Primary cutaneous lymphomas (PCLs) represent a heterogeneous group of extranodal T- and B-cell malignancies. The underlying molecular pathogenesis of this malignancy remains unclear. This study aimed to characterize oncogene abnormalities in PCLs. Using genomic microarray, we detected oncogene copy number gains of RAF1(3p25), CTSB (8p22), PAK1 (11q13), and JUNB (19p13) in 5 of 7 cases of mycosis fungoides (MF)/Sezary syndrome (SS) (71%), gains of FGFR1 (8p11), PTPN (20q13), andBCR (22q11) in 4 cases (57%), and gains ofMYCL1 (1p34), PIK3CA (3q26), HRAS(11p15), MYBL2 (20q13), and ZNF217 (20q13) in 3 cases (43%). Amplification of JUNB was studied in 104 DNA samples from 78 PCL cases using real-time polymerase chain reaction. Twenty-four percent of cases, including 7 of 10 cases of primary cutaneous CD30+ anaplastic large-cell lymphoma (C-ALCL), 4 of 14 MF, 4 of 22 SS, and 2 of 23 primary cutaneous B-cell lymphoma (PCBCL) showed amplification ofJUNB, and high-level amplification of this oncogene was present in 3 C-ALCL and 2 MF cases. JUNB protein expression was analyzed in tissue sections from 69 PCL cases, and 44% of cases, consisting of 21 of 23 SS, 6 of 8 C-ALCL, 5 of 10 MF, and 9 of 21 PCBCL, demonstrated nuclear expression of JUNB by tumor cells. Overexpression of JUNB also was detected in 5 C-ALCL and 2 SS cases. These results have revealed, for the first time, amplification and expression patterns of JUNB in PCL, suggesting thatJUNB may be critical in the pathogenesis of primary cutaneous T-cell lymphomas.

Introduction

Primary cutaneous lymphomas (PCLs) represent a heterogeneous group of extranodal T- and B-cell malignancies with an annual incidence of 0.5-1 per 100 000.1-3 This group of lymphomas has been classified into mycosis fungoides (MF)/Sezary syndrome (SS), accounting for 70% of PCL cases, primary cutaneous B-cell lymphoma (PCBCL), constituting more than 20% of cases, primary cutaneous CD30+ anaplastic large cell lymphoma (C-ALCL), constituting 10% of cases, and blastic natural killer cell lymphoma (NK), accounting for 1% of cases.1-3 These subtypes of PCL have distinctive clinicopathologic and immunophenotypic features.1-3 However, the underlying etiology and pathogenesis remains unclear.

Most malignancies accumulate a series of genetic events including activation of oncogenes and loss of tumor suppressor genes, which lead to a malignant phenotype. Previous studies have shown allelic losses at 9p, 10q, and 17p; microsatellite instability and mutations ofp53 in primary cutaneous T-cell lymphomas (CTCLs);4-6 and hypermethylation of p15 andp16 in both CTCL and PCBCL.7,8 However, little is known about genome-wide genetic alterations in PCL. We have studied a series of PCL cases using comparative genomic hybridization (CGH) and have identified consistent and distinctive patterns of chromosomal imbalances (CI) in both MF and SS and in PCBCL.9,10Genomic microarray is a novel technique of genomic analysis used to rapidly screen for genomic imbalances (GI) in a tumor genome.11 Previous studies have revealed oncogene copy number changes in several epithelial cancers.11-14 We also have detected oncogene gains and losses in PCBCLs using this technique,10 but at present there is no data available in CTCLs.

The aim of this study was to screen for oncogene abnormalities in PCLs. We began with a study of 7 cases of MF/SS using genomic microarray, which showed gains of several oncogenes, including JUNB. We then analyzed 104 DNA samples from 78 PCL patients for JUNBamplification using real-time–polymerase chain reaction (RT-PCR) and correlated these findings with the results of immunohistochemistry (IHC) analysis of formalin-fixed, paraffin-embedded tissue sections from 69 PCL cases.

Materials and methods

Samples

Initially, 7 cases of MF/SS with noticeable CI detected by CGH9 were selected for genomic microarray study (Table1). This included 5 SS (nos. 1 [sample 1524], 3 [1650], 4 [1530], 5 [1278], and 23 [2211]) and 2 MF (nos. 25 [1416] and 32 [1536]) cases (Table 1). Subsequently, 104 DNA samples from 78 patients with PCL, consisting of 41 samples from 22 SS cases, 14 MF samples, 16 samples from 10 C-ALCL cases, 23 PCBCL samples, 7 cutaneous blastic NK cell lymphoma samples, 2 systemic follicular lymphoma (FL) samples, and 1 lymphomatoid papulosis (LyP) sample were selected for RT-PCR study according to specific clinicopathologic features, immunophenotypes, and T-cell receptor/immunoglobulin gene analysis (Table2).2,3 In addition, formalin-fixed, paraffin-embedded tissue sections from 69 of 78 PCL cases analyzed by RT-PCR (23 SS, 10 MF, 8 C-ALCL, 21 PCBCL, 4 cutaneous NK cell lymphoma, 2 systemic FL, and 1 LyP) were selected for IHC study (Table 2). This project was approved by the St Thomas' Hospital Research Ethics Committee for sampling (EC02/089).

Table 1.

