Aberrant DNA methylation is believed to be important in tumorigenesis by causing either transcriptional inactivation of genes or chromosomal instability. Several laboratories have identified promoter hypermethylation of tumor suppressor genes in acute myeloid leukemia (AML). However, these studies do not provide a global assessment of overall methylation changes and do not allow the identification of novel methylated sequences. Previously, nonrandom CpG island methylation was reported in 17 adult de novo AML diagnostic samples when compared with the corresponding remission samples by means of restriction landmark genomic scanning (RLGS). That study has been expanded on by an analysis of a larger set of CpG islands (1740 vs 1184), which now provides details of 33 cloned methylated loci, including 21 known genes or expressed sequence tags. Five of these cloned loci appear to be methylated only in AML and not in the 6 solid tumors studied in this study (more than 98 samples analyzed). Chromosomal location was available for 30 of the 33 loci, and 5 of these 30 (17%) are localized to chromosome 11, suggesting a trend toward overrepresentation of methylation events on this chromosome. These results provide evidence for widespread aberrant methylation in AML, with identification of novel methylation targets, epigenetic changes that appear unique to AML, and apparent preferential methylation on chromosome 11.

Acute myeloid leukemia (AML) is a clonal malignancy of hematopoietic cells of the myeloid lineage. It is a heterogeneous disease at the molecular and cytogenetic levels, as evidenced by the mixed clinical response to standard therapy.1 Over half of de novo AML cases exhibit cytogenetic abnormalities, including numerous recurring chromosome translocations and inversions that result in gene fusions.2 Some of the resultant fusion proteins have been shown to be involved in leukemogenesis,3 but it is thought that additional molecular changes are needed for the development of frank leukemia.4-6 

DNA methylation is one mechanism that is believed to contribute to cancer initiation and progression by causing the inactivation of gene expression.7,8 This can have important consequences if the inactivated genes are essential for the control of normal cell growth, differentiation, or apoptosis. Aberrant DNA methylation can be responsible for one or both hits of Knudson's 2-hit hypothesis of carcinogenesis.9 The mechanisms that regulate normal and aberrant methylation are not fully understood, nor are the mechanisms by which methylation interferes with transcription. These processes involve complex interactions between methyltransferase and demethylase enzymes, histone acetylases and deacetylases, transcription factors, and chromatin structure (reviewed in Baylin and Herman,10 Cress and Seto,11 and Jones and Wolffe12).

Studies of selected tumor suppressor genes, such as p15 andp16,13,14 as well as candidate tumor suppressor genes, including the estrogen receptor15 and hypermethylated in cancer 1 (HIC1),16 indicate that aberrant DNA methylation is involved in AML. Melki et al17 found that 15 of 20 AML patients showed aberrant methylation in 2 or more cancer-related promoters, suggesting that AML might be characterized by a general deregulation of CpG island methylation.

In contrast to techniques that allow assessment of the methylation status of individual genes, restriction landmark genomic scanning (RLGS) is a tool for the identification of genomewide methylation changes in CpG islands regardless of whether the genomic sequence is known.18 This technique makes use of the rare-cutting methylation-sensitive restriction enzyme NotI (recognition sequence GC↓GGCCGC), which provides the landmarks composing an RLGS profile—a display of up to 2000 CpG islands in a single assay. The majority of these sequences are located in the 5′ regions of genes, thus providing a global portrait of the methylation status of hundreds of promoter sequences within a tumor sample. Some of the methylation changes within a single tumor type are unique to that tumor type, while other changes are common to several different tumor types.19 Therefore, it is possible that the identification of a unique set of methylation changes within a tumor type can establish a methylation signature or fingerprint, allow molecular classifications, and identify novel genes important in pathogenesis and treatment.

Previously, we reported a genomewide study of aberrant methylation in multiple tumor types, including AML. Our results showed that aberrant methylation in adult de novo AML is variable and nonrandom.19 We have expanded our analysis using 16 of the original 17 pairs of diagnostic and remission samples. This expanded analysis includes assessment of a larger number of CpG islands (1740 vs 1184) and a detailed description of 33 methylated loci from diagnostic AML samples. Using this strategy, we have identified novel methylation targets, epigenetic changes that appear specific for AML, and a trend toward overrepresentation of methylation on chromosome 11.

Restriction landmark genomic scanning

RLGS profiles established from our previous study were used for the current analysis.19 RLGS was performed as previously described by means of the enzyme combination NotI (methylation-sensitive), EcoRV, andHinfI.20 

RLGS gel analysis

Gels are analyzed by overlying the tumor sample (AML at diagnosis) and the matching normal control (remission sample), marking the changes on clear acetate, and recording the master profile address of the altered fragments. Previously, we had reported the analysis of 1184 fragments in multiple tumor types.19 Since the AML samples all have matched normal controls (ie, remission samples), this allows us to eliminate the possibility that spot changes are due to polymorphisms, rather than methylation events. Therefore, we were able to analyze 1740 fragments per sample in the current study.

Cloning of methylated loci

RLGS fragments were cloned with the use of a previously constructed arrayed plasmid library derived fromNotI/EcoRV fragments from peripheral blood (PB) genomic DNA from a healthy female donor.21 Confirmation of the clone of interest was accomplished by running a set of 4 RLGS mixing gels in which 5.2, 10.4, 20.8, and 66.3 (or in some cases 83.2) pg of 32P-labeled NotI-EcoRV fragments of the plasmid DNA were added to normal PB DNA for the first dimension gel electrophoresis. The standard RLGS procedure was then followed. Progressive enhancement of the locus of interest on the RLGS profile confirms the validity of the clone (Figure 3).

