pigmentaire avec infantilisme, insuffisance cardiaque et aplasies endocriniennes multiples.
Bull Mem Soc Med Hop Paris
.
1932
;
48
:
967
-974.
2
De Gobbi M, Roetto A, Piperno A, et al. Natural history of juvenile haemochromatosis.
Br J Haematol
.
2002
;
117
:
973
-979.
3
Roetto A, Totaro A, Cazzola M, et al. Juvenile hemochromatosis locus maps to chromosome 1q.
Am J Hum Genet
.
1999
;
64
:
1388
-1393.
4
Barton JC, Rao SV, Pereira NM, et al. Juvenile hemochromatosis in the Southeastern United States: a report of seven cases in two kinships.
Blood Cells Mol Dis
.
2002
;
29
:
104
-115.
5
Papanikolaou G, Politou M, Roetto A, et al. Linkage to chromosome 1q in Greek families with juvenile hemochromatosis.
Blood Cells Mol Dis
.
2001
;
27
:
744
-749.
6
Rivard SR, Lanzara C, Grimard D, et al. Juvenile hemochromatosis locus maps to chromosome 1q in a French Canadian population.
Eur J Hum Genet
.
2003
;
11
:
585
-589.
7
Roetto A, Papanikolaou G, Politou M, et al. Mutant antimicrobial peptide hepcidin is associated with severe juvenile hemochromatosis.
Nat Genet
.
2003
;
33
:
21
-22.
8
Papanikolaou G, Samuels ME, Ludwig EH, et al. Mutations in HFE2 cause iron overload in chromosome 1q-linked juvenile hemochromatosis.
Nat Genet
.
2004
;
36
:
77
-82.
9
Wain HM, Bruford EA, Lovering RC, Lush MJ, Wright MW, Povey S. Guidelines for human gene nomenclature.
Genomics
.
2002
;
79
:
464
-470.
10
Felts JH, Nelson JR, Herndon CN, Spurr CL. Hemochromatosis in two young sisters. Case studies and a family survey.
Ann Intern Med
.
1967
;
67
:
117
-123.
11
Feder JN, Gnirke A, Thomas W, et al. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis.
Nat Genet
.
1996
;
13
:
399
-408.
12
Lee PL, Gelbart T, West C, Halloran C, Felitti V, Beutler E. A study of genes that may modulate the expression of hereditary hemochromatosis: transferrin receptor-1, ferroportin, ceruloplasmin, ferritin light and heavy chains, iron regulatory proteins (IRP)-1 and -2, and hepcidin.
Blood Cells Mol Dis
.
2001
;
27
:
783
-802.
13
Kaltwasser JP. Juvenile hemochromatosis. In: Barton JC, Edwards CQ, eds. Hemochromatosis.
Genetics, Pathophysiology, Diagnosis, and Treatment
. New York: Cambridge University Press;
2000
:
318
-325.
14
Lamon JM, Marynick SP, Roseblatt R, Donnelly S. Idiopathic hemochromatosis in a young female. A case study and review of the syndrome in young people.
Gastroenterology
.
1979
;
76
:
178
-183.
15
Papanikolaou G, Papaioannou M, Politou M, et al. Genetic heterogeneity underlies juvenile hemochromatosis phenotype: analysis of three families of northern Greek origin.
Blood Cells Mol Dis
.
2002
;
29
:
168
-173.
16
Groen J. The hereditary mechanism of Gaucher's disease.
Blood
.
1948
;
3
:
1238
-1249.

Sign in via your Institution