A summary of genomic microarray findings in 7 MF/SS cases

Gene Location Case (sample) 
1 (1524) 3 (1650) 4 (1530) 5 (1278) 23 (2211) 25 (1416) 32 (1536) 
FGR 1p36 − − 
MYCL1 1p34 − 
NRAS 1p13 
LAMC2 1q25 − 
NMYC 2p24 − 
REL 2p13 
RAF1 3p25 
TERC 3q26 − 
PIK3CA 3q26 
PDGFRA 4q12 
MYB 6q22 
ESR 6q25 
EGFR 7p12 − 
PGY1 7q21 − 
MET 7q31 − − 
CTSB 8p22 
FGFR1 8p11 
MOS 8q11 − − 
MYC 8q24 
ABL1 9q34 − − 
FGFR2 10q26 
HRAS 11p15 
CCND1 11q13 − − 
FGF4 11q13 − 
EMS1 11q13 − 
GARP 11q13 − − − 
PAK1 11q13 
MLL 11q23 − − 
CCND2 12p13 
KRAS2 12p12 
WNT1 12q12 − 
GLI 12q13 
SAS 12q13 − 
MDM2 12q14 
AKT1 14q32 − − 
IGFR1 15q25 
FES 15q26 − 
MRP1 16p13 
TOP2A 17q2 − 
ERBB2 17q21 − 
RPS6KB1 17q23 − 
D17S1670 17q23 − 
YES1 18p11 
BCL23′ 18q21 
BCL25′ 18q21 − 
INSR 19p13 
JUNB 19p13 
CCNE1 19q13 
AIB1 20q12 
STK15 20q13 − 
CSE1L 20q13 
MYBL2 20q13 
PTPN1 20q13 
ZNF217 20q13 
CBFA2 21q22 
BCR 22q11 
PDGFB 22q12 
AR5′ Xq11 
AR3′ Xq11 
Gene Location Case (sample) 
1 (1524) 3 (1650) 4 (1530) 5 (1278) 23 (2211) 25 (1416) 32 (1536) 
FGR 1p36 − − 
MYCL1 1p34 − 
NRAS 1p13 
LAMC2 1q25 − 
NMYC 2p24 − 
REL 2p13 
RAF1 3p25 
TERC 3q26 − 
PIK3CA 3q26 
PDGFRA 4q12 
MYB 6q22 
ESR 6q25 
EGFR 7p12 − 
PGY1 7q21 − 
MET 7q31 − − 
CTSB 8p22 
FGFR1 8p11 
MOS 8q11 − − 
MYC 8q24 
ABL1 9q34 − − 
FGFR2 10q26 
HRAS 11p15 
CCND1 11q13 − − 
FGF4 11q13 − 
EMS1 11q13 − 
GARP 11q13 − − − 
PAK1 11q13 
MLL 11q23 − − 
CCND2 12p13 
KRAS2 12p12 
WNT1 12q12 − 
GLI 12q13 
SAS 12q13 − 
MDM2 12q14 
AKT1 14q32 − − 
IGFR1 15q25 
FES 15q26 − 
MRP1 16p13 
TOP2A 17q2 − 
ERBB2 17q21 − 
RPS6KB1 17q23 − 
D17S1670 17q23 − 
YES1 18p11 
BCL23′ 18q21 
BCL25′ 18q21 − 
INSR 19p13 
JUNB 19p13 
CCNE1 19q13 
AIB1 20q12 
STK15 20q13 − 
CSE1L 20q13 
MYBL2 20q13 
PTPN1 20q13 
ZNF217 20q13 
CBFA2 21q22 
BCR 22q11 
PDGFB 22q12 
AR5′ Xq11 
AR3′ Xq11 

n indicates normal (balanced); −, copy number loss; and +, copy number gain.

Table 2.