Determination of CpG island characteristics

RLGS clone sequences (either the entireNotI-EcoRV clone or available sequence from theNotI side) were submitted to the CpG island prediction program at WebGene at: http://www.itba.mi.cnr.it/webgene/ (accessed February 15, 2001). This program uses the CpG island criteria developed by Gardiner-Garden and Frommer.22 

Southern hybridization

Southern hybridization was performed as previously described.23 

Tissues and cell lines

Patient samples were obtained from the Cancer and Leukemia Group B Tissue Bank (Chicago, IL). The first 16 cases with the same available matched tissue (bone marrow [BM] [n = 3] or PB [n = 13]) from diagnosis and remission with de novo AML were chosen. Samples were collected in anticoagulant (heparin or EDTA) and shipped overnight to the procurement laboratory for processing. Mononuclear cells were separated on a Histopaque 1077 (Sigma, St Louis, MO) gradient by centrifugation at 1500 rpm for 30 minutes. Buffy coats were collected in freezing medium (Sigma) and stored in liquid nitrogen at −80°C until DNA isolation.

Isolation of high molecular weight DNA

High molecular weight DNA (approximately 1 μg/μL) from patient samples and cell lines was isolated according to published protocol.24 

Isolation of RNA

Total RNA was extracted by means of Trizol (Gibco BRL, Rockville, MD) according to the manufacturer's directions.

Cell lines

Cell lines (HL-60, Kasumi-1, ML-1, and TI-1) were obtained from the laboratory of one of the authors (M.A.C.). Cells were cultured in RPMI-1640 medium with 20% fetal bovine serum (Gibco BRL), 1% antibiotic-antifungal agent (Gibco BRL), and 1% anti–pleuropneumonia-like organism agent (Gibco BRL) at 37°C in a 5% CO2 humidified atmosphere. We diluted 5-aza-2′-deoxycytidine (Sigma) with sterile water, filtered it, and added it directly to the culture medium in the concentrations and for the durations indicated.

Complementary DNA synthesis

RNA was converted to complementary DNA (cDNA) by means of the Superscript Preamplification System for First Strand cDNA Synthesis (Gibco BRL) following the manufacturer's instructions, and with the use of 2 to 3 μg total RNA and 0.5 μg Oligo(dT)11-17.

Polymerase chain reaction

Polymerase chain reactions (PCRs) were carried out in a total volume of 50 μL. Reaction mixtures contained 2 μL cDNA, 5 μL 10 × PCR buffer (Gibco BRL), 200 μM each dNTP, 1.5 mM MgCl2, 10 pmol each primer, and 2.5 U Platinum TaqDNA polymerase (Gibco BRL), except for the GPIreactions, which used AmpliTaq Gold (Perkin Elmer, Foster City, CA). Some reactions contained 5% dimethyl sulfoxide (DRD4, CYP1B1, and GPI). All reactions were run in a GeneAmp PCR System 9700 (Perkin Elmer Applied Biosystems, Foster City, CA) thermal cycler. For each PCR reaction, 10 μL was loaded onto a nondenaturing 8% polyacrylamide gel, electrophoresed at 250 V for 50 to 60 minutes, stained with ethidium bromide, and visualized under UV light.

Primers for reverse transcription–PCR

DRD4 forward 5′ TCGTCTACTCCGAGGTCCAG and reverse 5′ AGCACACGGACGAGTAGACC; CYP1B1 forward 5′ ACAGCATGATGCGCAACTTC and reverse 5′ TGGTCAGGTCCTTGTTGATG; G-α-Olf forward 5′ CGGAAGACCAGGGCGTCGATGAA and reverse 5′ CCCATTGACGTGCAGGATCCTCA; expressed sequence tag (EST) AI433656 (Genbank accession No.) forward 5′ CCCCAGCGAAGGCGTAG and reverse 5′ CGCGGGGCCACCAGTTTG;WIT1 forward 5′ CCTCACTGCCCTGCTCCTA and reverse 5′ TACCCACCACCCCTCTACC; GPI forward 5′ GACCCCCAGTTCCAGAAGCTGC and reverse 5′ GCATCACGTCCTCCGTCACC. All reactions were performed with an initial denaturing step of 95°C for 10 minutes, followed by 35 cycles of denaturing at 96°C for 30 seconds (GPI, 15 seconds). Annealing was 58°C for 30 seconds for DRD4; 57°C for 30 seconds for CYP1B1; 66°C for 60 seconds forG-α-Olf; 62°C for 60 seconds for EST AI433656; 58°C for 30 seconds for WIT1; and 60°C for 15 seconds forGPI. Extension was performed at 72°C for 60 seconds (G-α-Olf for 30 seconds), and final extension was at 72°C for 10 minutes (GPI, 5 minutes).

Mapping of clone 2D74

This clone was mapped as previously described.25 Primers used for mapping were as follows: No. 1 forward TTAACTCCCTCTGCTGCTCTCG and reverse CAATCCCTTGCACGTTTTGC; No. 2 forward TGGGTTTGCTCTAGGTGTTGGC and reverse TTTAGGGTGTGGTGAAGGGACC.