A summary of RT-PCR and IHC analyses of JUNB in PCL

Case Sample* Diagnosis RT-PCR* IHC 
Staining Large cells (%) Positive large cells (%)2-153 
1524s/1525b SS 20 50 
1528b SS +++ 10 100 
4011/1650b SS +++ 10 100 
1530s/1603l SS ++ 10 80 
1277s/1278b SS ++ ++ 10 90 
1124s SS n/a ++ 40 90 
1378b SS ++ 20 60 
1598s/702b SS ++ ++ 70 70 
16041/1586b SS 50 50 
10 548s/546b SS − − − 
11 2135s/2131b SS ++ 40 80 
12 1711s/17461/1712b SS 10 50 
13 1900s/2530b SS 10 50 
14 2061s/2062b SS − 10 − 
15 2707s/2708b SS ++ 40 75 
16 2652s/2651b SS 10 
17 2335s/2329b SS ++ 20 60 
16 2724s/2725b SS ++ 20 60 
19 2559s SS 20 40 
20 2729s/2728b SS 30 50 
21 2718s/2719b SS 10 50 
22 2720s/2721b SS 20 40 
23 2211b SS ++ 10 80 
24 1484I MF − − 10 − 
25 1416s MF 20 20 
26 1445b MF − − − 
27 1975s MF − − − 
28 1394b MF − − − 
29 650I MF 10 
30 688s MF 10 10 
31 1487s MF +++ ++ 25 60 
32 1536s MF 10 50 
33 1587s MF ++++ n/a n/a n/a 
34 2609I MF − − − 
35 1348s MF n/a n/a n/a 
36 1375s MF n/a n/a n/a 
37 143s MF n/a n/a n/a 
38 1455s C-ALCL +++ +++ 100 100 
39 2624s/2626b C-ALCL ++++ +++ 60 100 
40 2092s/2095b C-ALCL +++ 100 100 
41 2267b/1358b C-ALCL ++ ++ 20 90 
42 2065s C-ALCL +++ +++ 80 100 
43 1281s/1282I C-ALCL ++ +++ 90 100 
44 sk273 C-ALCL − − − 
45 1950s C-ALCL − − − 
46 SK46s/SK47s C-ALCL ++ n/a n/a n/a 
47 SK40s/SK44s C-ALCL n/a n/a n/a 
48 302s LyP − − − 
49 142s DLCL − − − 
50 1233b/1234s DLCL − 10 − 
51 613b DLCL 60 
52 419s DLCL − − − 
53 1662s DLCL 10 50 
54 1993s DLCL − 20 − 
55 1201s MZL 10 40 
56 sk311s MZL 50 
57 1533s MZL − − − 
58 227s MZL − 10 − 
59 1848s MZL − − − 
60 1794b MZL − 10 − 
61 1797s MZL − 10 − 
62 928s MZL 10 10 
63 1475s MZL n/a n/a n/a 
64 258s Immunocytoma − − − 
65 1728s FCCL 50 
66 423s FCCL − − 10 − 
67 2047s FCCL − 10 − 
68 2075s FCCL ++ 30 60 
69 2198s FCCL ++ 20 90 
70 1943b Unclassified 10 10 
71 1648b Systemic FL 10 10 
72 1564b Systemic FL − 10 − 
73 1683s NK − − − 
74 18021i NK 50 
75 2022s NK 20 20 
76 2412s NK − 60 − 
77 1860s NK n/a n/a n/a 
78 1231s NK n/a n/a n/a 
79 2634b NK − n/a n/a n/a 
Case Sample* Diagnosis RT-PCR* IHC 
Staining Large cells (%) Positive large cells (%)2-153 
1524s/1525b SS 20 50 
1528b SS +++ 10 100 
4011/1650b SS +++ 10 100 
1530s/1603l SS ++ 10 80 
1277s/1278b SS ++ ++ 10 90 
1124s SS n/a ++ 40 90 
1378b SS ++ 20 60 
1598s/702b SS ++ ++ 70 70 
16041/1586b SS 50 50 
10 548s/546b SS − − − 
11 2135s/2131b SS ++ 40 80 
12 1711s/17461/1712b SS 10 50 
13 1900s/2530b SS 10 50 
14 2061s/2062b SS − 10 − 
15 2707s/2708b SS ++ 40 75 
16 2652s/2651b SS 10 
17 2335s/2329b SS ++ 20 60 
16 2724s/2725b SS ++ 20 60 
19 2559s SS 20 40 
20 2729s/2728b SS 30 50 
21 2718s/2719b SS 10 50 
22 2720s/2721b SS 20 40 
23 2211b SS ++ 10 80 
24 1484I MF − − 10 − 
25 1416s MF 20 20 
26 1445b MF − − − 
27 1975s MF − − − 
28 1394b MF − − − 
29 650I MF 10 
30 688s MF 10 10 
31 1487s MF +++ ++ 25 60 
32 1536s MF 10 50 
33 1587s MF ++++ n/a n/a n/a 
34 2609I MF − − − 
35 1348s MF n/a n/a n/a 
36 1375s MF n/a n/a n/a 
37 143s MF n/a n/a n/a 
38 1455s C-ALCL +++ +++ 100 100 
39 2624s/2626b C-ALCL ++++ +++ 60 100 
40 2092s/2095b C-ALCL +++ 100 100 
41 2267b/1358b C-ALCL ++ ++ 20 90 
42 2065s C-ALCL +++ +++ 80 100 
43 1281s/1282I C-ALCL ++ +++ 90 100 
44 sk273 C-ALCL − − − 
45 1950s C-ALCL − − − 
46 SK46s/SK47s C-ALCL ++ n/a n/a n/a 
47 SK40s/SK44s C-ALCL n/a n/a n/a 
48 302s LyP − − − 
49 142s DLCL − − − 
50 1233b/1234s DLCL − 10 − 
51 613b DLCL 60 
52 419s DLCL − − − 
53 1662s DLCL 10 50 
54 1993s DLCL − 20 − 
55 1201s MZL 10 40 
56 sk311s MZL 50 
57 1533s MZL − − − 
58 227s MZL − 10 − 
59 1848s MZL − − − 
60 1794b MZL − 10 − 
61 1797s MZL − 10 − 
62 928s MZL 10 10 
63 1475s MZL n/a n/a n/a 
64 258s Immunocytoma − − − 
65 1728s FCCL 50 
66 423s FCCL − − 10 − 
67 2047s FCCL − 10 − 
68 2075s FCCL ++ 30 60 
69 2198s FCCL ++ 20 90 
70 1943b Unclassified 10 10 
71 1648b Systemic FL 10 10 
72 1564b Systemic FL − 10 − 
73 1683s NK − − − 
74 18021i NK 50 
75 2022s NK 20 20 
76 2412s NK − 60 − 
77 1860s NK n/a n/a n/a 
78 1231s NK n/a n/a n/a 
79 2634b NK − n/a n/a n/a 

s indicates skin lesion; b, blood; l, lymph nodes; SS, Sezary syndrome; MF, mycosis fungoides; C-ALCL, primary cutaneous CD30+ anaplastic large cell lymphoma; LyP, lymphomatoid papulosis; DLCL, diffuse large cell lymphoma; MZL, marginal zone lymphoma; FCCL, follicle center cell lymphoma; unclassified, unclassified lymphoma; systemic FL, systemic follicular lymphoma; NK, natural killer cell lymphoma; n, N value <2 (normal); n/a, not available; +, N value >2; ++, N value >4; +++, N value >8; and ++++, N value >16.

*

indicates N value < 0.5.

indicates negative staining.

Proportion of large atypical cells in total dermal infiltrate; −, no large cell.

F2-153

Proportion of large atypical cells with positive staining; −, no positive large cell.

Genomic microarray

This experiment was conducted as previously described.10 After probe labeling, hybridization, and posthybridization washes, fluorescent images of the hybridized microarray chips, AmpliOnc I DNA array (Vysis, Downers Grove, IL), which contains 59 clones from 57 oncogenes (BCL2 andAR are represented by both 5′ and 3′ genomic clones) representing genomic regions that have been reported to be amplified in human tumors (Vysis, Downers Grove, IL) were captured and analyzed using the GenoSensor Reader System (Vysis). The fluorescence ratio thresholds for gains and losses of oncogene copy number were set according to our control experiments using test and reference DNA from healthy individuals and lymphoma patients.10 Thus, ratios equivalent to 1 ± 0.2 were set as the level for disomy (normal gene copy number), whereas ratios > 1.25 represented trisomy (gain of gene copy number), and ratios < 0.75 were indicative of monosomy (loss of gene copy number).10 

RT-PCR

To further confirm amplification of JUNB in PCL, RT-PCR studies were performed. This experiment, based on the TaqMan assay,15 was carried out using the ABI Prism 7700 Sequence Detector System (ABI/Perkin Elmer, Foster City, CA) as previously reported.10,16 Primer and TaqMan probe sequences were designed using the Primer Express version 1.0 software (ABI/Perkin Elmer) and GenBank sequence numbers were M29039, M12523, and M17987 for JUNB, ALB, and B2M, respectively, with the following primer sequences: JUNB: forward CTACGGGATACGGCCGG, reverse AGGCTCGGTTTCAGGAGTTTG, ALB: forward AGGGTAAAGAGTCGTCGATATGCT, reverse CAATCTCAACCCACTGTCAGCTA,B2M: forward GGAATTGATTTGGGAGAGCATC, reverse CAGGTCCTGGCTCTACAATTTACTAA.

The TaqMan probes were JUNB: 5′-(FAM)-CCCCTGGTGGCCTCTCTCTACACGACTA-(TAMRA)-3′, ALB: 5′-(FAM)-CAAACGCATCCATTCTACCAACTTGAGCAT-(TAMRA)-3′, B2M: 5′-(FAM)-AGTGTGACTGGGCAGATCATCCACCTTC-(TAMRA)-3′.

PCR mixes (25 μL) contained 12.5 μL of 2 × TaqMan Universal PCR master mix, 2.5 μL of each primer, and 2.5 μL of TaqMan probe with 1 to 2.5 μL of DNA. The Universal master mix contains ROX (6-carboxy-X-rhodamine), the passive reference fluorochrome that normalizes for pipetting volume errors. Thermal cycling consisted of 2 minutes at 50°C, 10 minutes at 95°C, followed by 40 cycles at 95°C for 15 seconds, and 60°C for 1 minute. Each assay included a “no template” control and a standard curve for JUNB,ALB, and B2M produced by normal placental DNA, and all were carried out in triplicate (96-well maximum). The parameter CT is defined as the fractional cycle number at which the fluorescence generated by cleavage of the probe passes a fixed threshold above baseline. The target gene copy number (JUNB)is quantified by measuring CT and by using a standard curve to determine the starting copy number. The ratio of the target gene copy number to the reference gene copy number normalizes the amount and quality of genomic DNA. The ratio defining the level of increased copy number of the target gene was termed as “N” and was determined as follows: n = copy number of target gene/copy number of reference gene. An N value > 2 was set for gene amplification (+), > 4 (++), > 8 (+++), and > 16 (++++) (Table 2).10,15,16An N value < 0.5 was regarded as decreased copy number (Table 2).

IHC

To further investigate the expression pattern of JUNB in PCL, immunohistochemical studies were performed using the DAKO ChemMate horseradish peroxidase system and DAKO DAB substrate system according to the supplier's instruction (DAKO, Carpinteria, CA).17Briefly, deparaffinized tissue sections were first treated with 3% H2O2 for 10 minutes to inhibit endogenous peroxidase and then microwaved at 700 watts for 18 minutes in 0.01 M sodium citrate buffer solution (pH 6.0) for 30 minutes. After a series of washes, the sections were incubated with primary mouse monoclonal antibody against JUNB (C-11: sc-8051) (Santa Cruz Biotechnology, Santa Cruz, CA) at room temperature for 1 hour at a final antibody concentration of 2 μg/mL diluted in blocking serum solution. After further incubation with universal biotinylated link antibody and peroxidase-labeled streptavidin, the reaction was developed with DAB substrate-chromogen solution for 10 minutes, followed by counterstaining with Harris hematoxylin. To test the specific reactivity of antibody with JUNB, C-11, paraffin sections from colorectal adenocarcinoma, keratosis, and normal lymph nodes (5 samples each) were initially stained with C-11 and an antibody of nonhuman reactive rabbit IgG (Santa Cruz Biotechnology), which was used as the negative control. All colorectal adenocarcinomas and epidermal basal and suprabasal keratinocytes in keratosis showed strong nuclear JUNB expression as previously reported.17,18 However, 5 normal lymph nodes had negative staining for JUNB. In addition, all the samples tested were negative staining for the nonhuman reactive rabbit IgG. To further exclude false-positive and false-negative results in each experiment, a positive control consisting of a colorectal adenocarcinoma and epidermal basal and suprabasal keratinocytes in each sample with known expression of JUNB and a negative control consisting of the rabbit IgG and normal lymph nodes without expression of this oncoprotein were used. The slides were analyzed for the proportion of tumor cells showing nuclear positivity. The level of JUNB expression was qualitatively defined as (+) when 5%-45% of tumor cells were positive, (++) when 50%-90% of tumor cells were positive, and (+++) when 100% of tumor cells were positive.19 