Statistical analysis

Heterogeneity of fragment losses across samples was determined by a chi-square test comparing the loss distribution with the expected (Poisson) distribution under the homogeneity hypothesis.26Similarly, chi-square goodness-of-fit tests were devised, comparing the observed vs the expected frequencies of fragments exhibiting multiple loss across samples, and comparing the observed vs the expected frequencies of chromosome-specific loss events. For these analyses, standard asymptotic P-value approximations did not apply or were inaccurate. For each analysis, 10 000 simulations from the permutation distribution of the data were performed to obtain empiricalP values. For the fixed observed number of methylation events on each chromosome, we calculated the null expected number of events as proportional to chromosome length or gene number. The variance of the observed number of events per chromosome, however, is sensitive to high-methylation frequencies of individual fragments and may not reflect a propensity of an individual chromosome. We performed a permutation test in which the observed loss at each fragment was fixed, but the fragment was randomly assigned to each chromosome according to the null expectation. To obtain an overall empirical distribution, we calculated, for each of 100 000 random permutations, the maximum chi-square cell contribution: (observed-expected)2/expected. This approach properly considers the varying loss rates of individual fragments and accounts for multiple statistical comparisons across several chromosomes.

Comparison of RLGS profiles from AML diagnostic and remission samples

To assess the extent of hypermethylation in AML, RLGS profiles were obtained for 16 pairs of BM (n = 3) or PB (n = 13) samples from adult patients at the time of original diagnosis with AML (Figure1) and again at complete remission (defined according to standard criteria with fewer than 5% blast cells on bone marrow aspirate27) following induction chemotherapy. Profiles were also obtained for 4 AML cell lines: Kasumi-1,28 HL-60,29 ML-1,30 and TI-1.31 Altered RLGS fragments in the patient samples were identified by comparing the diagnostic and remission profiles from the same patient. In each case, BM was compared with BM, and PB with PB. We have previously shown that the absence of a fragment on the diagnostic profile coupled with the presence of the fragment on the remission profile from the same patient is indicative of methylation in the diagnostic tissue19,32 (Figure2). Each fragment on the RLGS profile has a unique address (http://pandora.med.ohio-state.edu/masterRLGS/[accessed February 15, 2001]) to allow for consistent recording of alterations. A total of 1740 fragments were assessed for each pair of diagnostic and remission profiles. The total number of methylation events (ie, loss of a fragment) in the diagnostic profiles when compared with the remission profiles ranged from 0 to 145 (0% to 8.3% of the profile; mean 1.9%), indicating a wide range in the degree of aberrant methylation in these samples (Table1). This range demonstrates heterogeneity across samples, indicating that some samples demonstrated an inherently higher methylation event rate than others (P < .001; see “Statistical analysis”). Of the 1740 loci examined, 208 (16%) were methylated in at least one patient.

Fig. 1.

RLGS profile prepared from a BM aspirate at initial diagnosis with AML.

Directions of first and second dimension electrophoresis are shown, as well as molecular sizes of the fragments.

Fig. 1.

RLGS profile prepared from a BM aspirate at initial diagnosis with AML.

Directions of first and second dimension electrophoresis are shown, as well as molecular sizes of the fragments.

Close modal
Fig. 2.

RLGS profiles demonstrating methylation of fragment 3B36 (arrow) in diagnostic sample compared with remission sample from same patient.

Comparison of RLGS profile of AML diagnostic sample (panel A) and remission sample (panel B), showing absence of fragment 3B36, theCPY1B1 gene, in AML diagnostic sample owing to methylation.

Fig. 2.

RLGS profiles demonstrating methylation of fragment 3B36 (arrow) in diagnostic sample compared with remission sample from same patient.

Comparison of RLGS profile of AML diagnostic sample (panel A) and remission sample (panel B), showing absence of fragment 3B36, theCPY1B1 gene, in AML diagnostic sample owing to methylation.

Close modal

Cloning, sequencing, and characterization of altered RLGS fragments

In order to further characterize the target sequences that become aberrantly methylated in AML, we selected RLGS loci that had both a high and a low frequency of loss in our diagnostic AML samples and that were available in our cloning library. The cloning was accomplished by using an arrayed NotI-EcoRV plasmid library and RLGS mixing gels as previously described.21,23 Figure3 shows a portion of an RLGS profile demonstrating positive identification of clone 2D70 in a representative mixing gel. A total of 33 RLGS loci that were altered in diagnostic AML samples have been cloned and either partially (single pass from theNotI end) or fully sequenced (Table2). Previously, we reported that certain RLGS fragments are lost exclusively in certain tumor types.19 Here we report the cloning of 5 loci (2C40, 2D14, 3F16, 3F72, and 4E53) methylated exclusively in AML and not in the breast (n = 14), colon (n = 8), head and neck (n = 14), testicular tumors (n = 9), adult brain tumors (n = 14), or pediatric brain tumors (n = 22) in our original analysis (Table 2). All clone sequences were analyzed for CpG island characteristics with the WebGene program (Consiglio Nazionale delle Ricerche, Istituto Tecnologie Biomediche Avanzate, Milan, Italy) (http://www.itba.mi.cnr.it/webgene/). Of the 33 clones, 31 (94%) have CpG island characteristics. BLAST searches show that 11 clones have homology to known genes, 10 to EST sequences, 11 to bacterial artificial chromosomes (BACs) or P1 artificial chromosomes, and 1 has no homology. The results of the database searches are listed in Table2. The data demonstrate the strong bias of RLGS for display of CpG islands and sequences associated with genes, rather than random genomic sequences.