Results

Genomic microarray

All 7 MF/SS cases studied showed GI (100%). Oncogene copy number gains of RAF1 (3p25), CTSB(8p22), PAK1 (11q13), andJUNB (19p13) were identified in 5 cases (71%), gains ofFGFR1 (8p11), PTPN (20q13),and BCR (22q11) in 4 cases (57%), gains of MYCL1(1p34), PIK3CA (3q26), HRAS(11p15), MYBL2 (20q13), andZNF217 (20q13) in 3 cases (43%), and gains ofKRAS2 (12p12), GLI (12q13), IGFR1 (15q25), FES (15q26),and YES1 (18p11) in 2 cases (29%) (Table 1) (Figure1). Two female patients showed gains ofAR5′ and AR3′ as evidence for hybridization efficiency. There was a similar pattern of GI in SS and MF (Table 1) (Figure 1).

Fig. 1.

Illustration of an analyzed chart of the AmpliOnc microarray chip hybridized with the DNA sample from a patient with an SS patient (case 5, sample 1278).

The x-axis lists all informative oncogene probes and the y-axis represents the detected fluorescence ratio changes of tumor (T) against reference (R). The T/R ratio of JUNB (arrow) was beyond the threshold of 1.25 indicating gains of these oncogenes.

Fig. 1.

Illustration of an analyzed chart of the AmpliOnc microarray chip hybridized with the DNA sample from a patient with an SS patient (case 5, sample 1278).

The x-axis lists all informative oncogene probes and the y-axis represents the detected fluorescence ratio changes of tumor (T) against reference (R). The T/R ratio of JUNB (arrow) was beyond the threshold of 1.25 indicating gains of these oncogenes.

RT-PCR

Of 78 PCL cases analyzed with RT-PCR, 19 cases showed amplification of JUNB (24%) (Table 2). This included 7 C-ALCL (70%), 4 MF (29%), 4 SS (18%), 2 PCBCL (9%), 1 NK cell lymphoma (14%), and 1 systemic FL (50%). High-level amplification ofJUNB (+++) was present in 3 C-ALCL (30%) and 2 MF cases (14%) (Table 2). Decreased copy number of JUNB also was seen in 1 MF, 1 FCCL, and 1 NK cell lymphoma each (Table 2). When multiple samples such as blood and skin lesions from the same individual were analyzed, results were consistent. Three cases (nos. 5, 20, 21) showing gain of JUNB detected with genomic microarray also revealed amplification of JUNB using RT-PCR, but case 1 had gain of JUNB by genomic microarray without RT-PCR evidence of amplification of JUNB (Table 2).

IHC

Of 69 PCLs analyzed by IHC, 44 cases showed nuclear JUNB expression in a proportion of tumor cells (64%) (Table 2). This included 21 (91%) of 23 SS, 6 (75%) of 8 C-ALCL, 5 (50%) of 10 MF, 9 (43%) of 21 PCBCL, 2 (50%) of 4 NK cell lymphoma, and 1 (50%) of 2 systemic FL (Table 2). Seven cases (10%) revealed expression of JUNB by all tumor cells (+++) (overexpression), including 5 C-ALCL (63%) and 2 SS cases (9%) (Table 2; Figures2-3). Epidermal basal and suprabasal keratinocytes also expressed JUNB, which represented a useful internal control to indicate the efficiency of immunohistochemistry (Figure 2). All the positively stained PCBCL cases showed only occasional cells expressing JUNB (+) (Table 2), and in this case it is difficult to conclusively establish whether expression is restricted to tumor cells or activated B cells on morphology.

Fig. 2.

Illustration of IHC staining of JUNB in an SS patient (case 8).

This photograph (original magnification × 40) revealed strong nuclear expression of JUNB by large epidermotropic tumor cells with absent expression in small dermal mononuclear cells. Epidermal basal keratinocytes also expressed JUNB, representing a useful internal control.

Fig. 2.

Illustration of IHC staining of JUNB in an SS patient (case 8).

This photograph (original magnification × 40) revealed strong nuclear expression of JUNB by large epidermotropic tumor cells with absent expression in small dermal mononuclear cells. Epidermal basal keratinocytes also expressed JUNB, representing a useful internal control.

Fig. 3.

Illustration of IHC staining of JUNB in a C-ALCL patient (case 38).

This photograph (original magnification × 40) showed strong nuclear expression of JUNB by large anaplastic cells with no expression by small reactive lymphocytes.

Fig. 3.

Illustration of IHC staining of JUNB in a C-ALCL patient (case 38).

This photograph (original magnification × 40) showed strong nuclear expression of JUNB by large anaplastic cells with no expression by small reactive lymphocytes.

There was a striking concordance between the results of RT-PCR and IHC (Table 2). Fifteen cases (6 C-ALCL, 4 SS, 2 MF, 2 PCBCL, and 1 systemic FL) with amplification of JUNB identified by RT-PCR also showed expression of JUNB by tumor cells (Table 2). In addition, 25 cases (12 PCBCL, 5 MF, 2 SS, 2 C-ALCL, 2 NK cell lymphoma, 1 systemic FL, and 1 LyP) without amplification of JUNB did not express JUNB protein by tumor cells (Table 2).

Discussion

This genomic microarray study of CTCL variants has shown a global picture of oncogene copy number changes in MF and SS. Seventy-one percent of cases revealed gains of JUNB, RAF1,CTSB, and PAK1, and 57% demonstrated gains ofFGFR1, PTPN, and BCR. In addition, a consistent pattern of GI was present in SS and MF, supporting our previous hypothesis that both SS and MF represent part of a spectrum of the same disease as suggested by a similar pattern of CI detected by CGH.9 In contrast, these results are different from our previous observations in PCBCL,10 which is consistent with a different pathogenesis. RT-PCR analysis of PCL showed amplification of JUNB in 70% of C-ALCL, 29% of MF, 18% of SS, 14% of cutaneous NK cell lymphoma, and 9% of PCBCL cases. JUNB expression in more than 50% of CTCL variants was present in a majority of tumor cells. In contrast, expression of JUNB in PCBCL was limited to a minority of the cellular infiltrate. There was general concordance between the results of JUNB detected by these 3 different techniques. For instance, high-level amplification and overexpression of JUNB was consistently detected in C-ALCL, MF, and SS using RT-PCR and IHC. Occasional rare discrepancies were noted and are likely to be due to the different detection sensitivity of these techniques. These findings suggest that amplification and overexpression of JUNB may be a key pathogenetic event in CTCL.

JUNB protein is one of the principal components of the activating protein-1 (AP-1) transcription factor complex, consisting of the JUN (C-JUN, JUNB, and JUND) and FOS (C-FOS, FOSB, FRA1, and FRA2) families, which has been implicated in a variety of biologic processes.20,22-24 For example, previous studies have shown that JUNB is involved in control of the cell cycle by inducing high level expression of the cyclin-dependent kinase inhibitor p16(INK4a) and down-regulating cyclin D expression, producing a decrease in pRb hyperphosphorylation and G1-phase extension leading to premature cell senescence.21,25,26 In addition, in T cells JUNB has been found to promote T–helper-2 cell (TH2) differentiation through up-regulation of interleukin-4 (IL-4).27-29 Transforming growth factor-beta1 (TGFB1) also induces expression of JUNB in human leukemic cells,26 and interestingly, a TH2 immunophenotype and overexpression of TGFB1 are characteristic of CTCL.30-32 The TAX oncoprotein of human T-cell leukemia virus type 1 (HTLV-1) also induces JUNB expression,33,34 although all the cases in this study were HTLV-1 negative, and HTLV-1 is not associated with MF/SS.35 JUNB is expressed in epidermal keratinocytes, consistent with our observation in this study, and is thought to have a role in wound healing, photoaging, and UV-induced skin carcinogenesis.18 It has been suggested that JUNB and JUND are proliferation inhibitor or tumor suppressors.20,22,23,36-39 In contrast, C-JUN functions as a promoter of cell proliferation and as an apoptosis inhibitor due to down-regulation of p53, p21, and p16, and up-regulation of cyclin-dependent kinases.20,22,23,36-39 These studies would appear to suggest that amplification and overexpression ofJUNB would be apoptotic and inhibit tumor cell proliferation in CTCL. However, recent knock-in mouse studies have shown that JUNB can substitute for the absence of C-JUN during mouse development and cell proliferation,39,40 and this is thought to be through the constitutive activation of transcription factor NF-κB, which controls the activation of JUNB.41 This may explain why overexpression of C-JUN and JUNB proteins are detected in human colorectal, ovarian, and cervical cancers but not in normal tissues, whereas JUND protein is present in normal tissues but rarely in tumors.17,42,43 Amplification and/or overexpression ofJUNB also have been described in Hodgkin lymphoma cell lines, cervical cancer cell lines, and endometrial cancers.41,44,45 In this study, we identified copy number gain of JUNB in 5 MF/SS cases using genomic microarray. This was supported by RT-PCR and IHC studies, which revealed amplification and expression of JUNB in 8 and 28 cases, respectively. In addition, high-level amplification and overexpression ofJUNB were identified in CTCL variants. This was in contrast to findings in PCBCL, in which only rare cases showed amplification and expression of JUNB, and in fact decreased copy number ofJUNB was detected in 3 cases.10 Taken together, these results suggest that up-regulation of JUNB is frequently associated with CTCL variants rather than PCBCL. Further studies of C-JUN, C-FOS, and JUND are now required in PCL.

Apart from JUNB, other oncogenes such as RAF1,CTSB, and PAK1 also were frequently identified in MF/SS. RAF1 (v-raf-1 murine leukemia viral oncogene homolog 1) is a mitogen-activated protein kinase that acts downstream of RAS viral oncogene homolog and is regulated by BCL2 and other apoptosis-related proteins.46,CTSB encodes cathepsin B, a lysosomal cysteine protease that cleaves amyloid precursor protein and is involved in tumor invasion.46PAK1 (p21/Cdc42/Rac1-activated kinase 1) belongs to the PAK family composed of serine/threonine p21-activating kinases, which are involved in cytoskeleton reorganization and nuclear signaling. PAK1 regulates cell motility and morphology.46 Previous studies have shown amplification of RAF1, CTSB, andPAK1 in breast, esophageal, and urinary bladder carcinomas, respectively.47-49 At present there are no data on alterations of these oncogenes in nodal lymphomas. Therefore, further studies are required to confirm amplification of these oncogenes in PCLs with functional studies to establish the significance of these findings.

In summary, we have found consistent patterns of GI in MF/SS and frequent amplification and overexpression of JUNB in C-ALCL, MF, and SS, suggesting that this oncogene may play an important role in the pathogenesis of CTCL.

Prepublished online as Blood First Edition Paper, October 3, 2002; DOI 10.1182/blood-2002-08-2434.