Fig. 3.

RLGS mixing gels used in cloning procedure.

Normal PB genomic DNA (panel A) with no additionalNotI-EcoRV clone. PB with 5.2 pg (panel B) and 20.8 pg (panel C) of the radiolabeled candidate clone added to the genomic DNA. Progressive enhancement of the RLGS fragment of interest confirms identification of the correct NotI-EcoRV clone.

Fig. 3.

RLGS mixing gels used in cloning procedure.

Normal PB genomic DNA (panel A) with no additionalNotI-EcoRV clone. PB with 5.2 pg (panel B) and 20.8 pg (panel C) of the radiolabeled candidate clone added to the genomic DNA. Progressive enhancement of the RLGS fragment of interest confirms identification of the correct NotI-EcoRV clone.

Close modal

To assess the methylation status of selected genes in AML cell lines, Southern blots were prepared and hybridized with 6NotI-EcoRV clones (2C40, 3B36, 3D35, 3C01, 5C08, and 5E34) with the use of either the entire clone or a suitable restriction fragment. Normal donor PB mononuclear cell DNA served as a control. DNA was digested with EcoRV alone (PB) orEcoRV plus the methylation-sensitive enzyme NotI (PB and cell lines). Failure of NotI to cut the cell line DNA was observed in most cases; this is strongly supportive of methylation of these genes in the cell lines (Figure4). Previous work in our laboratory has confirmed that loss of a fragment on the RLGS profile corresponds to methylation in more than 99% of the samples analyzed by Southern hybridization (Costello et al,19 Plass et al,32 and unpublished data).

Fig. 4.

Southern blots showing methylation of RLGS clones in AML cell lines.

Lane 1: Control normal donor peripheral blood (PB) is digested withEcoRV only (RV only) to show size of unmethylated band. Lanes 2-6: PB and AML cell line DNA is double-digested withEcoRV and methylation-sensitive NotI (RV-NotI). The presence of an uncut band in these lanes is indicative of methylation at the NotI site. Blots are probed with the RLGS clones 2C40 (panel A), 5C08 (panel B), and 3B36 (panel C). The 1.7-kilobase (kb) band in (panel B) is due to partial methylation of an internal NotI site within the larger 3-kbEcoRV-NotI fragment. Kas-1 indicates Kasumi-1.

Fig. 4.

Southern blots showing methylation of RLGS clones in AML cell lines.

Lane 1: Control normal donor peripheral blood (PB) is digested withEcoRV only (RV only) to show size of unmethylated band. Lanes 2-6: PB and AML cell line DNA is double-digested withEcoRV and methylation-sensitive NotI (RV-NotI). The presence of an uncut band in these lanes is indicative of methylation at the NotI site. Blots are probed with the RLGS clones 2C40 (panel A), 5C08 (panel B), and 3B36 (panel C). The 1.7-kilobase (kb) band in (panel B) is due to partial methylation of an internal NotI site within the larger 3-kbEcoRV-NotI fragment. Kas-1 indicates Kasumi-1.

Close modal

Reverse transcription–PCR analysis using AML cell lines

As promoter hypermethylation has been linked to transcriptional silencing, we assessed the expression status of 5 sequences (4 genes and 1 EST) that were aberrantly methylated in our diagnostic AML samples. Whereas previously we had examined expression of 3 of these loci (G-α-Olf, WIT1, and 3D41) in brain tumor cell lines, the current studies were carried out with 3 AML cell lines: HL-60, Kasumi, and TI-1. RLGS profiles for each cell line showed all 5 sequences were methylated in the Kasumi-1 line, while 4 of 5 were methylated in the HL-60 (exception: 3B36) and in the TI-1 (exception: 5E34) cell lines (Table 3). Reverse transcription–PCR (RT-PCR) was performed on RNA from these cell lines before and after the cells were treated with the demethylating agent 5-aza-2′-deoxycytidine (Table 3). Expression status of 3 sequences,CYP1B1, G-α-Olf, and EST AI433656, was changed in at least one of the cell lines after treatment. DRD4expression was not detectable regardless of treatment, and expression of WIT1 remained unchanged.

Methylation changes in AML are nonrandom, with a trend toward overrepresentation of chromosome 11 loci

To determine if there were recurrent methylation events among diagnostic AML samples in our expanded set of CpG islands, we compared the analyses of fragment losses across our 16 patients. This comparison revealed that certain fragments (eg, 2C40, Table 2) were altered in the majority of diagnostic AML samples (11 of 16), whereas other fragments were altered much less frequently (eg, 3D41; 3 of 16) or not at all (eg, 4B2; 0 of 16; not listed in Table 2 because not methylated in this sample set). A standard goodness-of-fit test was applied to test the hypothesis of a constant rate of alteration among the fragments. This hypothesis was clearly rejected (P < .001; see “Statistical analysis”), with many more fragments showing repeated alteration than would be expected by chance. The expanded analysis of a larger set of CpG islands reported here upholds our previous observation of nonrandom methylation patterns in AML.

We also examined the BLAST search data for the chromosomal location of our 33 cloned methylated loci. Interestingly, of the 30 clones for which the chromosomal location was available, 5 (17%) map to chromosome 11 (3 to the long arm and 2 to the short arm) (Table 2). We plotted the total number of loss events (ie, the number of patients in which a specific locus was methylated) for each clone with a chromosomal assignment against the chromosome number (Figure5). We calculated an “expected” rate of methylation for the chromosomes using 2 criteria: the relative physical length of the chromosomes33 and the estimated number of genes on each chromosome.34 We compared the observed vs expected frequency of methylation on the chromosomes using a specially designed chi-square test with a permutation-basedP-value (see “Statistical analysis”). While there appeared to be a clear trend for overrepresentation of methylation events on chromosome 11, the test did not reach statistical significance (maximum χ12 = 110.09; overallP = .056).

Fig. 5.

Observed vs expected numbers of methylation events per chromosome for 30 RLGS loci for which chromosomal assignment is available.

The total number of methylation events per chromosome was determined by the number of times each RLGS locus with a chromosomal assignment was methylated in the 16 AML diagnostic samples. The data show a trend for an overrepresentation of methylation events on chromosome 11. ■ indicates observed events; ▪, expected events.

Fig. 5.

Observed vs expected numbers of methylation events per chromosome for 30 RLGS loci for which chromosomal assignment is available.

The total number of methylation events per chromosome was determined by the number of times each RLGS locus with a chromosomal assignment was methylated in the 16 AML diagnostic samples. The data show a trend for an overrepresentation of methylation events on chromosome 11. ■ indicates observed events; ▪, expected events.

Close modal

In this study, we provide a detailed analysis of a genomewide survey of aberrant methylation in adult de novo AML, extending our previous work with characterization of novel methylated CpG islands, identification of leukemia-specific methylation, and the suggestion of preferential methylation events on chromosome 11. There is a remarkable variability in the degree of methylation in our sample set, indicating a much larger degree of methylation in primary patient AML samples than was previously known. Indeed, some AML samples exhibit very little or no aberrant methylation while others exhibit a much larger degree of methylation (up to 8.3% of the RLGS profile, and thus presumably a similar proportion of the 45 000 CpG islands in the genome). The methylation events we have identified do not correlate with specific translocations associated with AML, and in addition, they occur in AMLs with normal cytogenetics. This finding suggests that the aberrant methylation could represent an independent epigenetic change in addition to the genetic changes. The use of complete remission samples for each patient as our normal control eliminates any differences in the profiles due to polymorphisms. Restoration of unmethylated CpG islands in the profiles obtained from remission samples is attributed to eradication of the leukemic blasts and repopulation of the bone marrow with normal hematopoietic cells.

The nonrandom nature of the methylation found in AML is particularly intriguing and can be explained by 2 scenarios. First, aberrant methylation may preferentially target specific genes. Perhaps there are intrinsic features of those sequences, such as repetitive elements, sequence motifs, or chromatin structure, that predispose them to undergo methylation at a high frequency in AML when the regulatory mechanisms of methylation have gone awry. A second explanation is that the methylation itself is completely random but cells with a certain methylation pattern achieve a selective advantage based on the altered gene expression profile that results from the methylation. This explanation is supported by documentation of methylation-induced biallelic inactivation of p15, p16, andMLH1 in various cancers.35,36 

In addition to providing a comprehensive assessment of overall methylation changes, RLGS allows the identification of novel methylated genes. As shown in Table 2, one third (11 of 33) of the methylated fragments correspond to known genes, while almost another third (10 of 33) have homology to ESTs. Many of the genes identified in our samples were not previously known to be methylated in cancer. This underscores the utility of RLGS in identifying methylation in novel promoter and gene sequences and provides a rational approach for using these sequences in the study of leukemogenesis.

There are overwhelming data that promoter methylation is associated with transcriptional inactivation.37 In addition, there is evidence that methylation of 3′ CpG islands could have an activating effect on transcription.37 Interestingly, of the 11 genes that we identified, 3 (POU3F1,38,TBX18,39,40 and insulin promoter factor41) are known transcription factors. A fourth gene, cold shock domain A, is a member of a family of DNA- and RNA-binding genes involved in transcriptional and translational regulation.42 These observations are particularly relevant in light of the fact that genetic changes in AML frequently involve transcription factors.43 However, since some of the methylated genes that we identified are not expressed in normal blood (eg, DRD4, Table 3), the significance of the methylation of those genes in the pathogenesis of AML is unclear. It is possible, if not likely, that a fraction of the methylated genes are unrelated to the leukemic process and that the methylation is a reflection of a global deregulation of control mechanisms, including methyltransferase44 or demethylase enzymes,45or endogenous stimuli.46 

Our RT-PCR analyses showed that methylation of the RLGS landmarkNotI restriction site does not always correlate with complete transcriptional inactivation. This finding agrees with other reports in the literature.19,47 Cameron and colleagues14 have previously shown that the density of methylated CpG dinucleotides is important for inactivation of thep15 gene, and Ganderton and Briggs48 showed that methylation of the 5′ region of PTHrP did not correlate with inactivation. In addition, the location of the CpG island within the gene may play a role in determining the effects of methylation on transcription. In our study, methylation of the CpG island in the middle of CYP1B1 seemed to have a variable effect on transcription.