Supported by grants from the British Skin Foundation, Dermatrust, and St John's Special Purpose Fund.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

References

References
1
Willemze
R
Kerl
H
Sterry
W
et al
EORTC classification for primary cutaneous lymphomas: a proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer.
Blood.
90
1997
354
371
2
Harris
NL
Jaffe
ES
Diebold
J
et al
The World Health Organization classification of neoplastic diseases of the haematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting, Airlie House, Virginia, November 1997.
Histopathology.
36
2000
69
86
3
Jaffe
ES
Harris
NL
Stein
H
Vardiman
JW
World Health Organization classification of tumours: pathology and genetics of tumours of haematopoietic and lymphoid tissues.
2001
IARC Press
Lyon, France
4
McGregor
JM
Crook
T
Fraser-Andrews
EA
et al
Spectrum of p53 gene mutations suggests a possible role for ultraviolet radiation in the pathogenesis of advanced cutaneous lymphomas.
J Invest Dermatol.
112
1999
317
321
5
Scarisbrick
JJ
Woolford
AJ
Russell-Jones
R
Whittaker
SJ
Loss of heterozygosity on 10q and microsatellite instability in advanced stages of primary cutaneous T-cell lymphoma and possible association with homozygous deletion of PTEN.
Blood.
95
2000
2937
2942
6
Scarisbrick
JJ
Woolford
AJ
Russell-Jones
R
Whittaker
SJ
Allelotyping in mycosis fungoides and Sezary syndrome: common regions of allelic loss identified on 9p, 10q, and 17p.
J Invest Dermatol.
117
2001
663
670
7
Child
FJ
Scarisbrick
JJ
Calonje
E
Orchard
G
Russell-Jones
R
Whittaker
SJ
Inactivation of tumor suppressor genes p15INK4b and p16INK4a in primary cutaneous B cell lymphoma.
J Invest Dermatol.
118
2002
941
948
8
Scarisbrick
JJ
Woolford
AJ
Calonje
E
et al
Frequent abnormalities of the p15 and p16 genes in mycosis fungoides and sezary syndrome.
J Invest Dermatol.
118
2002
493
499
9
Mao
X
Lillington
MD
Scarisbrick
J
et al
Molecular cytogenetic analysis of cutaneous T-cell lymphomas: identification of common genetic alterations in Sezary syndrome and mycosis fungoides.
Br J Dermatol.
147
2002
464
475
10
Mao
X
Lillington
D
Child
F
Russell-Jones
R
Young
D
Whittaker
S
Comparative genomic hybridisation analysis of primary cutaneous B-cell lymphomas: identification of common genomic alterations in disease pathogenesis.
Genes Chromosomes Cancer.
35
2002
144
155
11
Pinkel
D
Segraves
R
Sudar
D
et al
High resolution analysis of DNA copy number variation using comparative genomic hybridization to microarrays.
Nat Genet.
20
1998
207
211
12
Daigo
Y
Chin
SF
Gorringe
KL
et al
Degenerate oligonucleotide primed-polymerase chain reaction-based array comparative genomic hybridization for extensive amplicon profiling of breast cancers: a new approach for the molecular analysis of paraffin-embedded cancer tissue.
Am J Pathol.
158
2001
1623
1631
13
Hui
AB
Lo
KW
Yin
XL
Poon
WS
Ng
HK
Detection of multiple gene amplifications in glioblastoma multiforme using array-based comparative genomic hybridization.
Lab Invest.
81
2001
717
723
14
Hui
AB
Lo
KW
Teo
PM
To
KF
Huang
DP
Genome wide detection of oncogene amplifications in nasopharyngeal carcinoma by array based comparative genomic hybridization.
Int J Oncol.
20
2002
467
473
15
Bièche
I
Olivi
M
Champème
MH
Vidaud
D
Lidereau
R
Vidaud
M
Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.
Int J Cancer.
78
1998
661
666
16
Goff
LK
Neat
MJ
Crawley
CR
et al
The use of real-time quantitative PCR and comparative genomic hybridisation to identify amplification of the REL gene in follicular lymphoma.
Br J Haematol.
111
2001
618
625
17
Wang
H
Birkenbach
M
Hart
J
Expression of Jun family members in human colorectal adenocarcinoma.
Carcinogenesis.
21
2000
1313
1317
18
Angel
P
Szabowski
A
Schorpp-Kistner
M
Function and regulation of AP-1 subunits in skin physiology and pathology.
Oncogene.
20
2001
2413
2423
19
Weedon
D
Strutton
G
Skin Pathology. Edinburgh
2001
Churchill Livingstone
United Kingdom
20
Shaulian
E
Karin
M
AP-1 as a regulator of cell life and death.
Nat Cell Biol.
4
2002
E131
E136
21
Passegue
E
Wagner
EF
JunB suppresses cell proliferation by transcriptional activation of p16(INK4a) expression.
EMBO J.
19
2000
2969
2979
22
Jochum
W
Passegue
E
Wagner
EF
AP-1 in mouse development and tumorigenesis.
Oncogene.
20
2001
2401
2412
23
van Dam
H
Castellazzi
M
Distinct roles of Jun : Fos and Jun : ATF dimers in oncogenesis.
Oncogene.
20
2001
2453
2464
24
Shaulian
E
Karin
M
AP-1 in cell proliferation and survival.
Oncogene.
20
2001
2390
2400
25
Bakiri
L
Lallemand
D
Bossy-Wetzel
E
Yaniv
M