Importantly, our approach has identified 5 loci that appear to be methylated only in leukemia and not in the other tumor types we have investigated. Thus, we have the means to investigate genes whose effects may be specific to leukemia, as well as genes whose effects may be important in many different types of tumors.19 

As shown in Table 2, of the 33 cloned sequences, 30 have been mapped to a specific chromosome, and 5 of these 30 (17%) reside on chromosome 11. As chromosome 11 accounts for only 4.7% of relative length of the autosomes,33 methylation may be overrepresented on this chromosome. However, the trend for overrepresentation does not meet statistical significance. This will need to be further investigated with continuing elucidation of the human genome and a clearer understanding of CpG island and NotI site distribution. In a previous report, de Bustros et al49 postulated that the short arm of chromosome 11 is a “hot spot” for methylation. Our data with AML support these previous results and show that the methylation is not restricted to 11p but also involves 11q.

Chromosome 11 is already known to be involved in AML by virtue of translocations, partial tandem duplications, and trisomy 11.50-54 The association of methylation in these areas of chromosomal instability requires further investigation, but one hypothesis is that methylation occurs in these regions as a cause or consequence of genetic instability. Chromosome 11 is also known to harbor several cancer-related genes, including oncogenes and tumor suppressor genes, such as HRAS,55,FGF3,56,cyclin D,57,MEN1,58,ATM,59,TSG101,60 andWIT1.32 Aberrant methylation of any of these regions may lead to a selective advantage by activation or inactivation of these genes and an in vivo expansion of a malignant clone. In addition, there are several imprinted genes on chromosome 11, such as IGF2 and H19 at 11p15.5. Altered methylation of these genes is associated with Beckwith-Wiedemann syndrome.61,62 It is possible that the methylation associated with imprinting of these regions becomes deregulated and spreads over a larger region, resulting in the methylation of nearby genes. Together, these data indicate that not only genetic events but also methylation changes on chromosome 11 may play an important role in leukemogenesis.

Our findings provide a genomewide characterization of a highly variable methylation pattern in AML, along with the identification of novel methylated sequences, leukemia-specific methylation, and a trend for hypermethylation on chromosome 11. As AML is known to be a heterogeneous disease at both the cytogenetic and genetic levels,4 this may now also be extended to the epigenetic level since no single fragment is methylated in 100% of the profiles from diagnostic samples. Our data provide new insights into the molecular biology of AML and the role of epigenetic changes in this disease. Further characterization of these events should enhance our understanding of the pathogenesis of AML and could potentially result in the identification of novel cancer-related genes as well as molecular markers for the classification of AML.

We thank Julie Hall, Yue-Zhong Wu, Kellie Archer, Jeff Palatini, Donna Bucci, Mike Ostrowski, and Matthew P. Strout for advice and expert technical assistance; Robert Chadwick, head of the Genotyping and Sequencing Unit at Ohio State University, for assistance with sequencing and clone analysis; and Bo Yuan for bioinformatics assistance.

Supported by grants CA80912 (C.P.), CA16058 (C.D.B.), CA77658 (C.D.B.), CA31946 (C.D.B., M.A.C.), and CA09338 (M.A.C.) from the National Cancer Institute, National Institutes of Health, Bethesda, MD, and the Leukemia Clinical Research Foundation (C.D.B.).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.

1
Bishop
JF
The treatment of adult acute myeloid leukemia.
Semin Oncol.
24
1997
57
69
2
Mrozek
K
Heinonen
K
de la Chapelle
A
Bloomfield
CD
Clinical significance of cytogenetics in acute myeloid leukemia.
Semin Oncol.
24
1997
17
31
3
Caligiuri
MA
Strout
MP
Gilliland
DG
Molecular biology of acute myeloid leukemia.
Semin Oncol.
24
1997
32
44
4
Okuda
T
Cai
Z
Yang
S
et al
Expression of a knocked-in AML1-ETO leukemia gene inhibits the establishment of normal definitive hematopoiesis and directly generates dysplastic hematopoietic progenitors.
Blood.
91
1998
3134
3143
5
Castilla
LH
Wijmenga
C
Wang
Q
et al
Failure of embryonic hematopoiesis and lethal hemorrhages in mouse embryos heterozygous for a knocked-in leukemia gene CBFB-MYH11.
Cell.
87
1996
687
696
6
Castilla
LH
Garrett
L
Adya
N
et al
The fusion gene Cbfb-MYH11 blocks myeloid differentiation and predisposes mice to acute myelomonocytic leukaemia.
Nat Genet.
23
1999
144
146
7
Baylin
SB
Herman
JG
Graff
JR
et al
Alterations in DNA methylation: a fundamental aspect of neoplasia.
Adv Cancer Res.
72
1998
141
196
8
Herman
JG
Hypermethylation of tumor suppressor genes in cancer.
Semin Cancer Biol.
9
1999
359
367
9
Knudson
AG
Antioncogenes and human cancer.
Proc Natl Acad Sci U S A.
90
1993
10914
10921
10
Baylin
SB
Herman
JG
DNA hypermethylation in tumorigenesis: epigenetics joins genetics.
Trends Genet.
16
2000
168
174
11
Cress
WD
Seto
E
Histone deacetylases, transcriptional control, and cancer.
J Cell Physiol.
184
2000
1
16
12
Jones
PL
Wolffe
AP
Relationships between chromatin organization and DNA methylation in determining gene expression.
Semin Cancer Biol.
9
1999
339
347
13
Herman
JG
Civin
CI
Issa
JP
et al
Distinct patterns of inactivation of p15INK4B and p16INK4A characterize the major types of hematological malignancies.
Cancer Res.
57
1997
837
841
14
Cameron
EE
Baylin
SB
Herman
JG
p15(INK4B) CpG island methylation in primary acute leukemia is heterogeneous and suggests density as a critical factor for transcriptional silencing.
Blood.
94
1999
2445
2451
15
Issa
JP
Zehnbauer
BA
Civin
CI
et al
The estrogen receptor CpG island is methylated in most hematopoietic neoplasms.
Cancer Res.
56
1996
973
977
16
Issa
JP
Zehnbauer
BA
Kaufmann
SH
et al
HIC1 hypermethylation is a late event in hematopoietic neoplasms.
Cancer Res.
57
1997
1678
1681
17
Melki
JR
Vincent
PC
Clark
SJ
Concurrent DNA hypermethylation of multiple genes in acute myeloid leukemia.
Cancer Res.
59
1999
3730
3740
18
Akama
TO
Okazaki
Y
Ito
M
et al
Restriction landmark genomic scanning (RLGS-M)-based genome-wide scanning of mouse liver tumors for alterations in DNA methylation status.
Cancer Res.
57
1997
3294
3299
19
Costello
JF
Fruhwald
MC
Smiraglia
DJ
et al
Aberrant CpG-island methylation has non-random and tumour-type-specific patterns.
Nat Genet.
24
2000
132
138
20
Okazaki
Y
Okuizumi
H
Sasaki
N
et al
An expanded system of restriction landmark genomic scanning (RLGS Ver. 1.8).
Electrophoresis.
16
1995
197
202
21
Plass
C
Weichenhan
D
Catanese
J
et al
An arrayed human NotI-EcoRV boundary library as a tool for RLGS spot analysis.
DNA Res.
4
1997
253
255
22
Gardiner-Garden
M
Frommer
M
CpG islands in vertebrate genomes.
J Mol Biol.
196
1987
261
282
23
Smiraglia
DJ
Fruhwald
MC
Costello
JF
et al
A new tool for the rapid cloning of amplified and hypermethylated human DNA sequences from restriction landmark genome scanning gels.
Genomics.
58
1999
254
262
24
Okazaki
Y
Okuizumi
H
Sasaki
N
et al
Protocols for RLGS gel production.
Restriction Landmark Genomic Scanning (RLGS).
Hayashizaki
Y
Watanabe
S
1997
17
21
Springer
New York, NY
25
Fruhwald
MC
O'Dorisio
MS
Rush
LJ
et al
Gene amplification in PNETs/medulloblastomas: mapping of a novel amplified gene within the MYCN amplicon.
J Med Genet.
7
2000
501
509
26
Freund
RJ
Wilson
WJ
Statistical Methods.
1997
Academic Press
San Diego, CA
27
Cheson
BD
Cassileth
PA
Head
DR
et al
Report of the National Cancer Institute-sponsored workshop on definitions of diagnosis and response in acute myeloid leukemia.
J Clin Oncol.
8
1990
813
819
28
Asou
H
Tashiro
S
Hamamoto
K
et al
Establishment of a human acute myeloid leukemia cell line (Kasumi-1) with 8;21 chromosome translocation.
Blood.
77
1991
2031
2036
29
Gallagher
R
Collins
S
Trujillo
J
et al
Characterization of the continuous, differentiating myeloid cell line (HL-60) from a patient with acute promyelocytic leukemia.
Blood.
54
1979
713
733
30
Takeda
K
Minowada
J
Bloch
A
Kinetics of appearance of differentiation-associated characteristics in ML-1, a line of human myeloblastic leukemia cells, after treatment with 12-O-tetradecanoylphorbol-13-acetate, dimethyl sulfoxide or 1-beta-D-arabinofuranosylcytosine.
Cancer Res.
42
1982
5152
5158
31
Taoka
T
Tasaka
T
Tanaka
T
et al
Characterization, growth, and differentiation of a human myeloid leukemia cell line, TI-1 cell.
Blood.
80
1992
46
52
32
Plass
C
Yu
F
Yu
L
et al
Restriction landmark genome scanning for aberrant methylation in primary refractory and relapsed acute myeloid leukemia: involvement of the WIT-1 gene.
Oncogene.
18
1999
3159
3165
33
Stephens
JC
Cavanaugh
ML
Gradie
MI
et al
Mapping the human genome: current status.
Science.
250