Cell cycle-dependent variations in c-Jun and JunB phosphorylation: a role in the control of cyclin D1 expression.
EMBO J.
19
2000
2056
2068
26
Pachernik
J
Soucek
K
Hampl
A
Hofmanova
J
Kozubik
A
Transforming growth factor-beta1 induces junB mRNA accumulation, G1-phase arrest, and pRb dephosphorylation in human leukemia HL-60 cells.
Folia Biol (Praha).
47
2001
32
35
27
Mondino
A
Whaley
CD
DeSilva
DR
Li
W
Jenkins
MK
Mueller
DL
Defective transcription of the IL-2 gene is associated with impaired expression of c-Fos, FosB, and JunB in anergic T helper 1 cells.
J Immunol.
157
1996
2048
2057
28
Rincon
M
Derijard
B
Chow
CW
Davis
RJ
Flavell
RA
Reprogramming the signalling requirement for AP-1 (activator protein-1) activation during differentiation of precursor CD4+ T-cells into effector Th1 and Th2 cells.
Genes Funct.
1
1997
51
68
29
Li
B
Tournier
C
Davis
RJ
Flavell
RA
Regulation of IL-4 expression by the transcription factor junb during T helper cell differentiation.
EMBO J.
18
1999
420
432
30
Vowels
BR
Lessin
SR
Cassin
M
et al
Th2 cytokine mRNA expression in skin in cutaneous T-cell lymphoma.
J Invest Dermatol.
103
1994
669
673
31
Rook
AH
Gottlieb
SL
Wolfe
JT
et al
Pathogenesis of cutaneous T-cell lymphoma: implications for the use of recombinant cytokines and photopheresis.
Clin Exp Immunol.
107(suppl 1)
1997
16
20
32
Bagot
M
Nikolova
M
Schirm-Chabanette
F
Wechsler
J
Boumsell
L
Bensussan
A
Crosstalk between tumor T lymphocytes and reactive T lymphocytes in cutaneous T cell lymphomas.
Ann N Y Acad Sci.
941
2001
31
38
33
Fujii
M
Niki
T
Mori
T
et al
HTLV-1 Tax induces expression of various immediate early serum responsive genes.
Oncogene.
6
1991
1023
1029
34
Iwai
K
Mori
N
Oie
M
Yamamoto
N
Fujii
M
Human T-cell leukemia virus type 1 tax protein activates transcription through AP-1 site by inducing DNA binding activity in T cells.
Virology.
279
2001
38
46
35
Whittaker
SJ
Luzzatto
L
Deleted HTLV-1 provirus in mycosis fungoides.
Science.
259
1993
1470
1471
36
Szabowski
A
Maas-Szabowski
N
Andrecht
S
et al
c-Jun and JunB antagonistically control cytokine-regulated mesenchymal-epidermal interaction in skin.
Cell.
103
2000
745
755
37
Finch
S
Joseloff
E
Bowden
T
JunB negatively regulates AP-1 activity and cell proliferation of malignant mouse keratinocytes.
J Cancer Res Clin Oncol.
128
2002
3
10
38
Passegue
E
Jochum
W
Schorpp-Kistner
M
Mohle-Steinlein
U
Wagner
EF
Chronic myeloid leukemia with increased granulocyte progenitors in mice lacking junB expression in the myeloid lineage.
Cell.
104
2001
21
32
39
Weitzman
JB
Juggling jun.
Nat Genet.
30
2002
128
129
40
Passegue
E
Jochum
W
Behrens
A
Ricci
R
Wagner
EF
JunB can substitute for Jun in mouse development and cell proliferation.
Nat Genet.
30
2002
158
166
41
Mathas
S
Hinz
M
Anagnostopoulos
I
et al
Aberrantly expressed c-Jun and JunB are a hallmark of Hodgkin lymphoma cells, stimulate proliferation and synergize with NF-kappa B.
EMBO J.
21
2002
4104
4113
42
Bauknecht
T
Angel
P
Kohler
M
et al
Gene structure and expression analysis of the epidermal growth factor receptor, transforming growth factor-alpha, myc, jun, and metallothionein in human ovarian carcinomas: classification of malignant phenotypes.
Cancer.
71
1993
419
429
43
Neyns
B
Katesuwanasing
Vermeij
J
et al
Expression of the jun family of genes in human ovarian cancer and normal ovarian surface epithelium.
Oncogene.
12
1996
1247
1257
44
Choo
KB
Huang
CJ
Chen
CM
Han
CP
Au
LC
Jun-B oncogene aberrations in cervical cancer cell lines.
Cancer Lett.
93
1995
249
253
45
Bamberger
AM
Milde-Langosch
K
Rossing
E
Goemann
C
Loning
T
Expression pattern of the AP-1 family in endometrial cancer: correlations with cell cycle regulators.
J Cancer Res Clin Oncol.
127
2001
545
550
46
NCBI LocusLink. Available at: http://www.ncbi.nlm.nih.gov/LocusLinkAccessed May 25, 2002.
47
Bekri
S
Adelaide
J
Merscher
S
et al
Detailed map of a region commonly amplified at 11q13→q14 in human breast carcinoma.
Cytogenet Cell Genet.
79
1997
125
131
48
Hughes
SJ
Glover
TW
Zhu
XX
et al
A novel amplicon at 8p22–23 results in overexpression of cathepsin B in esophageal adenocarcinoma.
Proc Natl Acad Sci U S A.
95
1998
12410
12415
49
Simon
R
Richter
J
Wagner
U
et al
High-throughput tissue microarray analysis of 3p25 (RAF1) and 8p12 (FGFR1) copy number alterations in urinary bladder cancer.
Cancer Res.
61
2001
4514
4519

Author notes

Xin Mao, Skin Tumour Unit, St John's Institute of Dermatology, St Thomas' Hospital, Lambeth Palace Road, London SE1 7EH, United Kingdom; e-mail: mxmayo@hotmail.com ormxmayo@yahoo.co.uk.