1990
237
244
34
Deloukas
P
Schuler
GD
Gyapay
G
et al
A physical map of 30,000 human genes.
Science.
282
1998
744
746
35
Batova
A
Diccianni
MB
Yu
JC
et al
Frequent and selective methylation of p15 and deletion of both p15 and p16 in T-cell acute lymphoblastic leukemia.
Cancer Res.
57
1997
832
836
36
Veigl
ML
Kasturi
L
Olechnowicz
J
et al
Biallelic inactivation of hMLH1 by epigenetic gene silencing, a novel mechanism causing human MSI cancers.
Proc Natl Acad Sci U S A.
95
1998
8698
8702
37
Chan
MF
Liang
G
Jones
PA
Relationship between transcription and DNA methylation.
Curr Top Microbiol Immunol.
249
2000
75
86
38
Sumiyama
K
Washio-Watanabe
K
Ono
T
et al
Human class III POU genes, POU3F1 and POU3F3, map to chromosomes 1p34.1 and 3p14.2.
Mamm Genome.
9
1998
180
181
39
Papaioannou
VE
Silver
LM
The T-box gene family.
Bioessays.
20
1998
9
19
40
Yi
CH
Terrett
JA
Li
QY
et al
Identification, mapping, and phylogenomic analysis of four new human members of the T-box gene family: EOMES, TBX6, TBX18, and TBX19.
Genomics.
55
1999
10
20
41
McGrath
KE
Palis
J
Expression of homeobox genes, including an insulin promoting factor, in the murine yolk sac at the time of hematopoietic initiation.
Mol Reprod Dev.
48
1997
145
153
42
Coles
LS
Diamond
P
Occhiodoro
F
et al
An ordered array of cold shock domain repressor elements across tumor necrosis factor-responsive elements of the granulocyte-macrophage colony-stimulating factor promoter.
J Biol Chem.
75
2000
14482
14493
43
Tenen
DG
Hromas
R
Licht
JD
Zhang
DE
Transcription factors, normal myeloid development, and leukemia.
Blood.
90
1997
489
519
44
Robertson
KD
Uzvolgyi
E
Liang
G
et al
The human DNA methyltransferases (DNMTs) 1, 3a and 3b: coordinate mRNA expression in normal tissues and overexpression in tumors.
Nucleic Acids Res.
27
1999
2291
2298
45
Bhattacharya
SK
Ramchandani
S
Cervoni
N
Szyf
M
A mammalian protein with specific demethylase activity for mCpG DNA.
Nature.
397
1999
579
583
46
Walsh
CP
Chaillet
JR
Bestor
TH
Transcription of IAP endogenous retroviruses is constrained by cytosine methylation.
Nat Genet.
20
1998
116
117
47
Fruhwald
MC
O'Dorisio
MS
Dai
Z
et al
Aberrant hypermethylation of the major breakpoint cluster region in 17p11.2 in medulloblastomas but not supratentorial PNETs.
Genes Chromosomes Cancer.
30
2001
38
47
48
Ganderton
RH
Briggs
RS
CpG island methylation and promoter usage in the parathyroid hormone-related protein gene of cultured lung cells.
Biochim Biophys Acta.
1352
1997
303
310
49
de Bustros
A
Nelkin
BD
Silverman
A
et al
The short arm of chromosome 11 is a “hot spot” for hypermethylation in human neoplasia.
Proc Natl Acad Sci U S A.
85
1988
5693
5697
50
Mrozek
K
Heinonen
K
Bloomfield
CD
Clinical importance of cytogenetics in acute myeloid leukaemia.
Bailliere's Best Pract Res Clinical Haematol.
14
2001
19
47
51
Fan
YS
Rizkalla
K
William
BF
Engel
CJ
Jumping translocations of 11q in acute myeloid leukemia and 1q in follicular lymphoma.
Cancer Genet Cytogenet.
118
2000
35
41
52
Kalantry
S
Delva
L
Gaboli
M
et al
Gene rearrangements in the molecular pathogenesis of acute promyelocytic leukemia.
J Cell Physiol.
173
1997
288
296
53
Schichman
SA
Caligiuri
MA
Gu
Y
et al
ALL-1 partial duplication in acute leukemia.
Proc Natl Acad Sci U S A.
91
1994
6236
6239
54
Caligiuri
MA
Strout
MP
Schichman
SA
et al
Partial tandem duplication of ALL1 as a recurrent molecular defect in acute myeloid leukemia with trisomy 11.
Cancer Res.
56
1996
1418
1425
55
Pitterle
DM
Jolicoeur
EM
Bepler
G
Hot spots for molecular genetic alterations in lung cancer.
In Vivo.
12
1998
643
658
56
Kim
HS
Crow
TJ
Human proto-oncogene Int-2/FGF-3: map position 11q13.3-q13.4.
Chromosome Res.
6
1998
579
57
Seshadri
R
Lee
CS
Hui
R
et al
Cyclin DI amplification is not associated with reduced overall survival in primary breast cancer but may predict early relapse in patients with features of good prognosis.
Clin Cancer Res.
2
1996
1177
1184
58
Thakker
RV
Bouloux
P
Wooding
C
et al
Association of parathyroid tumors in multiple endocrine neoplasia type 1 with loss of alleles on chromosome 11.
N Engl J Med.
321
1989
218
224
59
Schaffner
C
Idler
I
Stilgenbauer
S
et al
Mantle cell lymphoma is characterized by inactivation of the ATM gene.
Proc Natl Acad Sci U S A.
97
2000
2773
2778
60
Lin
SF
Lin
PM
Liu
TC
et al
Clinical implications of aberrant TSG101 transcripts in acute myeloblastic leukemia.
Leuk Lymphoma.
36
2000
463
466
61
Lee
MP
DeBaun
MR
Mitsuya
K
et al
Loss of imprinting of a paternally expressed transcript, with antisense orientation to KVLQT1, occurs frequently in Beckwith-Wiedemann syndrome and is independent of insulin-like growth factor II imprinting.
Proc Natl Acad Sci U S A.
96
1999
5203
5208
62
Smilinich
NJ
Day
CD
Fitzpatrick
GV
et al
A maternally methylated CpG island in KvLQT1 is associated with an antisense paternal transcript and loss of imprinting in Beckwith-Wiedemann syndrome.
Proc Natl Acad Sci U S A.
96
1999
8064
8069

Author notes

Christoph Plass, The Ohio State University, Division of Human Cancer Genetics, Medical Research Facility 494A, 420 West 12th Ave, Columbus, OH 43210; e-mail: [email protected].

Sign in via your Institution